Biomarker related to glioblastoma disease prognosis and application thereof

By using the SelK gene as a biomarker and targeting the SKP2/β-TrCP1/CDK4 axis signaling pathway, the problem of difficulty in predicting the long-term survival of glioblastoma patients in existing technologies has been solved, providing new therapeutic targets and drug screening methods, and significantly improving patient prognosis.

CN120608149APending Publication Date: 2025-09-09THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410902941.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-08
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately predict long-term survivors of glioblastoma patients. Common molecular markers such as MGMT promoter methylation, EGFR amplification, TERT promoter mutation, PTEN mutation, etc. cannot effectively predict patient prognosis. There is a lack of understanding of the molecular markers and intrinsic tumor biological mechanisms of long-term GBM survivors.

Method used

Using the SelK gene and its expression products as biomarkers, proteomic analysis revealed that SelK expression in glioblastoma patients was negatively correlated with prognosis. This provided the use of the SelK gene or its expression products in the preparation, evaluation or screening of drugs for the treatment of glioblastoma, and targeted the SKP2/β-TrCP1/CDK4 axis signaling pathway to construct an intervention treatment strategy.

Benefits of technology

The SelK gene and its expression products can be used as molecular markers for GBM prognosis assessment. By downregulating SelK expression, GBM cell proliferation can be inhibited, providing new therapeutic targets and drug screening methods, significantly improving patient prognosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004931099100000011
    Figure HDA0004931099100000011
  • Figure HDA0004931099100000021
    Figure HDA0004931099100000021
  • Figure HDA0004931099100000031
    Figure HDA0004931099100000031
Patent Text Reader

Abstract

The invention relates to application of a SelK gene or an expression product thereof as a biomarker for prognosis judgment of glioblastoma diseases. The invention discloses application of a SelK gene or an expression product of the SelK gene to preparation of a product for performing glioblastoma typing diagnosis, therapeutic schedule selection and / or prognosis evaluation by detecting the level of the SelK gene or the expression product of the SelK gene in a tumor sample obtained from an object. The research shows that the high-expression SelK gene and the protein expression product thereof are both in negative correlation with poor prognosis of glioblastoma, and survival analysis also proves that the overall prognosis of patients with low SelK expression is obviously superior to that of patients with high SelK expression, so that the SelK gene and the expression product thereof can be used as molecular markers for prognosis evaluation and treatment effect. The invention also provides an application of the targeted SKP2 / beta-TrCP1 / CDK4 axis signal channel in preparation, evaluation or screening of drugs for treating glioblastoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of the SelK gene as a biomarker related to glioblastoma disease prognosis and a SelK gene-related signaling pathway in the preparation, evaluation or screening of drugs for treating glioblastoma. Background Art

[0002] Gliomas are the most common primary malignant tumors of the central nervous system, accounting for approximately 78% of all primary malignant tumors of the central nervous system. The annual incidence of brain gliomas in my country is 5-8 per 100,000 patients, and the five-year mortality rate is second only to pancreatic and lung cancers among systemic tumors. Glioblastoma (GBM) is the most malignant type of IDH (isocitrate dehydrogenase) wild-type WHO grade 4 glioma, accounting for approximately 50% of primary malignant tumors of the central nervous system. Despite advances in surgical, medical, and radiotherapy treatments, the prognosis for GBM patients remains extremely poor, with a median survival of only 12-15 months and 1-, 2-, 3-, and 5-year survival rates of only 39.3%, 16.9%, 9.9%, and 5.5%, respectively. However, a small number of GBM patients survive beyond three years, referred to as long-term survivors. The molecular markers and underlying tumor biological mechanisms of these long-term GBM survivors remain largely unknown.

[0003] In recent years, molecular markers have demonstrated increasing importance in the diagnosis of GBM and in predicting patient survival and treatment response. However, currently available common molecular markers, including MGMT promoter methylation, EGFR amplification, TERT promoter mutation, and PTEN mutation, remain ineffective in accurately predicting long-term GBM survivorship. For example, studies have shown that GBM patients with MGMT promoter methylation have a relatively good prognosis, but their median survival is only 3.5–6 months longer than that of patients without MGMT promoter methylation. Burgenske et al. reported the largest comparative study of long-term GBM survivors (12 patients) and short-term GBM survivors (37 patients). They found no significant differences between the two groups in common GBM molecular markers, including TERT promoter mutation, PTEN mutation, TP53 mutation, EGFR amplification, and DNA copy number variation. However, further RNA sequencing analysis revealed differences in some signaling pathways. Michaelsen et al. used digital gene quantification technology to detect 14 differentially expressed genes in 20 GBM patients (6 long-term survivors and 14 short-term survivors), and found that CD34 expression may be a predictive marker for long-term survival. However, none of the above studies further explored the functions and related mechanisms of signaling pathways or molecular markers.

[0004] Therefore, starting from long-term GBM survivors, finding new prognostic molecular markers and studying their functions will help explore the mechanism of GBM progression and seek new targets. Summary of the Invention

[0005] To address the above issues, the inventors discovered that SelK can serve as a feasible clinical predictive indicator for the prognosis of glioblastoma (GBM) patients. At the same time, the inventors identified a new mechanism by which SelK promotes GBM cell proliferation by targeting the SKP2 / β-TrCP1 / CDK4 axis, indicating that SelK may be a potential therapeutic target for GBM.

[0006] The first aspect of the present invention provides the use of the SelK gene or its expression product as a biomarker for the prognosis of glioblastoma.

[0007] The present invention relates to the SelK gene, which was selected by the inventors through proteomic analysis. The inventors selected 10 freshly frozen GBM specimens (including 5 long-term survivors, surviving ≥36 months; 5 short-term survivors, surviving ≤12 months) for proteomic analysis and found that selenoprotein K (SelK) expression was significantly lower in long-term survivors than in short-term survivors. Further validation analysis of 88 GBM specimens showed that SelK expression was negatively correlated with patient prognosis. Survival analysis also confirmed that patients with low SelK expression had a significantly better overall prognosis than those with high SelK expression.

[0008] The SelK gene is one of the most important members of the selenoprotein family. Its protein is primarily localized to the endoplasmic reticulum membrane and cell membranes, participating in the regulation of oxidative stress, endoplasmic reticulum stress response, and endoplasmic reticulum-associated protein degradation. Previous studies have shown a close relationship between the SelK gene and tumorigenesis. For example, downregulating SelK expression in human choriocarcinoma cells enhances tumor cell proliferation, migration, and invasion, while overexpression has the opposite effect. Similarly, overexpression of SelK effectively inhibits the migration and invasion of gastric cancer BGC-823 cells and promotes apoptosis. Flow cytometry has shown that overexpression of SelK alters cytoplasmic calcium distribution. However, knocking down SelK expression in cervical cancer inhibits tumor cell proliferation and growth. Currently, the function and mechanism of SelK in GBM research remain unclear.

[0009] The present study showed that high expression of the SelK gene and its protein expression products were negatively correlated with poor prognosis of glioblastoma. Survival analysis also confirmed that the overall prognosis of patients with low SelK expression was significantly better than that of patients with high SelK expression, suggesting that the SelK gene and its expression products can be used as molecular markers for GBM prognosis assessment and treatment effect.

[0010] In the present invention, the human SelK gene sequence can be referenced to the U.S. National Center for Biotechnology Information (NIH) Gene ID: NM_001190318.1, and the specific sequence is shown in SEQ ID NO: 1:

[0011] atgcgtcatcactttcgttgaaaatatttgttttgttcattaaaagacatcggaatattattttattaaaaagtcgaagaaatatacg

[0012] aaaccatcatggtttacgtttccgcaggaggaatccaatcacagcgctccatgtggcgggtttcatttatatcggaatctttttg

[0013] gggacttattaattttattgttctcttcttcaagacaatggtccaaccagatcttacaaagcatggaagaggtttgcaatcaaact

[0014] actcagcgaaaccaaacggcggggatgattctggcccccgcagaagaatggggggtttcaagagaagtactggtccctc

[0015] acccccacctgctgcagggggtgggtgaggtcggtaaatgcttacctctaattctggggtaagcacctaaaaagggggtca

[0016] catttcctgtattgtaaaaaagtagaaattcttgcatagactatcagctgtataagaatattcctaagattattagaatagatgtag

[0017] atttatttggattggttttgtgatcccttttttattagaaataacttcattatatgctacatatgtatgtgtatattaatacatatatacat

[0018] gtgttgtatatttaatgatgggttctcactaaacctacctttggtgtgagaatcttgaggagatgaagtttttcttttattgttttgtaa

[0019] ataattctgatgcattgtgtgcaataatatgttgtgcatgtgacatcataatgcattgtctgatgctctattgttgtcattgtaaatat

[0020] gagaataaactaaatgatgtcataaa

[0021] Alternatively, the expression product of the glioma marker SelK gene includes SelK gene mRNA and / or SelK protein. The SelK protein sequence can be found in NCBI, ID: NP_001177247.1, and the specific sequence is shown in SEQ ID NO: 2.

[0022] MVYVSAGGIQ SQRSMWRVSF ISESFWGLIN FIVLFFKTMV QPDLTKHGRG LQSNYSAKPNGGDDSGPRRR MGGFKRSTGPSPPPAAGGGU GR

[0023] In another embodiment of the present invention, the inventors found that SelK was significantly upregulated in tissues of patients with shorter survival. In addition, in GBM patients, SelK expression was negatively correlated with overall survival. These findings indicate that SelK is an important marker for GBM prognosis and plays an important role in its development.

[0024] In another embodiment of the present invention, the SelK gene or its expression product can be used as a feasible clinical predictive indicator for the prognosis of glioblastoma (GBM) patients.

[0025] In another embodiment of the present invention, there is provided use of the SelK gene or its expression product in preparing a product for glioblastoma typing diagnosis, treatment regimen selection and / or prognosis assessment by detecting the level of the SelK gene or its expression product in a tumor sample obtained from a subject.

[0026] In another embodiment of the present invention, the present invention also provides a detection kit for diagnosis, screening and / or prognosis of GBM glioma, the detection kit comprising: a pretreatment reagent for pretreating a sample to be tested to obtain a sample, and a detection reagent for detecting the SelK gene expression product in the sample; wherein the SelK gene expression product is SelK gene mRNA or SelK protein.

[0027] In another embodiment of the present invention, a detection kit for the diagnosis, screening, and / or prognosis of GBM glioma is provided, comprising: a pretreatment reagent for pretreating a sample to be tested to obtain a sample; and a detection reagent for detecting mRNA of the SelK gene expression product in the sample; wherein the detection reagent comprises amplification primers. Preferably, the detection reagent for detecting mRNA of the SelK gene expression product in the sample comprises an upstream primer cggcctgtgtctatggtcg and a downstream primer cagtcgcctcagtaaagcca.

[0028] In another embodiment of the present invention, the present invention provides a detection kit for diagnosis, screening and / or prognosis of GBM glioma, the detection kit comprising: a pretreatment reagent for pretreating a sample to be tested to obtain a sample, and a detection reagent for detecting SelK protein, a product of SelK gene expression in the sample; wherein the detection reagent comprises an antibody that specifically recognizes / binds to SelK protein.

[0029] In another embodiment of the present invention, the present invention provides a detection kit for diagnosis, screening and / or prognosis of GBM glioma, which comprises an antibody that specifically recognizes / binds to SelK protein, wherein the antibody comprises a monoclonal antibody, a polyclonal antibody or a nanobody. In another preferred embodiment, the antibody is preferably a monoclonal antibody that can recognize human full-length or fragment SelK protein with an affinity Kd reaching nanomolar level (nM level, 10 -7 -10 -9 ) or higher.

[0030] The detection reagent for quantitatively detecting SelK protein can perform its function based on known immunological methods, such as Western blotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, immunohistochemistry, immunofluorescence labeling, etc., to quantitatively detect SelK protein.

[0031] The second aspect of the present invention provides the use of targeting the SKP2 / β-TrCP1 / CDK4 axis signaling pathway in the preparation, evaluation or screening of drugs for treating glioblastoma.

[0032] Studies have shown that SelK inhibits GBM cell proliferation through the β-TrCP1-mediated ubiquitination and CDK4 degradation pathway. By targeting the SKP2 / β-TrCP1 / CDK4 axis signaling pathway, a GBM stratification and targeted intervention treatment strategy with SelK as a new target has been established. By evaluating whether candidate drugs can downregulate SelK, their ability to inhibit GBM cell proliferation in vivo can be determined. This approach can be used to develop, evaluate, or screen potential drug candidates for the treatment of glioblastoma, laying the foundation for future clinical translation and the development of new treatments.

[0033] To investigate the potential role of SelK in GBM development, the inventors examined the expression of SelK in normal human astrocytes (NHA) and different human GBM cell lines. The data showed that SelK expression in human GBM cell lines (U87, A172, LN229, and U251) was higher than that in NHA cells ( Figure 1 E).

[0034] In another preferred experiment of the present invention, the inventors selected LN229 and U251 cell lines with high SelK expression and established SelK knockout stable cell lines using a knockout shRNA set (Open Biosystems). The data showed that downregulation of SelK inhibited the proliferation and growth of LN229 and U251 cells. Through these experiments, the inventors discovered that SelK may play a key role in the development of GBM cells in vitro.

[0035] To evaluate the effect of SelK on GBM proliferation in vivo, the inventors subcutaneously injected SelK knockdown cells LN229, U251, or unresponsive control cells into BALB / c nude mice to establish a xenograft tumor model. After 28 days, the growth and tumor volume of the mice and their tumors were evaluated ( Figure 2 A). The results showed that knockdown of SelK significantly inhibited the proliferation of LN229 and U251 cells in vivo, characterized by reduced tumor volume and weight. The inventors' simultaneous analysis of the proliferation marker Ki67 (IHC) in tumors showed that the protein expression levels of SelK and Ki67 were significantly suppressed in tumor tissues derived from SelK knockout cells (see Figure 2 ). The results suggest that downregulation of SelK may inhibit the proliferation of GBM cells in vivo.

[0036] In order to study the specific molecular mechanism by which SelK may affect GBM cell proliferation, the inventors used flow cytometry experiments to evaluate the cell cycle changes of GBM cells with and without SelK knockout. The results showed that knockout of SelK could successfully arrest GBM cells in the G0 / G1 phase (see Figure 3Based on these findings, western blotting was used to assess the expression of CDK2, CDK4, CDK6, CyclinD1, and CyclinE2, proteins involved in G0 / G1 cell cycle progression. The inventors found that when SelK was knocked down, only CDK4 protein expression was downregulated, suggesting that CDK4 may be a downstream target of SelK in inhibiting its cell cycle (see Figure 3 ).

[0037] To further confirm whether CDK4 is involved in cell cycle regulation through SelK, the inventors overexpressed CDK4 in LN229 (shSelK#1) and LN229 (shSelK#2) cells. ATP and EDU detection using these cell lines showed that CDK4 overexpression reversed the inhibitory effect of SelK knockdown on GBM cell proliferation. In another embodiment of the present invention, when CDK4 was overexpressed in U251 (shSelK#1) and U251 (shSelK#2) cells, the proliferation capacity of these cells was significantly increased. These results indicate that the knockdown of SelK partially inhibits the proliferation of GBM cells by downregulating the expression of CDK4, thereby promoting G / G phase arrest.

[0038] To explore the potential role of SelK in regulating CDK4 expression, the inventors experimentally analyzed the effects of SelK knockdown on CDK4 mRNA levels in LN229 and U251 cells. The results showed that SelK had no effect on CDK4 mRNA regulation. This phenomenon suggests that SelK may regulate CDK4 expression through a post-transcriptional pathway. To investigate the effect of ubiquitination on CDK4 protein stability, the inventors conducted a CHX (cycloheximide)-based tracking experiment. CDK4 protein expression decreased in LN229 (shSelK#1) and LN229 (shSelK#2) cells within 12 hours of CHX treatment. The results indicate that SelK inhibits CDK4 ubiquitination, thereby enhancing CDK4 protein turnover.

[0039] To investigate the mechanism by which SelK regulates CDK4 ubiquitination, the inventors evaluated ITCH (an E3 ubiquitin ligase of CDK4 that destabilizes CDK4 and inhibits the survival of colorectal cancer cells) and E6AP (CDK4 ubiquitination in HEK293 cells was determined by the orthogonal ubiquitin transfer (OUT) assay) in cell lines. In addition, the inventors searched the UbiBrowser database to analyze other E3 ligases that may be involved in the ubiquitin-dependent degradation of CDK4. Knockdown of SelK in LN229 and U251 cells only increased the expression of β-TrCP1, while the expression of other E3 ligases ITCH and E6AP did not change significantly (see Figure 3These data suggest that SelK regulates CDK4 expression and cell proliferation in part through β-TrCP1-mediated CDK4 protein degradation.

[0040] The inventors implemented an experimental plan to further elucidate whether CDK4 is regulated by the potential E3 enzyme β-TrCP1 and whether β-TrCP1 is involved in the malignant proliferation of GBM. The inventors constructed LN229 cells with stable β-TrCP1 knockout (shSelK#1) and examined the effect of β-TrCP1 knockout on cell proliferation using ATP and soft agar assays. The results showed that β-TrCP1 knockdown restored the inhibitory effect of SelK knockdown on LN229 cell growth, both in monolayer and anchorage-free conditions. We also assessed the effect of β-TrCP1 knockdown on CDK4 protein expression using Western blot and protein degradation assays. These data indicate that in LN229 (shSelK#1) cells, β-TrCP1 knockdown increased CDK4 expression and attenuated CDK4 protein decay, indicating that β-TrCP1 plays a key role in SelK-mediated GBM cell proliferation and CDK4 protein expression.

[0041] The inventors conducted experiments demonstrating that β-TrCP1 directly interacts with and ubiquitinates CDK4. To more fully elucidate the underlying mechanism, the inventors mapped the CDK4-interacting domain of β-TrCP1 and subsequently generated truncation mutants of β-TrCP1. The results indicate that the interaction between CDK4 and β-TrCP1 is primarily mediated through the β-TrCP1 WD40 domain and the CDK4 N-terminal region, ultimately supporting CDK4 ubiquitination.

[0042] To further explore the impact of SelK on GBM cell growth, the inventors conducted protein degradation experiments and found that SelK promoted CDK4 protein expression by increasing SKP2 protein levels and reducing β-TrCP1 stability. In another experiment implementing the present invention, the inventors found that SelK enhanced β-TrCP1 ubiquitination by increasing SKP2 protein levels, ultimately leading to decreased β-TrCP1 protein expression and promoting GBM cell proliferation.

[0043] The inventors conducted a large number of experiments to further clarify that SelK inhibits the release of calcium through the IP3R channel, thereby activating endoplasmic reticulum stress, upregulating SKP2, and promoting the ubiquitination of β-TrCP1.

[0044] The inventors detected the expression levels of CDK4 and β-TrCP1 in GBM tissue samples (IHC) in clinical samples. The results showed that compared with the relative expression levels of GBM patients with long survival, CDK4 was significantly upregulated in the tissue samples of 4 GBM patients with short survival, while β-TrCP1 was significantly downregulated in the tissues of GBM patients with short survival (see Figure 6 ).

[0045] During drug screening, if the drug under evaluation can significantly downregulate SelK, it will clearly have the ability to inhibit GBM cell proliferation in vivo. By targeting the SKP2 / β-TrCP1 / CDK4 axis signaling pathway, potential candidate drugs for the treatment of glioblastoma can be prepared, evaluated, or screened. This GBM stratification and targeted intervention treatment strategy using the SelK gene as a new target may lay the foundation for future clinical translation and the development of new treatment methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Attachment Figure 1 :SelK expression is upregulated in human GB tissue with poor prognosis.

[0047] (A) Quantitative proteomic analysis of TMT labeling, with up- and down-regulated proteins displayed as a volcano plot.

[0048] (B) Graphene oxide enrichment analysis of upregulated proteins.

[0049] (C) Venn diagram showing proteomic analysis of the top three cluster-associated proteins and the top ten differentially expressed proteins. (D) Differential expression analysis of SelK mRNA in GB tissues from the TCGA database (MST is median survival time). (E) Survival curve analysis of the relationship between SelK expression and overall survival (OS) of patients using TCGA data.

[0050] (F) Immunohistochemical analysis of SelK protein expression in GB tissue (n=88). (MST is median survival time). (G) SelK protein expression levels were analyzed by calculating IOD / area.

[0051] (H) Survival curves show that SelK expression is correlated with overall survival (n = 88). *p < 0.05. Data are presented as mean ± SD. Log-rank analysis was used for survival analysis.

[0052] Attachment Figure 2 : SelK is upregulated in human GB cell lines and its downregulation can inhibit the growth of GB cells.

[0053] in:

[0054] (A) Expression of SelK protein in normal astrocytes (NHA) and human GB cell lines (Western blot). The numbers below represent the ratio of the gray value of the SelK protein band to the internal control.

[0055] B) Efficiency of downregulating SelK protein expression in LN229 and U251 stable cell lines (Western blot).

[0056] (C, D) ATP assays to determine the effect of SelK knockdown on LN229 and U251 cell proliferation (each experiment was repeated three times).

[0057] (E, F) Soft agar assay was used to determine the effect of SelK knockdown on the proliferation of LN229 and U251 cells.

[0058] (G,H) Cloning assay to determine the effect of SelK knockdown on the proliferation of LN229 and U251 cells. (I,J) EdU assay to determine the effect of SelK knockdown on the DNA replication activity of LN229 and U251 cells.

[0059] (K) Efficiency of SelK protein overexpression in U87 and A172 stable cell lines (Western blot).

[0060] (L, M) The effect of SelK overexpression on the proliferation of U87 and A172 cells was determined by ATP assay (each experiment was repeated three times).

[0061] (N, O) Soft agar assay to determine the effect of SelK overexpression on the proliferation of U87 and A172 cells. (P, Q) Cloning assay to determine the effect of SelK overexpression on the proliferation of U87 and A172 cells. *p < 0.05, indicating statistically significant differences. Data are expressed as mean ± SD.

[0062] Attachment Figure 3 :Knockdown of SelK significantly inhibited the proliferation of GB cells in vivo.

[0063] (A) Nude mice were injected with GB cells LN229 (Nonsense), U251 (Nonsense), and SelK knockout cells on day 0; mice were euthanized 28 days later, and tumors were isolated.

[0064] (BE) Mice and their tumors were photographed and weighed after 28 days. Tumor volumes were measured every 4 days and tumor growth curves were drawn.

[0065] (F, G) SelK protein levels in subcutaneous SelK-expressing GB tumors of nude mice (IHC).

[0066] (H, I) Ki67 protein levels in subcutaneous GB tumors of nude mice heterologously expressing SelK (IHC).

[0067] *p<0.05, the difference is statistically significant. All data are expressed as mean ± SD.

[0068] Attachment Figure 4 :Downregulation of CDK4 plays a key role in the G0 / G1 arrest of GB cells induced by SelK downregulation.

[0069] (AC) Flow cytometric analysis of the cell cycle profiles of LN229 and U251 cells after SelK knockout.

[0070] (D) Levels of key proteins involved in G0 / G1 phase progression (Western blot).

[0071] (E) Western blot analysis revealed that CDK4 was stably overexpressed in LN229 (shSelK#1) and LN229 (shSelK#2) cells.

[0072] (F, G) The effect of CDK4 overexpression on the proliferation of LN229 (shSelK#1) and LN229 (shSelK#2) cells was detected by ATP assay (each experiment was repeated 3 times).

[0073] (H, I) Effects of CDK4 overexpression on the proliferation of LN229(shSelK#1) and LN229(shSelK#2) cells, LN229(shSelK#1 / CDK4) and LN229(shSelK#2 / CDK4), and on the number of cell colonies formed.

[0074] (J,K) Clonality assay.

[0075] (LO) Effect of CDK4 overexpression on DNA replication activity of LN229(shSelK#1) and LN229(shSelK#2) (EdU assay).

[0076] *p<0.05, the difference is statistically significant. All data are expressed as mean ± SD.

[0077] Attachment Figure 5 Downregulation of SelK promotes ubiquitin-dependent degradation of CDK4 by upregulating β-TrCP1 expression.

[0078] (A, B) qPCR detection of CDK4 mRNA expression level.

[0079] (C) Western blot detection of CDK4 degradation rate.

[0080] (D) The UbiBrowser database predicted molecules that may be involved in regulating cdk4 protein degradation.

[0081] (E) Venn diagram screening of E3 enzymes involved in the regulation of cdk4 protein degradation.

[0082] (F) Protein levels of β-TrCP1 and E3 ligase, a known target of CDK4 (Western blot).

[0083] (G) β-TrCP1 knockdown efficiency (Western blot). (H,I) Effect of β-TrCP1 knockdown on LN229 (shSelK#1) cell proliferation (soft agar assay).

[0084] (J) Effect of β-TrCP1 knockdown on LN229 (shSelK#1) cell proliferation (ATP assay).

[0085] (K) Analysis of CDK4 levels in LN229 (shSelK#1 / shβ-TrCP1#2 and #3) and LN229 (shSelK#1 / Nonsense) cells (Western blot).

[0086] (L) CDK4 protein degradation after β-TrCP1 knockdown (Western blot).

[0087] *p<0.05, the difference is statistically significant. All data are expressed as mean ± SD

[0088] Attachment Figure 6 :Clinical sample β-TrCP1 directly interacts with CDK4 and ubiquitinates. Among them:

[0089] (A) Co-IP method was used to verify the relationship between β-TrCP1 and CDK4 in LN229 cells.

[0090] (B) Ubiquitination of β-TrCP1 to CDK4 was detected in LN229 cells. (C) Effect of β-TrCP1 knockdown on CDK4 ubiquitination in LN229 cells (ubiquitination assay).

[0091] (D) Schematic diagram of the HA-β-TrCP1 domain deletion construction.

[0092] (E) Co-IP assay was used to detect the interaction between CDK4 and β-Trcp1 domains in LN229 cells. (F) Ubiquitination assay was used to detect the ubiquitination between CDK4 and β-Trcp1 domains in LN229 cells.

[0093] (G) Schematic diagram of the GFP-CDK4 domain deletion structure.

[0094] (H) Co-IP detection of the interaction between β-TrCP1 and CDK4 domain in LN229 cells.

[0095] Attachment Figure 7 :SelK upregulates SKP2 and promotes SKP2-mediated β-TrCP1 ubiquitination.

[0096] (A, B) qPCR detection of β-TrCP1 mRNA levels.

[0097] (C) Western blot detection of the degradation rate of β-TrCP1 protein.

[0098] (D) Protein levels of known E3-ligases targeting β-TrCP1 (Western blot). (E) Verification of the efficiency of stable overexpression and β-TrCP1 protein expression after SKP2 overexpression (Western blot).

[0099] (F) ATP assay was used to detect the effect of SKP2 overexpression on the malignant proliferation of LN229 (shSelK#1) cells (each experiment was repeated 3 times independently).

[0100] (G,H) Effects of SKP2 overexpression on the malignant proliferation of LN229 (shSelK#1) cells (soft agar assay). (I) Degradation of β-TrCP1 protein after SKP2 overexpression (Western blot).

[0101] (J) CDK4 protein degradation after SKP2 overexpression (Western 876 blot).

[0102] *p<0.05, the difference is statistically significant. All data are expressed as mean ± SD.

[0103] Attachment Figure 8 :SelK downregulation releases calcium through IP3R channels to activate endoplasmic reticulum stress, thereby downregulating SKP2.

[0104] (A, B) Detection of SKP2 mRNA levels by qPCR.

[0105] (C) Detection of major markers of ER stress (Western blot).

[0106] (D) After LN229 (Nonsense) and 881U251 (Nonsense) cells were treated with 3 μM TM for 0, 6, 12, and 24 h, the expression of SKP2 protein was detected.

[0107] (E) After LN229(shSelK#1), LN229(shSelK#2), U251(shSelK#1), and U251(shSelK#2) cells were treated with 1 mM 4-PBA for 12 h, the expression of SKP2 and GRP78 proteins was detected.

[0108] (F) LN229 (Nonsense) and U251 (Nonsense) cells were treated with 3 μM TM for 0, 6, 12, and 24 h, and SKP2 mRNA levels were detected by qPCR.

[0109] (G,H) SKP2 mRNA levels were measured by qPCR in LN229(shSelK#1), LN229(shSelK#2), U251(shSelK#1), and U251(shSelK#2) cells after exposure to 1 mM 4-PBA for 12 hours. (IL) Intracellular calcium levels were measured by Calbryte 630 staining in LN229 and U251 cells, and after pretreatment with 2-apb (50 μM) and dantrolene (25 μM) for 2 hours. Intracellular calcium levels were measured by flow cytometry.

[0110] *p<0.05, the difference is statistically significant. All data are expressed as mean ± SD.

[0111] Attachment Figure 9 : Correlation between SelK, CDK4 and β-TrCP1 protein levels in clinical samples.

[0112] (A, B) CDK4 expression (IHC).

[0113] (C) Correlation analysis between SelK and cdk4 expressions.

[0114] (D, E) β-TrCP1 expression (IHC).

[0115] (F) Correlation analysis between SelK and β-TrCP1 expression.

[0116] (G) Graphical summary.

[0117] *p<0.05, the difference is statistically significant. All data are expressed as mean ± SD. DETAILED DESCRIPTION

[0118] The present invention is further described below with reference to specific examples and accompanying drawings. In the following examples, the experimental methods without specific conditions are generally based on conventional techniques in the art, and the reagents and raw materials used are all commercially available.

[0119] Experimental data are presented as mean ± standard deviation. All data were processed and plotted using Prism software (version 6.0, GraphPad, San Diego, CA). For each endpoint, differences between the two groups at a given time point were compared using the Student's t-test. A p-value of ≤ 0.05 was considered statistically significant.

[0120] Example 1 Clinical specimens, cell culture and transfection

[0121] A total of 88 clinical GBM samples were provided by the First Affiliated Hospital of Wenzhou Medical University (Zhejiang, China). The collection of all samples was approved by the Clinical Research Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University (Permit No. 2023-R262). NHA astrocytes were purchased from ScienCell (San Diego); human GBM cells U87, A172, LN229, and U251 were purchased from ATCC (Manassas, VA). All cell lines were confirmed by STR typing and were error-free. U87 and U251 cells were cultured in minimal essential medium (MEM; Gibco, #11095-080). NHA, A172, and LN229 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, #11995-065). All culture media contained 10% fetal bovine serum (FBS, Gibco, #10437-028). All cells were cultured in a 37°C, 5% CO2 incubator.

[0122] Clinical GBM samples found that the survival of most GBM patients was ≤1 year, but a few patients still had a survival of ≥3 years. Comprehensive analysis of clinical data found that there was no statistical difference in age and the prognosis of patients with a pathological diagnosis of GBM (with wild-type isocitrate dehydrogenase [IDH]) who all underwent concurrent radiotherapy was significantly different. The 10 patient tissue samples obtained were divided into two groups according to survival time. Then all samples were subjected to TMT-labeled quantitative proteomic analysis. Figure 1 Volcano map ( Figure 1 As shown in A), there are 349 up-regulated proteins and 560 down-regulated proteins differentially expressed between the two groups. SelK was found to be one of the up-regulated proteins.

[0123] Based on these findings, we analyzed SelK expression in 88 GBM tissues by immunohistochemistry to investigate its potential role in GBM development. The results were then analyzed in the context of patient survival. These analyses revealed that SelK was significantly upregulated in tissues from patients with shorter survival ( Figure 1 B-1C). In addition, in GBM patients (n=88), SelK expression was negatively correlated with overall survival ( Figure 1D) These findings suggest that SelK may be an important marker for GBM prognosis and play an important role in its development.

[0124] Western blots were used to detect the expression of SelK in human normal astrocytes (NHA) and different human GBM cell lines. The results showed that the expression of SelK in human GBM cell lines (U87, A172, LN229 and U251) was higher than that in NHA cells ( Figure 1 E). Based on SelK expression analysis, LN229 and U251 cell lines with high SelK expression were selected, and SelK knockout stable cell lines were established using a knockout shRNA set (Open Biosystems). Western blot confirmed the knockdown effect, and shSelK#1 and shSelK#2 were selected to investigate the role of SelK in GBM development ( Figure 1 F).

[0125] Example 2 Soft agar colony formation assay (soft agar)

[0126] First, a low-gel (containing 0.5% soft agar and 10% FBS-basal medium Eagle [BME]) was prepared on the bottom of a 6-well culture plate. After solidification, an upper gel (10% FBS-BME containing 0.33% agar) containing a certain number of cells (i.e., 10^4 cells) was overlaid. The plate was then incubated at 37°C in 5% CO2 for 2-3 weeks. The cell colonies in the culture dish were then photographed using a microscope equipped with a camera; all colonies containing >32 cells were counted and analyzed. After SelK knockdown, the number of cell colonies in both LN229 and U251 cells was reduced compared to the non-knockdown group. This result indicates that SelK downregulation inhibits the proliferation and growth of LN229 and U251 cells and that SelK plays a key role in the development of GBM cells in vitro.

[0127] Example 3 Nude mouse xenograft model

[0128] This study was approved by the Experimental Animal Ethics Committee of Wenzhou Medical University. BALB / c nude mice (female, 3-4 weeks old) were purchased from GemPharmatech (Nanjing, Jiangsu, China) and housed in the SPF-grade experimental area of ​​the Wenzhou Medical University Animal Center at a temperature of 20-26°C and a relative humidity of 40-70%. All mice had free access to standard rodent chow and filtered tap water. After approximately one week of feeding, the mice were randomly divided into three groups and treated with Nonsense, shSelK#1, or shSelK#2, respectively (n = 6 / group).

[0129] Each mouse was injected subcutaneously in the right flank with 3×10^6 LN229 (Nonsense), LN229 (shSelK#1), LN229 (shSelK#2), U251 (Nonsense), U251 (shSelK#1), and U251 (shSelK#2) cells. Three weeks later, when tumors reached an appropriate size, all mice were euthanized by cervical dislocation. At necropsy, tumors were excised, measured and weighed, and photographed.

[0130] Analysis showed that tumor volume and weight decreased ( Figure 3 B-3E). Simultaneous analysis of the proliferation marker Ki67 (IHC) in tumors showed that the protein expression levels of SelK and Ki67 were significantly suppressed in tumor tissues derived from SelK knockout cells ( Figure 3 These results indicate that downregulation of SelK inhibits the proliferation of GBM cells in vivo.

[0131] Example 4 Detection of CDK4 mRNA Expression by Real-time Fluorescence Quantitative PCR (qRT-PCR)

[0132] Total RNA was extracted from 5 × 10^5 cells using TRIzol reagent (Invitrogen, #15596018). Total RNA concentration was quantified using a BioDrop μLite spectrophotometer (BioDrop, Cambridge, UK), and cDNA was generated by PCR using a reverse transcription reagent (Takara, #RR037A). All procedures were performed according to the manufacturer's instructions. The primers used had an upstream sequence of cggcctgtgtctatggtcg and a downstream sequence of cagtcgcctcagtaaagcca.

[0133] qPCR experiments were performed to analyze the effect of SelK knockdown on CDK4 mRNA levels in LN229 and U251 cells. The results showed that SelK had no effect on the regulation of CDK4 mRNA ( Figure 5 This phenomenon suggests that SelK may regulate the expression of CDK4 in a post-transcriptional manner.

[0134] Example 5 Western blot analysis of ubiquitin ligase

[0135] Equal numbers of U251 and LN229 (Nonsense, shSelK#1 and shSelK#2) cells (10^6) were lysed on ice for 30 seconds to 1 minute using cell lysis buffer (containing 10% SDS, 100mM Na3VO4, 1M Tris-HCl [pH 7.4]), boiled, and sonicated. After centrifugation for 10 minutes, the protein concentration in the supernatant was measured using a NanoDrop One system (Thermo Fisher Scientific, 479, USA). Each protein sample was homogenized, and equal amounts of protein were loaded into each well of a 10% or 12% SDS-PAGE gel, followed by electrophoresis. The gel contents were electrotransferred to a PVDF membrane, and each membrane was incubated in TBS (Tris-buffered saline, pH 7.4) containing 5% nonfat dry milk for 60 minutes at room temperature.

[0136] Each membrane was then placed in a TBST (TBS-0.1% Tween-20) solution containing the specific primary antibody (GAPDH, β-TrCP1, ITCH, and E6AP) (at the manufacturer's recommended dilution) and incubated overnight at 4°C with gentle shaking. The next day, each membrane was rinsed three times with TBST and then incubated in a 5% skim milk solution containing the designated secondary antibody (at the manufacturer's recommended dilution) at 4°C for 4 h. After a final rinse with TBST, each membrane was treated with developer solution to visualize all bound antibodies. In all cases, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was assessed to monitor gel expression. Finally, all membranes were scanned using a TyphoonFLA 7000 Phosphor 495 Imaging System (GE Healthcare). All protein expression values ​​were then normalized to GAPDH levels.

[0137] The results showed that knockdown of SelK in LN229 and U251 cells only increased the expression of β-TrCP1, while the expression levels of other E3 ligases ITCH and E6AP remained relatively unchanged ( Figure 5 F). Taken together, these data suggest that SelK regulates CDK4 expression and cell proliferation, in part, through β-TrCP1-mediated CDK4 protein degradation.

[0138] Example 6 Immuno-colocalization analysis of TrCP1 and CDK4 proteins

[0139] Cells were transiently transfected with HA-β-TrCP1 and GFP-CDK4 plasmids at a 1:1 ratio. Thirty-six hours after transfection, both proteins were co-expressed in the cells. Cells were then lysed on ice using cell lysis buffer (Cell Signaling Technology, #9803) and a complete protein inhibitor cocktail (Roche, #04693116001). After high-speed centrifugation (13,000 × g) for 10 minutes, each supernatant was collected and protein concentration was determined using a BCA assay kit (Thermo Fisher Scientific, #23225). For immunoprecipitation, equal amounts of labeled magnetic beads, anti-HA-tagged monoclonal antibody magnetic beads (MBL, M180-11) and anti-GFP-tagged monoclonal antibody magnetic beads (MBL, D153-8), were incubated with equal amounts of lysed protein for 4–5 hours at 4°C. Subsequently, the beads were washed several times with cell lysis buffer to remove unbound protein. The pellet was then rinsed with cell lysis buffer, resuspended in cell lysis buffer, and boiled for 5 minutes. The supernatant of the solution was then collected using an MBL magnetic stand system, and the separated proteins were analyzed by Western blotting.

[0140] The results showed that β-TrCP1 directly interacts with CDK4 ( Figure 4 A), and promotes its ubiquitination status ( Figure 4 B). In addition, knockdown of β-TrCP1 by shRNA reduced the ubiquitination of GFP-CDK4 ( Figure 4 C) Thus, the data clearly demonstrate that β-TrCP1 not only directly interacts with CDK4 protein but also mediates its ubiquitination.

[0141] Example 7 SelK upregulates SKP2 and promotes SKP2-mediated β-TrCP1 ubiquitination

[0142] 1) Western blot was used to detect the expression of β-TrCP1 (SKP2 and SMURF2) in SelK knockdown GB cells. The detection method was the same as that in Example 5.

[0143] The data showed that although SMURF2 protein levels did not change significantly, SKP2 levels were consistently downregulated in these cells ( Figure 7 D). Therefore, these data suggest that SelK may promote CDK4 protein expression by increasing SKP2 protein levels and reducing β-TrCP1 expression.

[0144] 2) SKP2 was overexpressed in LN229 (shSelK#1), and the protein level of β-TrCP1 was detected using the same detection method as in Example 5.

[0145] The results showed that β-TrCP1 protein levels were decreased in SelK-knockdown cells with SKP2 overexpression ( Figure 7 E). Further analysis showed that SKP2 overexpression led to increased proliferation of LN229(shSelK#1) cells compared with control cells, as shown by ATP and soft agar assays ( Figure 7 F-7H). Compared with control cells, the turnover rate of β-TrCP1 protein was higher in cells with SelK knockdown and SKP2 overexpression ( Figure 7 I).

[0146] Example 8 Knockdown of SelK activates endoplasmic reticulum stress and downregulates SKP2

[0147] 1) Real-time PCR was performed to detect the level of SKP2 mRNA in SelK knockdown cells and control cells.

[0148] The results showed that SKP2 mRNA levels were significantly decreased after SelK knockdown in LN229 and U251 cells, which was consistent with the decreased SKP2 protein expression ( Figure 8 A-8B).

[0149] 2) Western blot was used to examine the levels of ER stress-related proteins GRP78, ATF6, IRE1, PERK, ATF4, and P-eIF2α34 in SelK knockdown and control cells. Since IRE1 and PERK are functionally active in their phosphorylated forms, the corresponding phosphorylated forms were also evaluated.

[0150] The results showed that each of these endoplasmic reticulum stress-related proteins increased in the SelK knockdown groups of LN229 and U251 cells compared with the control group ( Figure 8 C) This indicates that the reduction of SelK leads to an increase in ER stress-related proteins, thereby increasing ER stress.

[0151] 3) LN229 and U251 SelK knockdown cells were treated with the ER stress inducer tunicamycin(TM) and the ER stress inhibitor 4-phenylbutyrate (4-PBA). SKP2 expression was then detected by Western blot and qPCR.

[0152] Western blot results showed that as the duration of TM increased, the expression of SKP2 protein decreased ( Figure 8D). 4-PBA treatment for 12 hours in LN229 and U251 SelK knockdown cells also affected the expression of SKP2 protein. The results showed that after inhibiting ER stress by knocking down SelK, GRP78 protein expression was downregulated and SKP2 protein expression was upregulated compared with untreated cells ( Figure 8 E). qPCR detection showed that in SelK knockdown cells of LN229 and U251, inhibition of ER stress with 4-PBA significantly increased SKP2 mRNA levels ( Figure 8 G-8H).

[0153] In summary, SelK knockdown induced ER stress, leading to a decrease in SKP2 protein levels through transcriptional regulation.

[0154] Example 9 Downregulation of SelK activates endoplasmic reticulum stress by releasing calcium through IP3R channels

[0155] To further confirm whether ER stress is mediated by calcium ion channels, the inventors performed calcium ion detection. SelK knockdown cells were treated with dantrolene and 2-aminoethoxydiphenyl borate (2-APB), RyR and PI3R channel inhibitors, respectively. Cells were harvested from the culture dish and a suspension was prepared in a 1.5 ml tube. 500 μL HBSS and 0.5 μL (5 mM) Calbryte were added to each tube. TM 630AM (AAT Bioquest, Sunnyvale, CA, USA) and incubated at room temperature for 1 hour according to the manufacturer's instructions. The cells were then washed twice with HBSS to remove excess dye and immediately analyzed using the CytoFLEX flow system, measuring fluorescence intensity at 570 nm. At least 3 samples were acquired in each case.

[0156] The results showed that 2-APB treatment led to a decrease in Ca2+ levels in GB cells, which was caused by the inhibition of IP3R channels, resulting in a decrease in the release of Ca2+ ions from the ER to the cytoplasm. However, the effect of dantrolene treatment was not the same ( Figure 8 I-8L). This suggests that SelK may induce endoplasmic reticulum stress by affecting IP3R channels, thereby leading to intracellular Ca 2+ Changes in ion levels.

[0157] Example 10 Correlation between SelK, CDK4, and β-TrCP1 protein levels in clinical samples

[0158] To further explore the expression and expression correlation of SelK and its downstream genes, the inventors used immunohistochemistry to analyze the expression levels of CDK4, β-TrCP1, and GRP78 in nude mouse tumor tissue samples and GB tissue samples (IHC). IHC staining was performed using a commercial kit (Boster Bio, #SA1022) containing 3% H2O2, 5% BSA, rabbit secondary antibody, SABC (StreptAvidin-Biotin Complex), and DAB (3,3'-diaminobenzidine) in combination with specific primary antibodies against SelK (Invitrogen, #PA5-52529), Ki67 (Abcam, #ab16667), β-TrCP1 (Abcam, #ab233739), or CDK4 (Proteintech, #11026-1-AP) according to the manufacturer's instructions. Each tissue section was analyzed with a single primary antibody to avoid misrepresentation of total staining intensity (due to the use of a single type of secondary antibody). All stained samples were ultimately evaluated for staining intensity using a Nikon Eclipse Ni microsystem (DS-Ri2) and Image Pro Plus (v.6.0, Media Cybernetics, Rockville, MD, USA) to capture images and calculate the integrated optical density of each stained area (IOD / area).

[0159] The results showed that in tumors with SelK knockdown, GRP78 and β-TrCP1 were significantly increased, and CDK4 was significantly decreased. Compared with samples from GB patients with longer survival, CDK4 was significantly upregulated in tissue samples from GB patients with short survival ( Figure 9 A-9B), β-TrCP1 was significantly downregulated in tissues of GB patients with short survival ( Figure 9 D-9E). In general, despite the Figure 8 The correlation observed in F was moderate, but SelK expression was positively correlated with CDK4 expression and negatively correlated with β-362TrCP1 expression ( Figure 9 C,9F).

[0160] Studies have shown that SelK inhibits GBM cell proliferation through the β-TrCP1-mediated ubiquitination and CDK4 degradation pathway. By targeting the SKP2 / β-TrCP1 / CDK4 axis signaling pathway, a GBM stratification and targeted intervention treatment strategy with SelK as a new target has been established. By evaluating whether candidate drugs can downregulate SelK, their ability to inhibit GBM cell proliferation in vivo can be determined. This approach can be used to develop, evaluate, or screen potential drug candidates for the treatment of glioblastoma, laying the foundation for future clinical translation and the development of new treatments.

Claims

1. Use of the SelK gene or its expression product as a biomarker for the prognosis of glioblastoma.

2. The use according to claim 1, characterized in that: SelK expression is negatively correlated with patient prognosis, and patients with low SelK expression have a better overall prognosis than those with high SelK expression.

3. The use according to claim 1, characterized in that: The expression product of the SelK gene includes SelK gene mRNA and / or SelK protein, wherein the SelK protein sequence is shown in SEQ ID NO:

2.

4. Use of the SelK gene or its expression product in preparing a product for glioblastoma typing diagnosis, treatment regimen selection and / or prognosis assessment by detecting the level of the SelK gene or its expression product in a tumor sample obtained from a subject.

5. A detection kit for diagnosis, screening and / or prognosis of GBM glioma, comprising: A pretreatment reagent for pretreating a sample to be tested to obtain a sample, and a detection reagent for detecting the SelK gene expression product in the sample; wherein the SelK gene expression product is SelK gene mRNA or SelK protein.

6. A detection kit for diagnosis, screening and / or prognosis of GBM glioma, comprising: A pretreatment reagent for pretreating a sample to be tested to obtain a sample, and a detection reagent for detecting the mRNA of the SelK gene expression product in the sample; wherein the detection reagent comprises an amplification primer.

7. A detection kit for diagnosis, screening and / or prognosis of GBM glioma, comprising: A pretreatment reagent for pretreating a sample to be tested to obtain a sample, and a detection reagent for detecting SelK protein, the expression product of SelK gene in the sample; wherein the detection reagent includes an antibody that specifically recognizes / binds to SelK protein.

8. Use of targeting the SKP2 / β-TrCP1 / CDK4 axis signaling pathway in the preparation, evaluation or screening of drugs for the treatment of glioblastoma.

9. The use according to claim 8, characterized in that: SelK inhibits the proliferation of glioblastoma cells through the β-TrCP1-mediated ubiquitination and CDK4 degradation pathway.

10. The use according to claim 8, characterized in that: By evaluating whether a candidate drug can induce the downregulation of SelK, it is determined whether it has the ability to inhibit the proliferation of GBM cells in vivo, thereby being used to prepare, evaluate or screen potential candidate drugs for the treatment of glioblastoma.