Specific oligonucleotide fluorescence in-situ hybridization probe library for accurately identifying tartary buckwheat chromosome 5-8 and application of specific oligonucleotide fluorescence in-situ hybridization probe library
By constructing an oligonucleotide fluorescence in situ hybridization probe library specific for buckwheat chromosomes 5-8, the problem of difficulty in distinguishing homologous chromosomes in buckwheat was solved, and high-resolution karyotype analysis and genetic breeding support were achieved.
Patent Information
- Application Number
- CN202510759093.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-09-09
AI Technical Summary
Due to the small size of buckwheat chromosomes and low karyotype resolution, there is a lack of specific FISH probes, which makes it impossible to effectively distinguish homologous chromosomes, limiting the genetic improvement and basic research of buckwheat.
Single-copy oligonucleotide sequences specific for chromosomes 5-8 were screened from the whole genome of buckwheat to construct an oligonucleotide fluorescence in situ hybridization probe library. Specific primers were added to both ends of each sequence. Through PCR amplification and fluorescent labeling, a probe library that can accurately identify homologous chromosomes of buckwheat was formed.
High-resolution karyotype analysis of buckwheat chromosomes has been achieved, which can accurately identify and characterize the chromosome structural characteristics of buckwheat, supporting genetic breeding and cytological identification.
Smart Images
Figure CN120608170A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of cytogenetics research, and in particular to a specific oligonucleotide fluorescence in situ hybridization probe library for accurately identifying chromosomes 5 to 8 of tartary buckwheat and its application. Background Art
[0002] Buckwheat belongs to the genus Fagopyrum in the Polygonaceae family. Buckwheat includes two cultivated species: tartary buckwheat (Fagopyrum tataricum (L.) Gaertn) and sweet buckwheat (Fagopyrum esculentum Moench). Tartary buckwheat, with its high flavonoid, dietary fiber, and mineral content, has been designated by the Food and Agriculture Organization of the United Nations as a globally emerging crop for both food and medicine. Currently, tartary buckwheat faces severe variability and a shortage of germplasm resources, creating an urgent need for new germplasm. Artificial mutagenesis and hybridization techniques can create chromosomal variants and are important avenues for genetic improvement of tartary buckwheat. However, due to the small size of buckwheat chromosomes (1-3 μm), low karyotype resolution, and a lack of cytological markers, identification of homologous chromosomes and chromosomal variants in buckwheat remains difficult.
[0003] Fluorescence in situ hybridization (FISH) is a widely used cytogenetic method for studying chromosome identification and chromosome structural variation. Currently, this method has been successfully applied to identify chromosomes in plants such as potato, rice, maize, sugarcane, and morning glory. Due to the lack of chromosome-specific DNA probes, establishing a FISH-based chromosome identification system in non-model species is often challenging. Fluorescence in situ hybridization has been used to some extent in buckwheat research, but universal ribosomal DNA sequences such as 5S rDNA, 25S rDNA, and 45S rDNA are used as FISH probes. Currently, buckwheat still lacks specific FISH probes, and homologous chromosomes cannot be effectively distinguished at the cellular level.
[0004] Oligonucleotide fluorescence in situ hybridization (Oligo-FISH) is a fluorescence in situ hybridization technique that uses artificially synthesized single-stranded DNA or RNA sequences carrying fluorescent groups as probes. It is one of the important technologies for chromosome visualization. Oligonucleotide sequence probes designed based on the genome can be used for chromosome karyotype construction, homologous chromosome identification, chromosome structural variation, etc. Single-copy oligonucleotide probes can distinguish and visualize specific chromosomal regions, and are used to track specific chromosomes and identify homologous chromosomes. The development of single-copy oligonucleotide probes relies on high-quality reference genome sequences, eliminating homologous sequences outside the target region and repeats and dimers within the target region, and then obtaining a single-copy oligonucleotide sequence library of the target region, which is then fluorescently labeled to form an oligonucleotide probe library.
[0005] The reference genome of tartary buckwheat has been published, providing a solid foundation for developing single-copy oligonucleotide probes based on the entire buckwheat genome. However, the lack of specific probes capable of distinguishing homologous buckwheat chromosomes has hampered basic research and genetic breeding efforts. Establishing a FISH-based chromosome identification system for tartary buckwheat is crucial for exploring its origin and evolution, identifying chromosomal structural variations, and constructing physical maps. Summary of the Invention
[0006] The present invention aims to provide a specific oligonucleotide fluorescence in situ hybridization probe library and application for accurately identifying chromosomes 5-8 of tartary buckwheat, so as to solve the problems existing in the above-mentioned prior art. Single-copy oligonucleotide sequences specific to each pair of homologous chromosomes are screened from the whole genome of tartary buckwheat to construct an oligonucleotide fluorescence in situ hybridization probe library for tartary buckwheat. The structural characteristics of the homologous chromosomes of tartary buckwheat can be identified by combining the fluorescence in situ hybridization technique.
[0007] To achieve the above object, the present invention provides the following solutions:
[0008] The present invention provides a specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying chromosomes 5 to 8 of tartary buckwheat. The preparation of the specific oligonucleotide fluorescence in situ hybridization probe library comprises the following steps:
[0009] (1) Screening single-copy oligonucleotide sequences specific to chromosomes 5-8 from the tartary buckwheat reference genome, adding specific primers to both ends of each single-copy oligonucleotide sequence to construct a probe library;
[0010] (2) After PCR amplification of each probe in the probe library, fluorescent labeling is performed to obtain a specific single copy oligonucleotide fluorescent in situ hybridization probe library that accurately identifies buckwheat chromosomes 5-8;
[0011] The chromosome 5-specific single copy oligonucleotide sequences screened included the following sequences: (1) GTTGAGCAAGATAAGATGCAGACGTTGAACTCACCTGAAAAGTTG (SEQ ID NO. 9) or (2) GTACTGGTTCAGAAACACAGCACCTTCAAACATACTACACCAATA (SEQ ID NO. 10);
[0012] The chromosome 6-specific single copy oligonucleotide sequences screened included the following sequences: (1) AACTCCATCCGAAGAAGCGAATCCAAGGATATTGCAATCACCAGA (SEQ ID NO. 11) or (2) TAGCTCAGTTCACAGAGATGACGAGTAGGTATGCACGGGAAATGC (SEQ ID NO. 12);
[0013] The chromosome 7-specific single copy oligonucleotide sequences screened included the following sequences: (1) CACAAGGGAAATGGCCAGTGATCGAACAGCTCTCCTTGCCATCGC (SEQ ID NO. 13) or (2) ACACAGCAACAACCGAATATAGATGATCTTCAGTATTTTGAGAAA (SEQ ID NO. 14);
[0014] The chromosome 8-specific single copy oligonucleotide sequences screened included the following sequences: (1) TGTACCTTTGGATCGAAATGG TGAGGAGGCAATGAAGATGGATGG (SEQ ID NO. 15) or (2) TGGGTTTCTTTGATTTGAATTAACC ATGCAAATGTATATCAAGAT (SEQ ID NO. 16).
[0015] Preferably, the Genbank accession number of the tartary buckwheat reference genome is PRJNA381676.
[0016] Preferably, the specific primer sequences added to both ends of the chromosome 5-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 1-2; the specific primer sequences added to both ends of the chromosome 6-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 3-4; the specific primer sequences added to both ends of the chromosome 7-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 5-6; and the specific primer sequences added to both ends of the chromosome 8-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 7-8.
[0017] Preferably, the specific single copy oligonucleotide sequence screened on each chromosome is different from the single copy oligonucleotide sequences screened on the other three chromosomes.
[0018] Preferably, the length of the specific single copy oligonucleotide sequence for each chromosome is 45 bp.
[0019] Preferably, the specific primers and the specific single copy oligonucleotide sequences of chromosomes 5-8 are not repeated, and the sequence lengths of the specific primers are both 15 to 24 bp.
[0020] The present invention also provides an application of the specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying buckwheat chromosomes 5-8 in buckwheat chromosome identification or karyotype analysis.
[0021] Preferably, the buckwheat comprises tartary buckwheat.
[0022] The present invention also provides a product for buckwheat chromosome identification or karyotype analysis, comprising the specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying tartary buckwheat chromosomes 5-8.
[0023] Preferably, the product comprises chips; and / or the buckwheat comprises tartary buckwheat.
[0024] The present invention discloses the following technical effects:
[0025] The present invention selects single-copy oligonucleotide sequences of chromosomes 5-8 from the whole genome of buckwheat, filters out repetitive sequences, and obtains a probe sequence library for each pair of chromosomes. From these, single-copy oligonucleotide sequences specific to chromosomes 5-8 are selected as candidate probes. Specific primers are added to both ends of each candidate probe to construct a probe library. Through DNA amplification and fluorescent labeling, a specific oligonucleotide painting fluorescent in situ hybridization probe library capable of accurately identifying buckwheat chromosomes 5-8 is constructed. The probe library construction method used in the present invention is simple, and the probes in the probe library are subjected to in situ hybridization on buckwheat mitotic metaphase chromosomes. The results show that the probes' fluorescent signals are clear and stable, making them easy to detect and capable of obtaining a high-resolution buckwheat chromosome karyotype.
[0026] The single-copy oligonucleotide probes disclosed in this invention are highly specific and stable, accurately identifying specific sequences on buckwheat chromosomes and enabling precise chromosome identification. Using oligonucleotide probe technology, buckwheat karyotype analysis can be performed to understand structural characteristics such as chromosome number, morphology, inheritance, and variation, providing important technical support for cytological identification in buckwheat hybrid breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0028] Figure 1Shown are the painting results of specific oligonucleotide probe library on Tartary buckwheat chromosomes. The scale is 2 μm. A shows the painting results of chromosome 5-specific oligo-painting probe (green) and chromosome 6-specific oligo-painting probe (red) on Tartary buckwheat chromosomes; B shows the painting results of chromosome 7-specific oligo-painting probe (green) and chromosome 8-specific oligo-painting probe (red) on Tartary buckwheat chromosomes. DETAILED DESCRIPTION
[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.
[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0034] Oligonucleotide: Oligo;
[0035] Oligo-Painting: Oligo-Painting;
[0036] Oligonucleotide fluorescence in situ hybridization: Oligo-FISH.
[0037] Example 1 Development of Oligo-Painting Probe
[0038] (1) Using the tartary buckwheat cultivar Pinku 1 as the reference genome (Genbank accession number PRJNA381676), an oligonucleotide sequence probe library was constructed using Chorus2 software; oligonucleotide sequences with similarity > 75% were selected from the whole genome sequence of Pinku 1.
[0039] (2) The oligonucleotide sequences of chromosomes 5 to 8 of buckwheat screened out in step (1) were compared with the second generation sequencing data of Jiujiang buckwheat to screen out oligonucleotide sequences with a similarity of 75%.
[0040] (3) All repeated sequences are filtered out from the oligonucleotide sequences screened in step (2). The obtained probe sequences are grouped by chromosomes and compared pairwise to obtain a single copy oligonucleotide sequence library specific for chromosomes 5-8.
[0041] (4) Each chromosome is divided into 10 regions, and single-copy oligonucleotide sequences are evenly selected from these 10 regions to maintain a consistent density, ensuring that the single-copy oligonucleotide sequences can evenly cover the entire chromosome.
[0042] (5) Compare the single copy oligonucleotide sequence library of each chromosome with each primer to ensure that the primer sequence is not identical to any single copy oligonucleotide sequence of any chromosome.
[0043] (6) A library of oligonucleotide sequence probes specific for chromosomes 5-8 of buckwheat was prepared. These probes were labeled to form double-stranded probes and used for in situ hybridization on metaphase chromosomes of buckwheat root tips to observe the generation of red or green fluorescent signals on the chromosomes. The oligo-painting probes specific for chromosomes 5-8 consisted of 6401, 6268, 6011, and 5727 single-copy oligonucleotides, respectively, for a total of 24,407. The regional locations and lengths of the single-copy oligonucleotides on the chromosomes are shown in Table 1.
[0044] Table 1. Regional location and length of single copy oligonucleotides on chromosomes 5-8 of buckwheat
[0045]
[0046] (7) Specific primers were added to both ends of each selected single-copy oligonucleotide sequence to construct a buckwheat oligo-painting probe library. Each single-copy oligonucleotide sequence was 45 bp in length, and the starting position of each sequence in the pool in the buckwheat genome was as follows:
[0047] Table 2 Starting position of Chr5 Oligos sequence
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062] Table 3 Starting position of Chr6 Oligos sequence
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077] Table 4 Starting position of Chr7Oligos sequence
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091] Table 5 Starting position of Chr8 Oligos sequence
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104] Example 2 PCR Amplification of Oligo-Painting Probe Library
[0105] The amplification method includes the following steps:
[0106] (1) Single-copy oligonucleotides specific for different chromosomes have specific primers at both ends. Single-copy oligonucleotide libraries were synthesized in batches by GenScript Biotech Corp (Nanjing, China) to obtain probe library chips. The probe library chips were diluted to a concentration of 2 ng / μL and stored at -20°C. The 5' ends of the front and back primers were fluorescently modified with TAMRA or FAM. The front and back primer sequences were set with the F end identical and the R end reverse complementary, as shown in Table 6. The system and procedures involved in PCR amplification are shown in Table 7.
[0107] Table 6 Probe primer sequence information
[0108]
[0109] (2) The 50 μL PCR amplification system included: 2 μL of oligonucleotide probe library chip diluent (2 ng / μL), 2 μL of each of the front and back primers (100 μM / L), 25 μL of KAPA HiFi HotStart ReadyMix enzyme, and 19 μL of ddH2O. The amplification program is shown in Table 7.
[0110] Table 7 Amplification program
[0111]
[0112] (3) PCR product purification was completed using Gene JET PCR Purification kit to obtain the probe.
[0113] First, add an equal volume of Binding Buffer to 50 μL of PCR product and mix thoroughly. Then add 50 μL of isopropanol and mix thoroughly. Place the resulting mixture in an adsorption column and centrifuge at 13,000 rpm for 50 seconds. Discard the waste liquid and place the adsorption column back into the collection tube.
[0114] Next, add 700 μL of Wash Buffer to the column and centrifuge at 13,000 rpm for 60 seconds. Discard the waste solution, return the column to the collection tube, and centrifuge at 13,000 rpm for 1 minute.
[0115] Again, the adsorption column was placed in a sterilized 1.5 mL centrifuge tube, 50 μL of Elution Buffer was added to the center of the adsorption membrane, and centrifuged at 13,000 rpm for 1 min.
[0116] Finally, the probe concentration was measured spectrophotometrically, and the expected probe concentration range was 400-800 ng / μL.
[0117] Example 3 Fluorescence in situ hybridization and signal detection
[0118] (1) Preparation of single copy oligonucleotide probe hybridization solution: The hybridization solution system is 22 μL, including 3 μL each of the red and green probes prepared in Example 1, 2 μL of 20× sodium citrate buffer (SSC), 4 μL of 50% dextran sulfate, and 10 μL of deionized formamide. Gently pipette to mix and then centrifuge.
[0119] (2) Place in a 100°C water bath for 6 minutes, then immediately place in an ice box and let stand for 5 minutes.
[0120] (3) Fluorescence in situ hybridization: The prepared single copy oligonucleotide probe hybridization solution was added dropwise to the buckwheat chromosome preparation with good division phase, covered with a coverslip and placed in an 85°C hybridization oven for hybridization for 5 min 30 s. After taking out, the slide was quickly sealed with sealing glue and placed in a moist hybridization box and incubated at a constant temperature of 37°C in a constant temperature box for 20-24 h.
[0121] (4) Washing: Remove the coverslip and place the slide in 42°C 2×SSC, room temperature 2×SSC, ddH2O, and anhydrous ethanol solutions, respectively, for 5 min each. After drying, add 10 μL of DAPI to the slide. Cover with a coverslip and let it stand for 5 min before microscopic examination.
[0122] (5) Microscopic examination: An Olympus BX60-2 fluorescence microscope was used for microscopic examination and image capture, and the images were processed using Photoshop.
[0123] The above method was used to detect single copy oligonucleotide probe signals on the mitotic metaphase chromosome preparation of buckwheat. The detection results were as follows: Figure 1 As shown. The probes were applied to the tartary buckwheat cultivar - Xiqiao No. 2 (2n = 2x = 16). FISH results showed that the four pairs of chromosome-specific oligonucleotide probes only produced clear and bright fluorescent signals on two homologous chromosomes, indicating that these probes can specifically recognize tartary buckwheat chromosomes 5-8. The fluorescent signals of the probes were evenly covered on tartary buckwheat chromosomes 5-8. The probes were designed and developed based on tartary buckwheat genome data. The cytological results showed that they were consistent with the tartary buckwheat genome assembly results, which in turn proved the correctness of the assembly results. Eight chromosomes were identified in tartary buckwheat cells, and the four probes produced specific hybridization signals on the four pairs of homologous chromosomes, indicating that the probes are specific for chromosomes 5-8.
[0124] The oligo probe designed in this invention has high specificity and accuracy, and can accurately identify specific sequences on chromosomes 5 to 8 of tartary buckwheat, thereby accurately identifying chromosomes 5 to 8. Using this oligo probe technology, the karyotype of tartary buckwheat can be constructed to understand its structural characteristics, such as chromosome number, morphology, and genetic variation.
[0125] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying chromosomes 5-8 of buckwheat, characterized in that: The preparation of the specific oligonucleotide fluorescence in situ hybridization probe library comprises the following steps: (1) Screening single-copy oligonucleotide sequences specific to chromosomes 5-8 from the tartary buckwheat reference genome, adding specific primers to both ends of each single-copy oligonucleotide sequence to construct a probe library; (2) After PCR amplification of each probe in the probe library, fluorescent labeling is performed to obtain a specific single copy oligonucleotide fluorescent in situ hybridization probe library that accurately identifies chromosomes 5-8 of buckwheat; The chromosome 5-specific single-copy oligonucleotide sequences screened included the following sequences: (1) GTTGAGCAAGATAAGATGCAGACGTTGAACTCACCTGAAAAGTTG or (2) GTACTGGTTCAGAAACACAGCACCTTCAAACATACTACACCAATA; The chromosome 6-specific single-copy oligonucleotide sequences screened included the following sequences: (1) AACTCCATCCGAAGAAGCGAATCCAAGGATATTGCAATCACCAGA or (2) TAGCTCAGTTCACAGAGATGACGAGTAGGTATGCACGGGAAATGC; The chromosome 7-specific single-copy oligonucleotide sequences screened included the following sequences: (1) CACAAGGGAAATGGCCAGTGATCGAACAGCTCTCCTTGCCATCGC or (2) ACACAGCAACAACCGAATATAGATGATCTTCAGTATTTTGAGAAA; The chromosome 8-specific single copy oligonucleotide sequences screened included the following sequences: (1) TGTACCTTTGGATCGAAATGG TGAGGAGGCAATGAAGATGGATGG or (2) TGGGTTTCTTTGATTTGAATTAACCATGCAAATGTATA TCAAGAT.
2. The specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying buckwheat chromosomes 5-8 according to claim 1, characterized in that: The Genbank accession number of the tartary buckwheat reference genome is PRJNA381676.
3. The specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying buckwheat chromosomes 5-8 according to claim 1, characterized in that The specific primer sequences added to both ends of the chromosome 5-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 1-2; the specific primer sequences added to both ends of the chromosome 6-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 3-4; the specific primer sequences added to both ends of the chromosome 7-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 5-6; and the specific primer sequences added to both ends of the chromosome 8-specific single-copy oligonucleotide sequence are shown in SEQ ID NOs: 7-8.
4. The specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying buckwheat chromosomes 5-8 according to claim 1, characterized in that The specific single copy oligonucleotide sequence screened on each chromosome is different from the single copy oligonucleotide sequences screened on the other three chromosomes.
5. The specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying buckwheat chromosomes 5-8 according to claim 1, characterized in that The length of the specific single copy oligonucleotide sequence for each chromosome is 45 bp.
6. The specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying buckwheat chromosomes 5-8 according to claim 1, characterized in that: The specific primers and the specific single copy oligonucleotide sequences of chromosomes 5 to 8 are not repeated, and the sequence lengths of the specific primers are both 15 to 24 bp.
7. Use of the specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying buckwheat chromosomes 5 to 8 according to any one of claims 1 to 6 in buckwheat chromosome identification or karyotype analysis.
8. The use according to claim 7, characterized in that The buckwheat includes tartary buckwheat.
9. A product for buckwheat chromosome identification or karyotype analysis, characterized in that: The invention comprises the specific single copy oligonucleotide fluorescence in situ hybridization probe library for accurately identifying chromosomes 5 to 8 of tartary buckwheat according to any one of claims 1 to 6.
10. The product according to claim 9, characterized in that The product comprises chips; and / or the buckwheat comprises tartary buckwheat.