A grass carp npm1a and type ii reovirus vp38 fusion gene, recombinant protein, composition and application

By preparing a fusion recombinant protein of grass carp NPM1a and type II reovirus VP38 and using indole-3-lactic acid, a vaccine system with host-virus dual-target fusion antigen and precise immune enhancement of intestinal mucosa was established. This solved the problem that existing vaccines could not effectively block viral invasion and protect the intestinal mucosa, and achieved efficient prevention and control of grass carp hemorrhagic disease.

CN120624488BActive Publication Date: 2025-12-23HUNAN NORMAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510785323.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-12
Publication Date
2025-12-23
Estimated Expiration
2045-06-12

AI Technical Summary

Technical Problem

Existing grass carp vaccines are unable to effectively block the invasion pathway of type II reovirus and have a low protection rate against the intestinal mucosal barrier, resulting in poor control of grass carp hemorrhagic disease.

Method used

Recombinant proteins were prepared using the fusion gene of grass carp NPM1a and type II reovirus VP38, and indole-3-lactic acid was used as an immune enhancer to establish a synergistic vaccine system that combines host-virus dual-target fusion antigen with precise immune enhancement of the intestinal mucosa.

Benefits of technology

It significantly improved the antiviral ability of grass carp, with a relative survival rate of 85.2%, achieving the blocking of viral invasion pathways and strengthening of the intestinal mucosal barrier, thereby improving the quality and efficiency of the immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624488B_ABST
    Figure CN120624488B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of aquaculture fish vaccine, in particular to a grass carp NPM1a and type II reovirus VP38 fusion gene, recombinant protein, composition and application. The nucleotide sequence of the fusion gene is shown as SEQ ID NO: 1. The fusion gene is obtained by connecting grass carp NPM1a and type II reovirus VP38 through a linker sequence, a BamH restriction site is added at the 5' end of the fusion sequence, and a XhoI restriction site is added at the 3' end. The linker sequence is shown as SEQ ID NO: 2. By preparing a subunit vaccine of grass carp NPM1a and type II reovirus VP38 fusion protein, and jointly using indole-3-lactic acid as an immune enhancer, the technical bottlenecks of low protection rate of existing vaccines and poor intestinal mucosal barrier repair are overcome.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of aquaculture fish vaccines, in particular to a fusion gene of grass carp NPM1a and type II reovirus VP38, a recombinant protein, a composition and application. BACKGROUND

[0002] Grass carp (Ctenopharyngodon idella) is a core economic species of Chinese aquaculture and an important source of high-quality aquatic protein. However, viral hemorrhagic disease caused by type II reovirus (GCRV) infection in grass carp is highly contagious and pathogenic, causing huge economic losses to grass carp aquaculture every year and seriously hindering the green, healthy and sustainable development of aquaculture. The existing hemorrhagic disease prevention and control methods have three major technical bottlenecks: ① Traditional inactivated vaccines generally lack sufficient neutralizing antibody titers due to the lack of specific antigen presentation targets; ② Live attenuated vaccines have the risk of virulence regression; ③ Subunit vaccines mostly use single viral structural proteins (such as VP4, VP35 and VP56), which have low immunoprotective rates and cannot activate mucosal immune responses. Therefore, developing a new vaccine system that takes into account efficient antigen delivery and precise activation of mucosal immunity has become an urgent need for the prevention and control of grass carp hemorrhagic disease.

[0003] Type II reovirus (GCRV) is the main pathogen causing hemorrhagic disease in grass carp, and its genome contains 11 segments of double-stranded RNA, encoding VP1, VP2, VP3, NS79, VP5, VP4, VP56, VP41, VP46, VP38 and VP35 proteins. Currently, researchers have conducted some studies on the vaccine effects of these proteins. Studies have shown that grass carp immunized with different doses of VP4 recombinant protein can resist viral infection, with a relative survival rate of 47%-82%. The relative survival rate of rare minnows immunized with VP6 protein using lactic acid bacteria as a carrier and orally was 42.9%. The VP35 protein subunit vaccine can significantly increase the number of peripheral blood leukocytes in grass carp, increase serum antibody levels, and up-regulate the mRNA expression of immune-related genes, and the relative survival rate of grass carp after challenge was 60%. The relative survival rate of rare minnows immunized with VP4 and VP35 fusion protein subunit vaccine was 67%. The relative survival rate of grass carp immunized with VP56 protein expressed on the surface of Bacillus subtilis and orally challenged was 56%. The relative survival rate of grass carp immunized with VP3, VP4 and VP38 three-protein fusion subunit vaccine was 83%, and the relative survival rate of grass carp immunized with VP4, VP35 and VP56 three-protein fusion subunit vaccine was 62%. However, the above vaccine design strategies only target viral structural proteins, which cannot completely block the interaction between the virus and the host receptor, resulting in incomplete blocking of the virus invasion path, and the activation and protection rate of the vaccine for the intestinal mucosal barrier is limited.

[0004] Nucleophosmin 1 (NPM1) is a nucleophosmin widely present in the nucleolus of vertebrates, which activates chromatin transcription in an acetylation-dependent manner and maintains the homeostasis of the nucleus. On the other hand, NPM1 is also a key receptor for the invasion of host cells by various viruses. For example, NPM1 can interact with various viral proteins such as hepatitis B virus (HBV), Epstein-Barr virus (EBV), bovine immunodeficiency virus and human immunodeficiency virus, participate in multiple stages of viral infection and affect viral proliferation. In addition, in grass carp, NPM1 can be transferred from the nucleus to the cytoplasm and promote GCRV replication. However, the role of NPM1 in viral infection has not been applied to vaccine development.

[0005] Tryptophan (Trp) is an essential amino acid that can only be obtained through diet, and is the only amino acid containing an indole structure. Tryptophan metabolism can produce various molecules such as kynurenine (Kyn), 5-hydroxytryptamine, indole-3-lactic acid (ILA) and other indole derivatives, which are involved in the regulation of immune response, reproductive development and cell biology functions and other physiological processes. Studies have shown that indole-3-lactic acid can act as a ligand for aryl hydrocarbon receptor (AhR), promote the expression of interleukin 22 and antibacterial peptides, thereby protecting the intestinal mucosal barrier and inhibiting the infection of pathogenic microorganisms. However, its mechanism of action in fish immune regulation and practical application has not been reported, and there is no research on its combination with subunit vaccine to achieve precise dual activation of intestinal mucosal barrier and vaccine immunity.

[0006] In summary, there is currently no vaccine system for the synergistic combination of "host-virus dual target fusion antigen" and "intestinal mucosal precise immune enhancer" for grass carp. SUMMARY

[0007] The present application provides a fusion gene of grass carp NPM1a and type II reovirus VP38, a recombinant protein, a composition and an application, and aims to fill the current domestic blank of NPM1 in preventing and treating grass carp hemorrhagic disease caused by type II reovirus (GCRV). The difference between the present application and the previous patent is that based on the above background, the present application proposes an innovative idea of combining "host-virus dual target fusion antigen" and "intestinal mucosal precise immune enhancer", by preparing a subunit vaccine of grass carp NPM1a and type II reovirus VP38 fusion protein, and using indole-3-lactic acid as an immune enhancer, to overcome the technical bottlenecks of low protection rate of existing vaccines and poor intestinal mucosal barrier repair, and to provide a solution with high efficiency, safety and economy for the prevention and control of grass carp hemorrhagic disease, which has significant industrial application value.

[0008] In order to achieve the above object, the application provides a grass carp NPM1a and type II reovirus VP38 fusion gene, the nucleotide sequence of the fusion gene is shown as SEQ ID NO: 1.

[0009] Preferably, the fusion gene is obtained by connecting the grass carp NPM1a and type II reovirus VP38 through a linker sequence, a BamH restriction site is added at the 5' end of the fusion sequence, and a XhoI restriction site is added at the 3' end;

[0010] The linker sequence is shown as SEQ ID NO: 2.

[0011] Under the same technical concept, the application further provides a recombinant expression vector containing the fusion gene.

[0012] Under the same technical concept, the application further provides a grass carp NPM1a and type II reovirus VP38 fusion recombinant protein, the amino acid sequence of the fusion recombinant protein is shown as SEQ ID NO: 3.

[0013] Under the same technical concept, the application further provides a preparation method of the grass carp NPM1a and type II reovirus VP38 fusion recombinant protein, comprising the following steps:

[0014] (1) inserting a linker sequence in the middle of the grass carp NPM1a and type II reovirus VP38 gene, and synthesizing a grass carp NPM1a and type II reovirus VP38 fusion gene;

[0015] (2) connecting the grass carp NPM1a and type II reovirus VP38 fusion gene to a recombinant expression vector, and transforming into an E. coli expression strain;

[0016] (3) inducing expression of the recombinant protein, precipitating and purifying to obtain the grass carp NPM1a and type II reovirus VP38 fusion recombinant protein.

[0017] Preferably, the inserting of the linker sequence in step (1) specifically comprises: using an overlap PCR method, adding a BamH restriction site at the 5' end of the fusion sequence, adding a XhoI restriction site at the 3' end, and connecting the grass carp NPM1a and type II reovirus VP38 through a linker sequence coding flexible polypeptide;

[0018] The amino acid sequence of the flexible polypeptide coded by the linker sequence is shown as SEQ ID NO: 4.

[0019] Preferably, the recombinant expression vector in step (2) is a pET28a vector, and the transformation into an E. coli expression strain specifically comprises: transforming the recombinant expression vector into E. coli DH5a competent cells by a CaCl2 method to obtain a recombinant plasmid, and performing sequencing verification, and then transforming the recombinant plasmid into an E. coli BL21 expression vector.

[0020] Preferably, the induced expression of the recombinant protein in step (3) specifically comprises: inoculating 100-200 μl of E. coli BL21 containing the recombinant plasmid into 200 ml of LB liquid medium at a ratio of 1:100-1:200, and adding kanamycin to the medium at a final concentration of 30-50 μg / ml; then placing the culture bottle in a 37℃ 180-220 rpm shaker, and culturing until the OD is about 0.4-0.5; adding IPTG to the culture bottle at a final concentration of 0.2-0.4 mM, and then placing the culture bottle in a 16℃ 120-140 rpm shaker; after 6-8 h, centrifuging to collect the bacterial cells, adding 5-10 ml of protein lysis solution, and using an ultrasonic disrupter to break the cells at low temperature, and centrifuging at 10000-12000 rpm to collect the supernatant, which is the recombinant protein;

[0021] The purification specifically comprises: adding the supernatant to a Ni-NTA protein chromatography column to purify the fusion recombinant protein of grass carp NPM1a and type II reovirus VP38.

[0022] Under the same technical concept, the present application also provides a composition of the fusion recombinant protein of grass carp NPM1a and type II reovirus VP38, which comprises the fusion recombinant protein of grass carp NPM1a and type II reovirus VP38 and indole-3-lactic acid, and the mass ratio is 1:5 to 1:10. This ratio can maximize the immune protection efficiency, reduce the viral load, and avoid excessive inflammation and metabolic toxicity.

[0023] Under the same technical concept, the present application also provides an application of the composition of the fusion recombinant protein of grass carp NPM1a and type II reovirus VP38, which is used to improve the grass carp's resistance to hemorrhagic disease. The administration amount of each component in the composition is 0.5-1.0 mg / ml of the fusion recombinant protein and 2.5-5 mg / ml of ILA, the injected grass carp has a body length of 10-12 cm and a body weight of 15-20 g, and the injection frequency is once.

[0024] The above-mentioned scheme of the present application has the following beneficial effects:

[0025] The present application establishes a double barrier to block the invasion path of the virus by preparing a subunit vaccine of a fusion recombinant protein of grass carp NPM1a and type II reovirus VP38; meanwhile, the AhR / IL-22 pathway is activated by indole-3-lactic acid, which can improve the antioxidant capacity of immune cells, reduce the damage of oxidative stress to immune cells, provide a good internal environment for immune response, create a “high-efficiency sensing microenvironment” for the recognition of fusion protein antigens and the generation of subunit vaccines; on the other hand, the intestinal mucosal barrier is strengthened through the AhR / IL-22 pathway (up-regulating tight junction proteins such as ZO-1 and Occludin), which not only directly blocks the invasion path of the reovirus through the intestinal mucosa, but also avoids the functional exhaustion of dendritic cells (DC) by reducing the leakage of endotoxin, so that the fusion protein antigen is more easily captured by DC cells, thereby enhancing the antigen uptake and presentation capacity of DC, realizing the spatial synergistic effect of “virus invasion blocking-antigen presentation enhancement-immune response quality improvement”. This multi-faceted synergistic effect significantly improves the grass carp's ability to resist hemorrhagic disease, with a relative survival rate of up to 85.2%, realizing the synergistic effect of “targeted blocking-mucosal repair”, and providing an innovative solution for the efficient prevention and control of grass carp viral hemorrhagic disease in aquaculture.

[0026] Other beneficial effects of the present application will be described in detail in the subsequent specific embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 SDS-PAGE detection results of rCiNPM1a, rVP38 and rCiNPM1a+rVP38 of embodiment 1 of the present application;

[0028] Figure 2 Detection results of the content of LPS in the plasma of grass carp after GCRV infection in embodiment 2 of the present application;

[0029] Figure 3 Detection results of the expression of key protective factors in the intestinal mucosa tissue of grass carp after GCRV infection in embodiment 2 of the present application; wherein A is AhR, B is IL-22, C is ZO-1, and D is Occludin;

[0030] Figure 4 Detection results of the content of key antioxidant enzymes in grass carp after GCRV infection in embodiment 3 of the present application; wherein A is SOD, B is CAT, C is ACP, and D is AKP;

[0031] Figure 5 Detection results of the expression of antiviral factors in grass carp after GCRV infection in embodiment 4 of the present application; wherein A is IgM, B is IFN1, C is Mx, D is ISG15, E is Viperin, and F is CMPK2;

[0032] Figure 6 The detection result of the virus load in grass carp after GCRV infection in Example 4 of the present application is shown in Table 4.

[0033] Figure 7 The detection result of the survival rate of grass carp after GCRV infection in Example 5 of the present application is shown in Table 5. DETAILED DESCRIPTION

[0034] To make the technical problems, technical solutions and advantages of the present application clearer, specific embodiments will be described in detail below with reference to the drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0035] In the description of the present application, it should be noted that the orientations or positional relationships indicated by the terms "center", "upper", "lower", "left", "right", "vertical", "horizontal", "inner", "outer" and the like are based on the orientations or positional relationships shown in the drawings, and are only for the convenience of describing the present application and simplifying the description, and therefore cannot be understood as indicating or implying that the devices or elements referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore cannot be understood as limiting the present application. In addition, the terms "first", "second", "third" are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0036] In the description of the present application, it should be noted that unless otherwise explicitly specified and limited, the terms "mounting", "connection", "connection" should be understood broadly, for example, it can be a locking connection, or a detachable connection, or an integral connection; it can be a mechanical connection, or an electrical connection; it can be directly connected, or indirectly connected through an intermediate medium, or the internal communication of two elements. For those skilled in the art, the specific meaning of the above terms in the present application can be understood according to the specific circumstances.

[0037] The experimental reagents, sequencing and experimental animals involved in the present application are provided by the following companies:

[0038] 1. Gene sequencing and primer synthesis are completed by "Beijing Chengke Biotechnology Co., Ltd.";

[0039] 2. Indole-3-lactic acid reagent is purchased from "Shanghai Aladdin Biochemical Technology Co., Ltd.";

[0040] 3. E. coli DH5a and BL21(DE3) competent cells, protein lysis solution, Ni-NTA chromatography purification kit are purchased from "Shanghai Sunny Biotech Co., Ltd.";

[0041] 4. LPS, SOD, CAT, ACP and AKP kits were purchased from Nanjing Jianshen Biological Engineering Research Co., Ltd.;

[0042] 5. Healthy grass carp was purchased from Hunan Qiao Mai Lake High-quality Fish Research Institute Co., Ltd.

[0043] In addition, the technical features involved in the different embodiments of the application described below can be combined with each other as long as they do not conflict with each other.

[0044] Example 1

[0045] A method for preparing a fusion gene of grass carp NPM1a and type II reovirus VP38 and a recombinant protein, specifically comprising the following steps:

[0046] Step (1): Synthesis of fusion gene sequence

[0047] Grass carp NPM1a (GenBank accession number: XM_051909362.1) and type II reovirus VP38 gene (GenBank accession number: KC201175.1) were fused by using Overlap PCR method. A linker sequence was added between the two genes, a BamH restriction site (GGATCC) was added at the 5' end of the fusion sequence, and a XhoI restriction site (CTCGAG) was added at the 3' end. By this method, grass carp NPM1a was connected to type II reovirus VP38 through a flexible polypeptide (SEQ ID NO: 4 GGGGSGGGGSGGGGSGPGPG) encoded by the linker sequence.

[0048] The sequence of the linker is as follows:

[0049] SEQ ID NO: 2

[0050] GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTCCGGGTC CGGGT

[0051] The nucleotide sequence of the recombinant fusion gene is as follows:

[0052] SEQ ID NO: 1

[0053]

[0054] Step (2): Construction of fusion sequence expression vector

[0055] The above sequence was double digested with BamH and Xhol, and ligated into pET28a vector. The recombinant plasmid was transformed into E. coli DH5a competent cells by CaCl2 method, and verified by sequencing. The recombinant plasmid was then transformed into E. coli BL21 expression vector. Meanwhile, according to the above method, control vectors for expressing grass carp NPM1a protein and type II reovirus VP38 protein alone were constructed.

[0056] Step (3): Purification of recombinant protein

[0057] 100 μl of E. coli BL21 (DE3) containing recombinant plasmid was inoculated into 200 ml of LB liquid medium at a ratio of 1:200. Kanamycin was added to the medium at a final concentration of 50 μg / ml. Then the culture bottle was placed in a 37°C 200 rpm shaker, and cultured to OD about 0.4. IPTG was added to the culture bottle at a final concentration of 00.4 mM, and then the culture bottle was placed in a 16°C, 120 rpm shaker. After 6 hours, the bacterial cells were collected by centrifugation, and 5 ml of protein lysis solution was added. The cells were broken by ultrasonic disrupter at low temperature, and the supernatant was collected by centrifugation at 10000 rpm. The supernatant was added to a Ni-NTA protein chromatography column, and the recombinant protein (named rCiNPM1a+rVP38 recombinant protein) was purified according to the kit operation steps. The size of the recombinant protein was detected by SDS-PAGE (the detection results are shown in Figure 1 ). Meanwhile, grass carp NPM1a protein and type II reovirus VP38 protein were expressed alone as control groups according to the above method.

[0058] The amino acid sequence of the recombinant fusion protein is as follows:

[0059] SEQ ID NO: 3

[0060] MDLEQMGPQTFLYGCELKAGKDVSFNPEDDDYDHQLSVRMACVDPATKDELNVVEIEGHDSEGQKVKAVLATLKPSTLPSVCLGGFEITPPVVFRLRSGSGPVHISGQHLVIMGGDQSFDEEEEEEEEEEETVTTAKKRPASLTAKPSKKMKLDEQEEEEEEDDDDDDDDDDEIDDEEDDDEDDDDEEEESEEESPVKEKKTASKPQTPAQNGKGPKPSTPAKQNKTPEKGNKGDKKAQTPKTPQSPKTPQTPRVFTVPEIKAKMMASVEKGVSLPKLQPKFENYVKNCFKATDAKVIEELWKWRQSVKGGGGSGGGGSGGGGSGPGPGMAGVSLNINRNISNSASTIFLEDIPLLSCSVRCEPGKGRELPKFNMSCPAINAMGRCLNPMKFIAEHWVPNSPSRKPSRQHWRNVLNGLEFSNGRGFDVLSFSPAGMAVLRDILTEDSVKYCFDESNTCSLFTLLYTLCCDAAGVEPMDLDSRQTDASARMVSYQDRAIVLTSNEAGDRIEPWNVELDKEFGNPDLLSRLNISYGVQRYGDSKASTDTLTLADAPERSKPALITVQPLLVAMCIKQSLDGLLALSDLRLRFDQYPGYANALMNAMAMYACLDRDLMRFLLRLEMTHASTVSEVAECWRNSRNSRDATGCHIVPRQGLLIIVSGDVEVRRIFAQML

[0061] Table 1 Primers of Example 1

[0062]

[0063] Example 2

[0064] A grass carp NPM1a and type II reovirus VP38 recombinant protein composition and application, the composition is a fusion protein combined with indole-3-lactic acid (ILA), specifically comprising the following steps:

[0065] Step (1): immunizing grass carp with fusion protein combined with indole-3-lactic acid

[0066] Healthy grass carp with the body length of 10-12 cm and the body weight of 15-20 g were selected from the same batch and divided into five groups, 15 fish in each group, and the temperature in the breeding room was maintained at 28℃±0.1:

[0067] ① Normal group: 100 μl of sterile PBS was injected intraperitoneally.

[0068] ② ILA group: 100 μl of sterile PBS containing ILA at a concentration of 4 mg / ml was injected intraperitoneally.

[0069] ③ ILA+rCiNPM1a group: 100 μl of sterile PBS containing ILA at a concentration of 4 mg / ml and rCiNPM1a recombinant protein at a concentration of 0.5 mg / ml was injected.

[0070] ④ ILA+rVP38 group: 100 μl of sterile PBS containing ILA at a concentration of 4 mg / ml and rVP38 recombinant protein at a concentration of 0.5 mg / ml was injected.

[0071] ⑤ ILA+rCiNPM1a+rVP38 group: 100 μl of sterile PBS containing ILA at a concentration of 4 mg / ml, rCiNPM1a+rVP38 recombinant protein at a concentration of 0.5 mg / ml was injected.

[0072] After 21 days, 100 μl of GCRV was injected intraperitoneally to artificially infect the fish in each group, and the virus concentration was 1.0×107TCID50 / ml.

[0073] Step (2): Detection of the change of intestinal mucosal permeability of grass carp

[0074] After 2 days of infection, the blood of fish in each group was collected by using a disposable syringe to prepare plasma. Then, the content of LPS in the plasma was detected by using an LPS kit to evaluate the effect of the fusion protein combined with indole-3-lactic acid on the intestinal mucosal permeability of grass carp after challenge. The experimental results showed that the LPS content of the normal PBS control group was 43.1±4.8 pg / ml, the LPS content of the ILA group was 37.8±4.4 pg / ml, the LPS content of the ILA+rCiNPM1a group was 30.8±4.0 pg / ml, the LPS content of the ILA+rVP38 group was 28.8±4.3 pg / ml, and the LPS content of the ILA+rCiNPM1a+rVP38 group was 20.1±4.4 pg / ml, indicating that the LPS content of the ILA+rCiNPM1a+rVP38 group was significantly lower than that of other groups (Mann-Whitney test, P<0.01), as shown in Figure 2

[0075] ​Step (3): Detection of changes in key protective factors of grass carp intestinal mucosal barrier

[0076] After 2 days of infection, the intestinal tissue was quickly frozen in liquid nitrogen, and total RNA was extracted from the intestinal tissue using a total RNA extraction kit. The reverse transcription kit was used to reverse the cDNA. The expression of AhR, IL-22, ZO-1 and Occludin was detected by qRT-PCR method to evaluate the influence of fusion protein combined with indole-3-lactic acid on the expression of key protective factors of intestinal mucosal barrier of grass carp after challenge. The primers are shown in Table 1 below, and the internal reference gene is 18S rRNA. The experimental results show that the expression of AhR, IL-22, ZO-1 and Occludin in the ILA+rCiNPM1a+rVP38 group is significantly higher than that in the normal PBS control group (Mann-Whitney test, P<0.01), as shown in Figure 3

[0077] Among them, GCRV virus has been reported in the literature: Wei Y, Lv Z, Du Z, Xiao T. The structural characteristics and expression characteristics of C1S in response to GCRV infection in grass carp. Fish Shellfish Immunol. 2025, 161: 110264.

[0078] Table 2 Primers of Example 2

[0079]

[0080] Example 3

[0081] The influence of grass carp NPM1a and type II reovirus VP38 recombinant protein composition on the antioxidant capacity of grass carp, specifically including the following steps:

[0082] Step (1): Grass carp NPM1a and type II reovirus VP38 recombinant protein composition immunize grass carp

[0083] The immunization method is the same as step (1) of Example 2.

[0084] Step (2): Detection of changes in the antioxidant capacity of grass carp

[0085] ​After 2 days of infection, the liver tissues of fish in each group were quickly frozen in liquid nitrogen and ground to prepare tissue suspension. The contents of four key antioxidant enzymes SOD, CAT, ACP and AKP were detected by using the kit to evaluate the effect of the fusion protein combined with indole-3-lactic acid on the antioxidant capacity of grass carp after challenge. The experimental results show that the contents of antioxidant enzymes SOD, CAT, ACP and AKP in the ILA+rCiNPM1a+rVP38 group are significantly higher than those in the normal PBS control group (Mann-Whitney test, P<0.01), as shown in Table 1. Figure 4

[0086] Example 4

[0087] The effect of grass carp NPM1a and type II reovirus VP38 recombinant protein composition on the antiviral ability of grass carp includes the following steps:

[0088] Step (1): Immunization of grass carp with grass carp NPM1a and type II reovirus VP38 recombinant protein composition

[0089] The immunization method is the same as step (1) of Example 2.

[0090] Step (2): Detection of expression changes of grass carp IgM antibody

[0091] After 2 days of infection, the spleen tissue was quickly frozen in liquid nitrogen, and the total RNA in the tissue was extracted by using a total RNA extraction kit, and the cDNA was reverse transcribed by using a reverse transcription kit. The expression of IgM was detected by using qRT-PCR method to evaluate the effect of the fusion protein combined with indole-3-lactic acid on the expression of IgM antibody of grass carp after challenge. The primers are shown in Table 2, and the reference gene is 18S rRNA. The experimental results show that the relative expression of IgM in the normal PBS control group is 1.00±0.02, the relative expression of IgM in the ILA group is 1.19±0.18, the relative expression of IgM in the ILA+rCiNPM1a group is 1.96±0.19, the relative expression of IgM in the ILA+rVP38 group is 1.99±0.31, and the relative expression of IgM in the ILA+rCiNPM1a+rVP38 group is 2.70±0.18, indicating that the expression of IgM in the ILA+rCiNPM1a+rVP38 group is significantly higher than that in other groups (Mann-Whitney test, P<0.01), as shown in Table 2. Figure 5 A.

[0092] Step (3): Detection of expression changes of key antiviral factors of grass carp

[0093] ​After obtaining the cDNA of step (2) above, the cDNA was reversed using a reverse transcription kit. The expression of IFN1, Mx, ISG15, Viperin and CMPK2 was detected by qRT-PCR method to evaluate the effect of the fusion protein combined with indole-3-lactic acid on the expression of key antiviral factors in grass carp after challenge. The primers are shown in Table 2 below, and the reference gene is 18S rRNA. The experimental results show that the expression of key antiviral factors such as IFN1, Mx, ISG15, Viperin and CMPK2 in the ILA+rCiNPM1a+rVP38 group was significantly higher than that in other groups (Mann-Whitney test, P<0.01), as shown in Figure 5 B to Figure 5 F.

[0094] Step (4): Detection of the change of viral load in grass carp

[0095] After obtaining the cDNA of step (2) above, the expression of VP38 was detected by qRT-PCR method to evaluate the effect of the fusion protein combined with indole-3-lactic acid on the viral load of GCRV in grass carp after challenge. The primers are shown in Table 2 below, and the reference gene is 18S rRNA. The experimental results show that the relative expression of VP38 in the normal PBS control group was 1.00±0.02, the relative expression of VP38 in the ILA group was 0.89±0.03, the relative expression of VP38 in the ILA+rCiNPM1a group was 0.64±0.05, the relative expression of VP38 in the ILA+rVP38 group was 0.65±0.13, and the relative expression of VP38 in the ILA+rCiNPM1a+rVP38 group was 0.52±0.04, indicating that the viral load in the ILA+rCiNPM1a+rVP38 group was significantly lower than that in other groups (Mann-Whitney test, P<0.01), as shown in Figure 6 .

[0096] Table 3 Primers of Example 4

[0097]

[0098]

[0099] Example 5

[0100] The effect of grass carp NPM1a and II type reovirus VP38 recombinant protein composition on the survival rate of grass carp against hemorrhagic disease, specifically comprising the following steps:

[0101] Step (1): Grass carp NPM1a and II type reovirus VP38 recombinant protein composition immunize grass carp

[0102] Select healthy, body length of about 10-12 cm, body weight of about 15-20 g of the same batch of grass carp, divided into five groups, 30 fish in each group, the temperature of the breeding room is maintained at 28℃±0.1, and the rest of the immune method is the same as step (1) of example 2.

[0103] Step (2): detection of survival rate of grass carp after infection with GCRV

[0104] After the challenge, observe for 15 days and count the mortality rate, calculate the relative protection rate, and evaluate the effect of the fusion protein combined with indole-3-lactic acid on the ability of grass carp to resist hemorrhagic disease. The experimental results show that after 15 days, the number of deaths in the normal PBS control group is 27, the number of deaths in the ILA group is 22, the number of deaths in the ILA+rCiNPM1a group is 13, the number of deaths in the ILA+rVP38 group is 12, and the number of deaths in the ILA+rCiNPM1a+rVP38 group is 4. Using the relative survival rate = 1-immune group mortality rate / control group mortality rate, the relative survival rate of each group was calculated, and the results showed that the relative survival rate of the ILA group was 18.5%, the relative survival rate of the ILA+rCiNPM1a group was 51.9%, the relative survival rate of the ILA+rVP38 group was 55.6%, and the relative survival rate of the ILA+rCiNPM1a+rVP38 group was 85.2%, indicating that the relative survival rate of the ILA+rCiNPM1a+rVP38 group was significantly higher than that of the other groups (Log-rank test, P<0.01), as shown in Figure 7

[0105] The above is a preferred embodiment of the present application, it should be noted that for those skilled in the art, without departing from the principles of the present application, can make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.​

Claims

1. A composition, characterized in that, The composition consists of a fusion recombinant protein of grass carp NPM1a and type II reovirus VP38 and indole-3-lactic acid in a mass ratio of 1:5 to 1:10, and the amino acid sequence of the fusion recombinant protein is shown in SEQ ID NO:

3.

2. The composition according to claim 1, characterized in that, The nucleotide sequence of the fusion gene of the grass carp NPM1a and type II reovirus VP38 is shown in SEQ ID NO: 1; The fusion gene was obtained by linking grass carp NPM1a and type II reovirus VP38 through a linker sequence. A BamH restriction site was added to the 5' end of the fusion sequence, and an XhoI restriction site was added to the 3' end. The linker sequence is shown in SEQ ID NO:

2.

3. The composition according to claim 2, characterized in that, The method for preparing the fusion recombinant protein includes the following steps: (1) A linker sequence was inserted between the grass carp NPM1a and type II reovirus VP38 genes to synthesize the grass carp NPM1a and type II reovirus VP38 fusion gene; (2) The fusion gene of grass carp NPM1a and type II reovirus VP38 was ligated into a recombinant expression vector and transformed into an Escherichia coli expression strain; (3) The recombinant protein was induced to express, purified, and the fusion recombinant protein of grass carp NPM1a and type II reovirus VP38 was obtained.

4. The composition according to claim 3, characterized in that, The insertion of the linker sequence in step (1) specifically includes: using the Overlap PCR method, adding a BamH restriction site to the 5' end of the fusion sequence and an XhoI restriction site to the 3' end, and linking the grass carp NPM1a to type II reovirus VP38 through the flexible polypeptide encoded by the linker sequence. The amino acid sequence of the flexible polypeptide encoded by the linker sequence is shown in SEQ ID NO:

4.

5. The composition according to claim 3, characterized in that, The recombinant expression vector mentioned in step (2) is the pET28a vector. The transformation into the Escherichia coli expression strain specifically includes: transforming the recombinant expression vector into Escherichia coli DH5α competent cells using the CaCl2 method to obtain the recombinant plasmid, verifying it by sequencing, and then transforming the recombinant plasmid into the Escherichia coli BL21 expression strain.

6. The composition according to claim 3, characterized in that, The induction of recombinant protein expression in step (3) specifically includes: inoculating 100-200 μl of Escherichia coli BL21 containing recombinant plasmid into 200 ml of LB liquid medium at a ratio of 1:100-1:200, adding kanamycin to the medium to a final concentration of 30-50 µg / ml; then placing the culture flask in a shaker at 37℃ and 180-220 rpm and culturing until the OD is 0.4-0.5; adding IPTG to the culture flask to a final concentration of 0.2-0.4 mM, and then culturing the culture flask in a shaker at 16℃ and 120-140 rpm; after 6-8 h, centrifuging to collect the bacterial cells, adding 5-10 ml of protein lysis buffer, using an ultrasonic cell disruptor to disrupt the cells at low temperature, and centrifuging at 10000-12000 rpm to collect the supernatant; The precipitation and purification specifically includes: adding the supernatant to a Ni-NTA protein chromatography column to purify the recombinant protein of grass carp NPM1a and type II reovirus VP38.

7. An application of the composition according to any one of claims 1-6, characterized in that, The composition is used to prepare a vaccine that enhances the resistance of grass carp to hemorrhagic disease.

Citation Information

Patent Citations

  • Oral vaccine for treating grass carp hemorrage as well as preparation and application thereof

    CN105801707A

  • Type II grass carp reovirus VP4-NS38 fusion protein gene, expression vector, strain and application thereof

    CN113214407A