A high-yield vitamin B 12 Recombinant Adhesive Streptomyces engineered strains, their construction methods and applications

By introducing the pos5 gene into *Strombus fasciatus* and driving its expression using different promoters, the problem of insufficient vitamin B12 production in *Strombus fasciatus* was solved, and a significant increase in VB12 production was achieved, meeting the needs of synthetic biology and metabolic engineering.

CN120624498BActive Publication Date: 2026-02-24EAST CHINA UNIV OF SCI & TECH +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510840781.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-23
Publication Date
2026-02-24
Estimated Expiration
2045-06-23

AI Technical Summary

Technical Problem

Existing engineered strains of *Strombus amygdalinus* produce insufficient yields in the biosynthesis of vitamin B12, making it difficult to meet the diverse research and production needs in the fields of synthetic biology and metabolic engineering.

Method used

By introducing the pos5 gene nucleotide sequence into *Strombus viscous*, using a recombinant plasmid to introduce the pos5 gene of NADH kinase, and using different promoters Pw, Ph, and Pd to drive heterologous expression, the supply of VB12 precursor NADPH was enhanced, thereby increasing sugar conversion rate and biosynthetic yield.

Benefits of technology

By heterologously expressing the NADH kinase gene of Saccharomyces cerevisiae, the NADPH content in *Strombus aegyptium* was increased by 70%, the sugar conversion rate was increased by 30%, and the VB12 yield was increased by 9%, providing a new and improved approach for VB12 biosynthesis in *Strombus aegyptium*.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624498B_ABST
    Figure CN120624498B_ABST
Patent Text Reader

Abstract

The application discloses a recombinant gluconacetobacter engineering strain with high vitamin B 12 yield and a construction method and application thereof, and belongs to the technical field of engineering strains. The construction method comprises the following steps: taking gluconacetobacter as a starting strain, and introducing a pos5 gene coding NADH kinase to construct a recombinant gluconacetobacter engineering strain with high vitamin B 12 yield. By heterologously expressing the NADH kinase (pos5) gene from saccharomyces cerevisiae, the transformation of NADH in the cytoplasm of the gluconacetobacter to NADPH is promoted, the content of NADPH is increased by 70%, thereby the metabolic flux is improved, more flows to the VB 12 synthesis pathway, finally the sugar conversion rate is increased by 31%, and the VB 12 yield is increased by 9%. The application provides new technologies and applications for subsequent improvement of VB 12 biosynthesis in the gluconacetobacter.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of engineered bacterial strain technology, and in particular to a high-yield vitamin B12 strain. 12 Recombinant Adhesive Streptomyces engineered strains, their construction methods, and applications. Background Technology

[0002] Ensifer adhaerens is a vitamin B12 fungus. 12 Typical strains of *Strombus amygdalinus* are used in industrial production due to their simple fermentation process and relatively convenient culture conditions. Optimization of the metabolic pathways of *Strombus amygdalinus* is important, and this can be achieved by inhibiting or attenuating VB. 12 The final product VB can be improved by using competitive pathways for intermediate metabolites, overexpression of key synthetic genes, and fusion expression. 12 Production.

[0003] Furthermore, high expression of heterologous genes in *Strombus amygdalinus* can be achieved by replacing the promoter. Gene transcription is triggered by the promoter and is a core step in regulating gene expression levels and patterns. Some highly efficient natural promoters, derived from diverse biological hosts, have been identified, developed, and widely used in scientific research and manufacturing. However, the rapid advancements in the biotechnology industry have made it increasingly difficult for existing high-quality promoter resources and their singular response modes to meet the ever-growing and diversified research and production demands.

[0004] Therefore, it is necessary to study the vitamin B content in *Strombus amygdalinus*. 12 The biosynthetic pathways are being modified to meet the new requirements of the chassis host in the fields of synthetic biology and metabolic engineering. Summary of the Invention

[0005] The purpose of this invention is to provide a high-yield vitamin B12 product. 12 This invention discloses a recombinant *Strombus adherentus* engineered strain, its construction method, and its application, aiming to solve the problems existing in the prior art. The recombinant *Strombus adherentus* engineered strain constructed in this invention is used to produce vitamin B. 12 The ability to utilize it for vitamin B is significantly enhanced. 12 Fermentation production can significantly increase vitamin B content. 12 Production.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a high-yield vitamin B 12 The method for constructing recombinant *Strombus adhesiveus* engineered strains includes using *Strombus adhesiveus* as the starting strain and introducing the pos5 gene encoding NADH kinase to construct a high-yield vitamin B complex. 12 The steps for recombinant engineered strains of *Strombus aegyptiacus*.

[0008] Optionally, the nucleotide sequence of the pos5 gene is shown in SEQ ID NO.2.

[0009] Optionally, the pos5 gene is introduced via a recombinant plasmid;

[0010] The recombinant plasmid was constructed by inserting the promoter Pw and pos5 genes into the pSET152 plasmid as a backbone.

[0011] The nucleotide sequence of the promoter Pw is shown in SEQ ID NO.5.

[0012] Optionally, the pos5 gene is derived from Saccharomyces cerevisiae.

[0013] This invention also provides high-yield vitamin B obtained according to the described construction method. 12 Recombinant Adhesive Streptomyces engineered strain.

[0014] This invention also provides the recombinant *Strombus adhesiveus* engineered strain in the production of vitamin B. 12 Applications in [the field].

[0015] This invention also provides a method for producing vitamin B. 12 The method includes the step of fermentation production using the recombinant engineered strain of *Strombus amygdalinus*.

[0016] Optionally, the fermentation includes shake-flask fermentation.

[0017] The present invention discloses the following technical effects:

[0018] This invention enhances VB by introducing different NADPH cofactor regulatory genes pos5, gnd, zwf, or sthA into the genome of *Striga fasciatus* using homologous single crossover, and by verifying the pos5 gene under different promoters. 12 The supply of precursor NADPH ultimately improves sugar conversion and vitamin B content in *Strombus agglutinosa*. 12 The biosynthetic yield was increased. Heterologous expression of the NADH kinase (pos5) gene from *Saccharomyces cerevisiae* promoted the conversion of NADH to NADPH in the cytoplasm of *Strombus aegyptium*, increasing NADPH levels by 70%, thereby enhancing metabolic flux and directing more fluids to vitamin B. 12 The synthetic pathway ultimately increased sugar conversion rate by 30%, and VB 12 Yield increased by 9%. This invention paves the way for subsequent VB production in *Strombus amygdalinus*. 12 Improvements in biosynthesis have provided new technologies and applications. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The diagram shows the validation of pos5, gnd, zwf, and sth gene insertion driven by promoter Pw; A: Schematic diagram of gene validation primer design; B: Conjugator PCR validation of nucleic acid electrophoresis results; In the left image, lane M: marker, lane 1: strain GND, lane 3: control group; In the right image, lane M: marker, lanes 1-3: strain POS5, lanes 4-6: strain ZWF, lanes 7-10: strain STHA; lane 11: control group; C: Sequencing validation results; Note: Lane 2 is an erroneous band, which does not affect the validation results.

[0021] Figure 2 The cofactor content (A) and cofactor ratio (B) of strain WT and experimental group strains POS5, GND, ZWF and STHA;

[0022] Figure 3 A: Schematic diagram of pos5 gene insertion verification under different promoters; B: Conjugation PCR verification of nucleic acid electrophoresis results; Lane M: marker, Lanes 1-3: strain Pw-pos5, Lanes 4-6: Ph-pos5, Lanes 7-9: Pd-pos5, Lane 10: control; C: Sequencing verification results.

[0023] Figure 4 The content of each cofactor (A) and NADP of the pos5 gene after expression in *Strombus amygdalinus* under different promoters. + +NADPH / NAD + +NADH ratio (B);

[0024] Figure 5 A diagram illustrating the functional validation of the pos5 gene expression in *Strombus amygdalinus* under different promoter activations; B 12 Production; B: B 12 Specific yield; C: sugar conversion rate. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] The *Ensifer adhaerens* used in this invention is from the American Type Culture Collection (ATCC), and its strain name is ATCC 21921.

[0031] Plate culture medium (g·L) -1 Ingredients: 17.0g tryptone, 3.0g soy peptone, 2.5g D-glucose, 5.0g NaCl, and 2.5g K2HPO4. Autoclave at 121℃ for 25 minutes.

[0032] Primary seed culture medium (g·L) -1 The mixture consisted of 12.86g sucrose, 57.14g molasses, 0.00714g DMBI, 1.07g MgSO4·7H2O, 0.14g MnSO4·H2O, 0.01429g ZnSO4·7H2O, 0.5g (NH4)2SO4, 1.64g (NH3)2HPO4, and 0.01429g CoCl2·6H2O. The solution was sterilized at pH 7.4 for 25 minutes at 121°C.

[0033] Secondary seed culture medium (g·L) -1 The mixture consisted of 83.0g molasses, 20.8g sucrose, 0.156g MnSO4·H2O, 0.02g ZnSO4·7H2O, 2.3g (NH4)2SO4, 1.5g MgSO4·7H2O, 0.7g (NH4)2HPO4, 2.95g CaCO3, 4.2g betaine, 0.004g DMBI, and 0.02g CoCl2·6H2O. The solution was sterilized at 121℃ for 25 minutes at pH 7.4.

[0034] Fermentation medium (g·L) -1 The ingredients are: 80.0g sucrose, 55.0g corn steep liquor, 1.16g MgSO4·7H2O, 0.58g MgO, 0.09g ZnSO4·7H2O, 2.0g (NH4)2SO4, 0.58g (NH3)2HPO4, 2.64g glycerophosphate, 0.88g KH2PO4, 0.7g FeCl3, 20.9g betaine, 0.058g DMBI, 0.088g CoCl2·6H2O, and 1.16g CaCO3. The pH is adjusted to 7.4, and the mixture is sterilized at 121℃ for 25 minutes.

[0035] SEQ ID NO.1 (gnd nucleotide sequence):

[0036]

[0037] SEQ ID NO.2 (pos5 nucleotide sequence, from Saccharomyces cerevisiae):

[0038]

[0039] SEQ ID NO.3 (zwf nucleotide sequence):

[0040]

[0041] SEQ ID NO.4 (sthA nucleotide sequence):

[0042]

[0043] SEQ ID NO.5 (Nucleotide sequence of Pw promoter):

[0044] ATCGTTCAGAATCACCTGGTCGGGGCGTTTGCCGAATCTCTGCGTTGATTCTGCTGATTCCTCAGGCCGCCATCCTTTCTCCACCAAGCGCTTTCTTGGAGCGAATGCTGTTTTAGGCATTCACTGGACATCTGAAACGGGGTTCGCGTCCAGCTTTTCCCCTGTTTTGGGCGGGTTTCTGCCTCTTTCTGAAACAGGCGACCCCCACCTTCCTTATGCTAACCCCCCGTCGCTAAAGGGTTTTCTTAATGCTTTGTTAATTTTCTGCGGGGGTCTGCGGCGATTTTGTGTCGTTTCAGCAACAGGCCTCGGCGAAGGGCGATGCAAAGGACGTGAACTCGCTAGTTGGACGTTGCGCCGGTGATCCGGTCTTGTATTTTCAACTCCGGAAGCAAGGGCGGTTGATCGTCCGACTTCTTGAACGTTGGGGATGGGGCAGGGAAAGCTGTCCTTCAGCAAAATACCCAGACCCGTTTGAAACTTTTGACTGGAGGTCAGAA;

[0045] SEQ ID NO.6 (Nucleotide sequence of Ph promoter):

[0046] CGGCTGCGGATGAACTGCTTGACCGCCTCGTAGCGCGGCATCGGGCCGTCTTCGAAAGCGATTGTCTCGTTCCGTTTTCCCAGTGCCGTCATCAACTCAAGCCCCGCCTTTCCGCGCCGCCGAACAAATCATGCGCATTCGCCCTCGAATCTTTTCGTTCATTTCACGCTTGCGCGCCAGCGTAAAATATCTATAGTTCCATATACAACTACGTACAGGAAAATGCAC;

[0047] SEQ ID NO.7 (Nucleotide sequence of Pd promoter):

[0048] GCCGCCCGTGAACCTCGATTTGACAGGGGATCCGGCCTGTAGGCAGGCTGCGGCCAATGGCCCATTTCGGGCTAGACAAATCCCGGGCTTGCTTTTGCCCCCAAACGCCCCGCAGAATGCCTTGCAGTCCG AAACGCCGGTCCTTATATACGCCGCATCGGCGCAGTCTAAGCTGCGAAGAAATCCAAAGACCATCCCGTTAGGGGCTGTCTCACGAATGCCTGACCGGGTTCCGACAGTCCGCTGCAAGGAGAGAACGAC;

[0049] SEQ ID NO.8 (Pw-F nucleotide sequence):

[0050] ACGGCCAGTGCCAAGCTTATCGTTCAGAATCACCTGGT;

[0051] SEQ ID NO.9 (Pw-R nucleotide sequence):

[0052] TAGAGTCGACCTGCAGCCCTTTCTGACCTCCAGTCAAAAGTT;

[0053] SEQ ID NO.10 (gnd-F nucleotide sequence):

[0054] CTTTTGACTGGAGGTCAGAAATGTCCAAGCAACAGATCGG;

[0055] SEQ ID NO.11 (gnd-R nucleotide sequence):

[0056] CGACGGCCAGTGCCAAGCTTTTTAATCCAGCCATTCGGTAT;

[0057] SEQ ID NO.12 (zwf-F nucleotide sequence):

[0058] CTTTTGACTGGAGGTCAGAAATGGCGGTAACGCAAACAGC;

[0059] SEQ ID NO.13 (zwf-R nucleotide sequence):

[0060] CGACGGCCAGTGCCAAGCTTTTACTCAAACTCATTCCAGG;

[0061] SEQ ID NO.14 (sthA-F nucleotide sequence):

[0062] CTTTTGACTGGAGGTCAGAAGGCTTACCCGCGATAAAATG;

[0063] SEQ ID NO.15 (sthA-R nucleotide sequence):

[0064] TATGACATGATTACGAATTCTTAAAACAGGCGGTTTAAAC;

[0065] SEQ ID NO.16 (152-Pw-F nucleotide sequence):

[0066] GGCTGCAGGTCGACTCTAGAATCGTTCAGAATCACCTGGT;

[0067] SEQ ID NO.17 (152-Pw-R nucleotide sequence):

[0068] TCAATTTAACCCTGACAAACATTTCTGACCTCCAGTCAAAAGTT;

[0069] SEQ ID NO.18 (152-Ph-F nucleotide sequence):

[0070] CTGCAGGTCGACTCTAGACGGCTGCGGATGAAC;

[0071] SEQ ID NO.19 (152-Ph-R nucleotide sequence):

[0072] TGACAAACATGTGCATTTTCCTGTACGTAGT;

[0073] SEQ ID NO.20 (152-Pd-F nucleotide sequence):

[0074] GCTGCAGGTCGACTCTAGAGCCGCCCGTGAACCTC;

[0075] SEQ ID NO.21 (152-Pd-R nucleotide sequence):

[0076] TCAATTTAACCCTGACAAACATGTCGTTCTCTCCTTGCAG;

[0077] SEQ ID NO.22 (ty-F nucleotide sequence):

[0078] CAGGGTTTTCGTGCCTGAAAGGAGAAATTGT;

[0079] SEQ ID NO.23 (ty-R nucleotide sequence):

[0080] CGTGACTGGGAAGCAGATGCTGCCTGT;

[0081] SEQ ID NO.24 (homological arm nucleotide sequence):

[0082] CGTGCCTGAAAGGAGAAATTGTCATGGTGGAGTACGCGCCCGGGGAGCCCAAGGG CACGCCCTGGCACCCGCACCGGGCCATCACAGGCAGCATCTGCTT;

[0083] SEQ ID NO.25 (Selection marker gene nucleotide sequence):

[0084] ATGTCATCAGCGGTGGAGTGCAATGTCGTGCAATACGAATGGCGAAAAGCCGAGCTCATCGGTCAGCTTCTCAACCTTGGGGTTACCCCCGGCGGTGTGCTGCTGGTCCACAGCTCCTTCCGTAGCGTCCGGCCCCTCGAAGATGGGCCACTTGGACTGATCGAGGCCCTGCGTGCTGCGCTGGGTCCGGGAGGGACGCTCGTCATGCCCTCGTGGTCAGGTCTGGACGACGAGCCGTTCGATCCTGCCACGTCGCCCGTTACACCGGACCTTGGAGTTGTCTCTGACACATTCTGGCGCCTGCCAAATGTAAAGCGCAGCGCCCATCCATTTGCCTTTGCGGCAGCGGGGCCACAGGCAGAGCAGATCATCTCTGATCCATTGCCCCTGCCACCTCACTCGCCTGCAAGCCCGGTCGCCCGTGTCCATGAACTCGATGGGCAGGTACTTCTCCTCGGCGTGGGACACGATGCCAACACGACGCTGCATCTTGCCGAGTTGATGGCAAAGGTTCCCTATGGGGTGCCGAGACACTGCACCATTCTTCAGGATGGCAAGTTGGTACGCGTCGATTATCTCGAGAATGACCACTGCTGTGAGCGCTTTGCCTTGGCGGACAGGTGGCTCAAGGAGAAGAGCCTTCAGAAGGAAGGTCCAGTCGGTCATGCCTTTGCTCGGTTGATCCGCTCCCGCGACATTGTGGCGACAGCCCTGGGTCAACTGGGCCGAGATCCGTTGATCTTCCTGCATCCGCCAGAGGCGGGATGCGAAGAATGCGATGCCGCTCGCCAGTCGATTGGC;

[0085] SEQ ID NO.26 (ori nucleotide sequence):

[0086] .

[0087] This technical solution includes the following steps:

[0088] (1) On the suicide plasmid pOJ260, construct promoters driven by Pw, namely pos5 (encoding NADH kinase), gnd (encoding 6-phosphoglucose dehydrogenase), zwf (encoding glucose-6-phosphate dehydrogenase), and sthA (encoding NAD(P)). +The transhydrogenase gene was digested using the pOJ260 vector plasmid. PCR primers for the promoter Pw were designed using *Strombus amygdalinus* as a template (nucleic acid sequences as shown in SEQ ID NO. 8 and SEQ ID NO. 9). The target fragment pos5 was amplified by PCR using *Saccharomyces cerevisiae* as a template. The amplification reaction system is shown in Table 1, and the reaction program is shown in Table 2. 2×Phanta Flash Master Mix was used to amplify the DNA fragment for recombination, with a working efficiency of 1000 bp / 10 s. The extension time was set according to the length of the target fragment. Primers for gnd, zwf, and sthA were designed using *Strombus amygdalinus* as a template: gnd-F / gnd-R (SEQ ID NO. 10 and SEQ ID NO. 11), zwf-F / zwf-R (SEQ ID NO. 12 and SEQ ID NO. 13), and sthA-F / sthA-R (SEQ ID NO. 14 and SEQ ID NO. 15). NO.15), using *Strombus aegyptiacus* as a template, the target fragments gnd, zwf, and sthA were obtained by PCR. The amplification reaction system is shown in Table 1, and the reaction procedure is shown in Table 2. The digested vector plasmid pOJ260, promoter Pw, and four target fragments were ligated with recombinase to obtain four recombinant plasmids: pOJ260-Pw-pos5, pOJ260-Pw-gnd, pOJ260-Pw-zwf, and pOJ260-Pw-sthA.

[0089] (2) Recombinant pSET152 plasmid vectors with exogenous gene expression cassettes driven by Pw, Ph, and Pd promoters were constructed respectively. The original pSET152 plasmid was digested with enzymes at the multiple cloning site. Homologous arm sequences (SEQ ID NO. 24) and primers for the Pw, Ph, and Pd promoters, 152-Pw-F / 152-Pw-R (SEQ ID NO. 16 and SEQ ID NO. 17), 152-Ph-F / 152-Ph-R (SEQ ID NO. 18 and SEQ ID NO. 19), and 152-Pd-F / 152-Pd-R (SEQ ID NO. 20 and SEQ ID NO. 21), were designed using *Strombus aegyptiacus* as a template. Homologous arm sequences (primers ty-F / ty-R, as shown in SEQ ID NO. 22 and SEQ ID NO. 21) were obtained by PCR using *Strombus aegyptiacus* as a template. The amplification reaction system is shown in Table 1, and the reaction procedure is shown in Table 2. The pos5 fragment was obtained by PCR amplification using Saccharomyces cerevisiae as a template and ligated with ligase. The recombinant vector includes: the target gene pos5 and the upstream and downstream homologous arm sequences of the insertion site, the selection marker gene sequence (nucleic acid sequence as shown in SEQ ID NO.25), and the replicon (ori) in Escherichia coli (nucleic acid sequence as shown in SEQ ID NO.26).

[0090] Table 1 PCR amplification reaction system

[0091]

[0092]

[0093] Table 2 PCR amplification reaction procedure

[0094] stage Temperature (°C) Time (s) Cycle number Pre-variation 98 30 1 time Cyclic reaction 35 times -transsexual 98 10 - -annealing 56 5 - -extend 72 20-90 - Post-extension 72 90 1 time save 4-10 Indefinite -

[0095] (3) The recombinant vector was introduced into competent E. coli S17-1 cells, and the target gene was inserted into the homologous position of the E. adhaerens genome through intergeneric fusion transfer. Mutants with successful insertion of the target gene were screened, and the integration event was confirmed by PCR and sequence analysis. An upstream primer (SEQ ID NO. 20) was designed to be placed on the genomic DNA, and a downstream primer (SEQ ID NO. 21) was designed to be placed in the middle of the target gene pos5. The PCR product contained a segment of genomic DNA, a promoter, and a segment of the pos5 gene. The PCR product was then sequenced and verified using the above two primers.

[0096] (4) After inoculating and culturing different recombinant strains and the control strain E. adhaerens, the cofactor content and cofactor ratio of strains POS5, GND, ZWF, and STHA were detected; the NADPH and NADP of the POS5 series recombinant strains under different promoter initiation were also measured. + NADH, NAD + The content and sugar conversion rate were detected. The strain on the plate was subjected to shake-flask fermentation for 7 days, and the VB content in the fermentation broth was measured. 12 Production volume. Specifically, this includes:

[0097] (4-1) Pick a single colony of *Strombus aegyptiacus* and incubate it in a TSB tube for 24 hours. Take 500 μL of the bacterial culture, centrifuge, discard the supernatant, and proceed with the analysis. Use Beyotime's NADP... + / NADPH assay kit (WST-8 method) and NAD + / NADH Assay Kit (WST-8 Method) for the Detection of NADPH and NADP + NADH and NAD + The content of NADPH. NADPH is highly degradable, and most operations should be rapid and protected from light;

[0098] (4-2) The shake-flask fermentation process is as follows: The strain was streaked on a plate medium for 4 to 5 days, then about 1 / 3 of the cells were scraped and inoculated into the primary seed medium. After culturing at 30℃ and 260 rpm for 24 h, it was inoculated into the secondary seed medium at a 1.5% inoculum and cultured under the same conditions for about 20 h. Then, it was inoculated into the fermentation medium at a 10% inoculum ratio, and the temperature was set at 32℃ and 260 rpm for 168 h. Starting from 48 h of culture, samples were taken every 24 hours, and the residual sugar concentration was determined using the DNS colorimetric method. At 48 h, glucose and betaine were added: 2 mL for feed 1 and 200 μL for feed 2.

[0099] Feed 1 consisted of 55% glucose, 0.45g cobalt chloride, and 0.45g DMBI; Feed 2 consisted of 100g betaine, 1.6g cobalt chloride, and 1.6g DMBI, with a pH of 6.0.

[0100] (4-3)VB 12 The detection method used was a liquid chromatograph (Shimadzu LC-2030, Japan), and the steps were as follows:

[0101] Preparation of the mobile phase: Mix 300 mL of methanol, 700 mL of water and 2 mL of acetic acid, adjust the pH to 7.0 with ammonia, then vacuum filter, and finally transfer it to a mobile phase bottle and sonicate for 30 minutes.

[0102] Sample preparation steps: Take 1 mL of fermentation broth, then add 200 μL of glacial acetic acid, 200 μL of 8% NaNO2 solution, and one drop of defoamer, and carry out the hydrolysis reaction for 30 minutes. After treatment, cool it to room temperature, then dilute it with water to 2.5 mL, filter it through a funnel, and take 200 μL of the filtrate into a liquid chromatography vial for subsequent analysis.

[0103] Chromatographic conditions: Waters C18 column (5 μm, 4.6 × 250 nm), injection volume 20 μL, column temperature 40 °C, flow rate 1.0 mL / min, detection wavelength 550 nm. See the following examples for details.

[0104] Example 1: Construction of different NADPH-regulating plasmid strains in *Streptococcus adhesiveus*

[0105] In this embodiment, four recombinant plasmids, pOJ260-Pw-pos5, pOJ260-Pw-gnd, pOJ260-Pw-zwf, and pOJ260-Pw-sthA, were constructed on the suicide plasmid pOJ260, driven by the promoter Pw (nucleotide sequence shown in SEQ ID NO. 5). These recombinant plasmids were pOJ260-Pw-pos5, pOJ260-Pw-gnd, pOJ260-Pw-zwf, and pOJ260-Pw-sthA. These plasmids were then integrated into *Strombus aegyptiacus* via homologous single crossover for preliminary verification of NADPH regulation levels. The plasmids were transformed into competent *E. coli* S17-1 cells using standard procedures, and then ligated with *Strombus amygdalinus* to obtain four recombinant strains: POS5, GND, ZWF, and STHA. Genotyping of the four conjugates was performed, successfully amplifying bands of 6314 bp, 6476 bp, 6545 bp, and 6535 bp, respectively. Further sequencing confirmed the correct genotypes of all four strains. The verification results are as follows: Figure 1 .

[0106] Example 2: Construction of the pos5 series strains of *Streptococcus adhesioides* under the action of different promoters

[0107] To investigate the effect of different promoter strengths on pos5 gene expression, this embodiment constructed three plasmids driving pos5 gene expression with different promoters: pMW-Pw-pos5 driven by the strong promoter Pw (nucleotide sequence shown in SEQ ID NO.5), and pSET-Ph-pos5 and pSET-Pd-pos5 driven by the moderate promoters Ph (nucleotide sequence shown in SEQ ID NO.6) and Pd (nucleotide sequence shown in SEQ ID NO.7). These three recombinant plasmids were transformed into E. coli S17-1 competent cells according to standard procedures, and intermetagenological synergistic transfer was performed with E. adhaerens to obtain three recombinant strains: Pw-pos5, Ph-pos5, and Pd-pos5. Genotyping of the three conjugates was performed, successfully amplifying bands of 5028 bp, 4592 bp, and 4625 bp, respectively. Further sequencing showed that the genotypes of all three strains were correct. The verification results are as follows: Figure 3 .

[0108] Example 3: Functional verification of *Strombus adhesiveus* strains with different NADPH-regulated plasmids.

[0109] After successfully obtaining the correctly genotyped conjugates, the four recombinant strains from Example 1 were inoculated into 5 mL TSB medium containing kanamycin (50 μg / mL) and apramycin (50 μg / mL) and cultured at 30°C for 24 hours, respectively. Simultaneously, the control strain *E. adhaerens* was cultured. All strains were streaked onto fermentation plates and cultured at 30°C for 5 days. Subsequently, NADPH and NADP levels in the TSB tubes were measured. + NADH and NAD + Content, results are shown in Figure 2 NADP + Compared with the wild type, all four recombinant strains showed significant improvements, while NADH levels were slightly reduced, and NADP levels in POS5 were also significantly increased. + The most significant increase was in NADPH levels.

[0110] Example 4: Functional verification of *Streptococcus adhesioides* pos5 series strains under different promoters

[0111] After successfully obtaining the correctly genotyped conjugates, the NADPH and NADP of each strain in Example 2 were tested. + NADH and NAD + Content, results are shown in Figure 4 The strain on the plate was subjected to shake-flask fermentation for 7 days, and VB was measured. 12 Yield. Figure 4 The results showed that the NADPH content of each strain in TSB tubes was significantly higher than that of the wild type, indicating that the pos5 gene was successfully expressed in all three strains: the strain driven by the Pw promoter had the highest NADPH content, while the strains driven by the Pd and Ph promoters had similar NADPH content. Specifically, the Pw-pos5 strain showed a 70% increase in NADPH content, and NADP... + +NADPH / NAD + An 87% increase in NADH levels confirms that the strain's anabolic capacity is significantly enhanced compared to the wild type. (Verified strain VB) 12 Yield and sugar conversion rate (e.g.) Figure 5 All aspects (as shown) showed improvement, with Pw-pos5 strain VB showing improvement. 12 The yield reached 141.6 mg / L, while the wild type yield was 130.0 mg / L. (VB) 12 Yield increased by 9%. The sugar conversion rate of Pd-pos5 strain was 3.11‰, which was 31% higher than that of wild-type strain 2.38‰. The sugar conversion rate of Ph-pos5 was 2.92‰ and that of Pw-pos5 was 2.80‰, which were also 23% and 18% higher than that of wild-type strain, respectively.

[0112] Based on the above results, this invention screens NADPH-regulating genes and expresses homologous single-crossover genes (pos5, gnd, zwf, and sthA) driven by the Pw promoter in *Strombus amygdalinus*. The pos5 gene, driven by different promoters, was constructed in the pSET152 vector, inserted into the *Strombus amygdalinus* genome, and successfully expressed, achieving efficient conversion of NADH to NADPH.

[0113] It was verified that successful expression of the pos5 gene enhances NADPH synthesis, which is crucial for VB production in *Strombus adherentus*. 12 The metabolic pathway provides sufficient reducing power, ultimately reducing VB. 12 Yield increased by 9%, and intracellular glucose conversion improved by 30%, indicating that enhancing NADPH supply can be a feasible metabolic engineering strategy to optimize VB. 12 Production of VB. Future research could further explore its synergistic regulation with other key metabolic pathways, or combine it with overexpression of key genes and optimized fermentation conditions, with the aim of achieving VB production. 12 Significant increase in production.

[0114] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A high-yield vitamin B complex 12 The method for constructing recombinant engineered strains of *Strombus amygdalinus* is characterized by, This includes constructing high-vitamin B production systems by introducing the pos5 gene encoding NADH kinase into *Streptococcus adhesus* strains. 12 The steps for recombinant engineered strains of *Streptococcus adhesus*; The nucleotide sequence of the pos5 gene is shown in SEQ ID NO.2; The pos5 gene was introduced via a recombinant plasmid. The recombinant plasmid was constructed by inserting promoter Pw and pos5 genes into the pSET152 plasmid as a backbone. The nucleotide sequence of the promoter Pw is shown in SEQ ID NO.5; The pos5 gene is derived from Saccharomyces cerevisiae.

2. The high-yield vitamin B obtained by the construction method as described in claim 1 12 Recombinant Adhesive Streptomyces engineered strain.

3. The recombinant *Strombus adhesiveus* engineered strain as described in claim 2 in the production of vitamin B. 12 Applications in [the field].

4. A method for producing vitamin B 12 The method is characterized by, The step includes fermentation using the recombinant Adhesive Streptomyces engineered strain as described in claim 2.

5. The method as described in claim 4, characterized in that, The fermentation includes shake-flask fermentation.

Citation Information

Patent Citations

  • Strain for producing vitamin A and application thereof

    CN118256524A

  • Recombinant ensifer adhesion as well as construction method and application thereof

    CN119592600A

  • Application of ED pathway regulation gene for ensifer adhesion in industrial production of vitamin B12

    CN120173986A