A lamp assimilation probe, kit and loop-mediated isothermal amplification method

By designing a novel LAMP assimilation probe, the quenching probe is stable in the absence of a template and is displaced and extended in the presence of a template. The free probe can be used as a primer, which solves the problem of low sensitivity in traditional LAMP detection and achieves rapid, specific and accurate detection results.

CN120624613BActive Publication Date: 2026-05-19SHENZHEN YILIFANG BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510675409.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2026-05-19
Estimated Expiration
2045-05-23

AI Technical Summary

Technical Problem

Traditional LAMP assays suffer from low sensitivity of assimilation probes, residual probes after reaction affect detection efficiency, and primer design is difficult, operation is cumbersome, cost is high, and the length of amplified fragments is limited.

Method used

A novel LAMP assimilation probe is designed, comprising a quenching probe and a fluorescent probe. The quenching probe is a quenching group labeled with an endogenous sequence of the target gene. The fluorescent probe is complementary to the quenching probe, with the fluorescent group labeled in between. The quenching probe is stable in the absence of a template and is displaced and extended in the presence of a template. The free probe can be used as a primer, and the fluorescent probe alone can also generate a signal.

Benefits of technology

It improves reaction speed and sensitivity, reduces false negative rate, achieves simple, fast, specific and accurate detection, and enhances fluorescence signal intensity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624613B_ABST
    Figure CN120624613B_ABST
Patent Text Reader

Abstract

The application provides a LAMP assimilation probe, a kit and a loop-mediated isothermal amplification method, and belongs to the technical field of biology.The assimilation probe comprises a quenched probe and a fluorescent probe, the quenched probe is an endogenous sequence between a target gene F1 gene and a B1c gene or between a F1c gene and a B1 gene, and a quencher group is labeled at the 5' end of the quenched probe; the fluorescent probe comprises a first oligonucleotide chain and a second oligonucleotide chain, and a fluorescent group of the fluorescent probe is labeled between the first oligonucleotide chain and the second oligonucleotide chain.The LAMP reaction kit comprises LAMP primers for amplifying a target gene and the LAMP assimilation probe.The LAMP method based on the LAMP assimilation probe and the LAMP reaction kit of the application can be used to detect a target object, and the reaction speed, the sensitivity and the fluorescent signal are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a LAMP assimilation probe, kit, and loop-mediated isothermal amplification method. Background Technology

[0002] Loop-mediated isothermal amplification (LAMP) is a novel isothermal nucleic acid amplification method developed in 2000. Its key feature is the design of four specific primers targeting six regions of the target gene. The amplification reaction is completed using a strand displacement DNA polymerase under isothermal conditions (around 63°C) for 30-60 minutes. LAMP offers advantages such as speed, sensitivity, simplicity, and no need for temperature cycling; it can amplify 10^10 DNA molecules within 10 minutes using the strand displacement polymerase. 9 -10 10 Isothermal amplification, using one copy of the target nucleic acid, is currently the most widely used technique in scientific research and clinical practice. Compared with conventional PCR, it does not require processes such as template thermal denaturation, temperature cycling, electrophoresis, and ultraviolet observation, and has become a promising and attractive alternative strategy for PCR detection, which can be used for point-of-care testing (POCT) of pathogens including Bordetella pertussis.

[0003] LAMP assays rely on real-time fluorescence dye curves and melting temperature curves for product analysis and identification. Primer design for these methods is extremely difficult and cannot guarantee high specificity. Traditional LAMP assays based on enzyme digestion or Tm values ​​are cumbersome, costly, and limited in amplified fragment length. Assimilation probes based on the fluorescence resonance energy transfer (FRET) principle are the most frequently used, most specific, and most stable probe model in LAMP assays, and have been widely applied to the detection of various pathogens, including the novel coronavirus, Zika virus, dengue virus, HIV, and Salmonella enterica. Assimilation probes consist of two partially complementary oligonucleotides: a fluorescent probe and a quencher probe. The fluorescent probe is designed by adding a fluorescently labeled universal oligonucleotide (F chain) to the 5' end of a circular primer (LF or LB). The quencher probe is complementary to the F chain of the fluorescent probe and is labeled with a quencher group at its 3' end. In the absence of target DNA, hybridization between the fluorescent and quencher probes brings the quencher and fluorescent groups together, quenching the fluorescence signal. In the presence of target DNA, LAMP is initiated. Along the DNA strand initiated by the fluorescent probe, the newly synthesized DNA strand replaces the quenching probe to release the fluorescent signal of the fluorophore. In traditional assimilation probes, the two strands (fluorescent probe and quenching probe) separate after the reaction and remain in the LAMP system, resulting in low sensitivity of the assimilation probe and affecting detection efficiency. Summary of the Invention

[0004] The purpose of this invention is to provide a LAMP assimilation probe, a kit, and a loop-mediated isothermal amplification method. The fluorescent probe and quencher probe of the assimilation probe can be repeatedly cycled and reused in the LAMP system, thereby accelerating the reaction rate and improving the sensitivity of the assimilation probe.

[0005] The technical solution of the present invention is as follows:

[0006] This invention provides a LAMP assimilation probe, comprising a quenching probe and a fluorescent probe. The quenching probe is an endogenous sequence between the target gene F1 gene and the B1c gene, or between the F1c gene and the B1 gene, and the 5' end of the quenching probe is labeled with a quenching group. The fluorescent probe comprises a first oligonucleotide chain and a second oligonucleotide chain, the first oligonucleotide chain being complementary to the sequence of the quenching probe, the second oligonucleotide chain being a loop primer sequence for LAMP, and the fluorescent group of the fluorescent probe being labeled between the first oligonucleotide chain and the second oligonucleotide chain.

[0007] In one embodiment, the two ends of the quenching probe are marked with quenching groups.

[0008] In one implementation, the 5' to 3' sequence orientation of the quenching probe is consistent with the sequence orientation of the LAMP outer primer F3 and the loop primer LB.

[0009] In one embodiment, the Tm range for the quenching probe and the fluorescent probe to form a DNA double strand is 70–85°C.

[0010] In one embodiment, the concentration ratio of the quenching probe to the fluorescent probe is 0~7:1.

[0011] The present invention also provides a LAMP reaction kit, the kit comprising LAMP primers for amplifying target genes and the aforementioned LAMP assimilation probe.

[0012] In one embodiment, the LAMP primers include F3 primer, B3 primer, FIP primer, BIP primer, LF primer, and LB primer; the nucleotide sequence of the F3 primer is shown in SEQ ID NO.1, the nucleotide sequence of the B3 primer is shown in SEQ ID NO.2, the nucleotide sequence of the FIP primer is shown in SEQ ID NO.3, the nucleotide sequence of the BIP primer is shown in SEQ ID NO.4, the nucleotide sequence of the LF primer is shown in SEQ ID NO.5, and the nucleotide sequence of the LB primer is shown in SEQ ID NO.6.

[0013] The LAMP assimilation probe includes a fluorescent probe and a quenching probe; the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.7, and the nucleotide sequence of the quenching probe is shown in any one of SEQ ID NO.8-10.

[0014] As one implementation, the kit also includes DNA polymerase.

[0015] In one embodiment, the kit further includes any one or more of Bst DNA polymerase, reaction buffer, dNTP mix, MgCl2, and double-distilled water.

[0016] The present invention also provides a method for loop-mediated isothermal amplification based on the above-mentioned LAMP assimilation probe or the above-mentioned LAMP reaction kit, wherein the target gene and the reagents in the above-mentioned LAMP reaction kit are mixed, LAMP amplification is performed, and the emitted fluorescence is measured.

[0017] Beneficial effects:

[0018] This invention provides a LAMP assimilation probe targeting endogenous sequences. The LAMP assimilation probe of this invention can stably exist in a 65°C reaction system without a template. With a template, a quenching probe is displaced from the assimilation probe, increasing the fluorescence signal of the system. The free quenching probe in the system can act as a primer for extension on the reaction product, and the displaced quenching probe can also act as a primer for extension on the reaction product, accelerating the reaction rate and improving sensitivity. The concentration of the quenching probe in this invention has no significant effect on the sensitivity of the assimilation probe. The standalone fluorescent probe can also generate additional fluorescence signals during subsequent extension processes, so the standalone fluorescent probe can be used as a novel probe.

[0019] Based on the LAMP assimilation probe and LAMP reaction kit of this invention, the real-time LAMP method is used to detect target analytes, which improves the reaction rate, accuracy and fluorescence signal intensity of the system, reduces the false negative rate, and has the advantages of being simple, fast, sensitive, specific and accurate. Attached Figure Description

[0020] Figure 1 This is a basic schematic diagram of LAMP detection.

[0021] Figure 2 The diagram shows the structure of the novel assimilation probe of the present invention, wherein (A) represents the structure of the assimilation probe of the present invention; (B) represents the schematic diagram of the assimilation probe of the present invention; (C) represents the structure of a conventional assimilation probe; M represents the sequence of the quenching probe; and Mc represents the reverse complementary sequence of the M sequence.

[0022] Figure 3This is a schematic diagram of the core principle of real-time fluorescent LAMP detection of target genes based on the assimilation probe of this invention.

[0023] Figure 4 The diagram shows the structure of the six probe models of the present invention; (A), (B), and (C) correspond to the assimilation probes of Examples 1-3, respectively; (D) is the conventional probe of Comparative Example 1; and (E) and (F) are the assimilation probes of Comparative Example 1 and Comparative Example 2, respectively. Red dots represent fluorescent groups, and blue dots represent quenching groups.

[0024] Figure 5 The graph shows the amplification efficiency screening results of the six probe models of the present invention. The colored curves marked ABCDEF represent the amplification curves of the six probe models, and the green curve represents the amplification curve of the corresponding blank control ddH2O.

[0025] Figure 6 The graph shows the screening results of the amplification efficiency of three assimilation probes in Examples 1 and 2 and Comparative Example 1 of this invention. The colored curves marked with ABD represent the amplification curves of Bordetella pertussis with 1000, 10000 and 100000 copies / mL of the three probe models, respectively. The green curves are the amplification curves of Bordetella pertussis with 100 copies / mL and the blank control ddH2O.

[0026] Figure 7 The diagram shows the structural schematics of the two probe models in Experiment Example 3 of this invention, as well as the amplification efficiency screening results of qPCR and LAMP. In this diagram, (A) represents the FP1 / QP1 probe model, (a) represents the FP1 probe model, and the red, yellow, pink, and blue curves represent probe systems with templates of 500,000, 50,000, 5,000, and 500 copies / mL of Bordetella pertussis DNA, respectively. The green curve is the amplification curve of the blank control ddH2O.

[0027] Figure 8 The graph shows the results of different concentration ratios of assimilation probes FP1 / QP1 in Experiment Example 4 of this invention. The final concentration of FP1 was 0.08 μM. The 0 μL, 0.2 μL, 0.4 μL, 0.8 μL, and 1.4 μL marked in the graph represent the final concentrations of QP1 of 0 μM, 0.08 μM, 0.16 μM, 0.32 μM, and 0.56 μM, respectively. The templates for the five probe systems were all 10,000 and 2,000 copies / mL of Bordetella pertussis DNA. The green curve is the amplification curve of the blank control ddH2O.

[0028] Figure 9 The results of the sensitivity study of the assimilation probe LAMP system in Experimental Example 5 of this invention. Figure 1Figure A shows the qPCR detection results of nucleic acid from Bordetella pertussis samples at 7 concentrations (2500-160000 copies / mL). Figure B is a comparison of 4 replicate results of 7 concentration gradients (2500-160000 copies / mL) of the assimilation probe system (blue) of Example 1 and the conventional probe (red) of Comparative Example 1. Green represents the amplification curve of the blank control ddH2O.

[0029] Figure 10 The results of the sensitivity study of the assimilation probe LAMP system in Experimental Example 5 of this invention. Figure 2 Figure A shows the qPCR detection results of 7 concentrations of Bordetella pertussis sample nucleic acid (500-32000 copies / mL). Figure B is a comparison of 4 replicate results of 7 concentration gradients (500-32000 copies / mL) of the assimilation probe system (blue) of Example 1 and the conventional probe (red) of Comparative Example 1. Green represents the amplification curve of blank control ddH2O.

[0030] Figure 11 This is a specificity detection curve for real-time fluorescent LAMP detection of Bordetella pertussis based on assimilation probes in Experiment Example 6 of the present invention. The blue curve represents the amplification results of nucleic acid from 10 clinical Bordetella pertussis samples; the green curve represents the amplification curves of nucleic acid from 11 respiratory pathogen samples (influenza A / B, rhinovirus, adenovirus, respiratory syncytial virus, novel coronavirus, human bocavirus, Mycoplasma pneumoniae, Chlamydia pneumoniae, human metapneumovirus, Legionella pneumophila) and the blank control ddH2O. Detailed Implementation

[0031] This invention optimizes the structure of traditional assimilation probes, providing a novel LAMP assimilation probe. The assimilation probe comprises a quenching probe and a fluorescent probe. The quenching probe is an endogenous sequence between the target gene F1 and the B1c gene, or between the F1c and B1 genes, and its 5' end is labeled with a quenching group. The fluorescent probe comprises a first oligonucleotide chain and a second oligonucleotide chain, the first oligonucleotide chain being complementary to the sequence of the quenching probe, the second oligonucleotide chain being a LAMP loop primer sequence, and the fluorescent group of the fluorescent probe being labeled between the first and second oligonucleotide chains.

[0032] The quenching probe described in this invention is an endogenous sequence between the target gene F1 and the B1c gene, or between the F1c gene and the B1 gene, with a quenching group labeled at its 5' end. The sequence orientation from the 5' to the 3' end of the quenching probe is consistent with the sequence orientation of the LAMP outer primer F3 and the loop primer LB. As one embodiment, a 20-30 bp base sequence between the aforementioned gene sequences is selected for the design of the quenching probe, ensuring that the Tm range of the DNA double strand formed by the 5' end of the quenching probe and the 5' end of the fluorescent probe is 70-85°C. As one embodiment, quenching groups are labeled at both the 5' and 3' ends of the quenching probe. This invention does not particularly limit the type of quenching group; any quenching group corresponding to the fluorescent probe in the art can be used, such as quenching groups from the BHQ-1, BHQ-3, Dabcyl, TAMRA, QSY, and MGB series.

[0033] The fluorescent probe of this invention comprises a first oligonucleotide chain and a second oligonucleotide chain. The first oligonucleotide chain is complementary to the sequence of the quenching probe. In one embodiment, the 3' end sequence of the quenching probe has 0-9 more nucleotide bases than the 5' end sequence of the first oligonucleotide chain of the fluorescent probe. The second oligonucleotide chain is a loop primer sequence for LAMP. The fluorescent group of the fluorescent probe is labeled between the first and second oligonucleotide chains. In one embodiment, the fluorescent group is labeled on the oligonucleotide between the first and second oligonucleotide chains, or on the DNA backbone between the first and second oligonucleotide chains. In one embodiment, any one or more of adenine (A), guanine (G), thymine (T), and cytosine (C) are selected as the fluorescently labeled oligonucleotide, and thymine (T) is further selected as the fluorescently labeled oligonucleotide. This invention does not particularly limit the type of fluorescent group, and options include, but are not limited to, FAM, Cy5, TET, HEX, and Rox. As one implementation method, a fluorescent probe labeled with FAM is selected, with an excitation wavelength of 494 nm and an emission wavelength of 518 nm. The fluorescent group is quenched by the quenching group BHQ-1. Alternatively, a fluorescent probe labeled with Cy5 is selected, with the quenching group BHQ-3 selected.

[0034] The 5' end of the fluorescent probe of this invention pairs in reverse complementary directions with the 5' end of the quencher probe to form a DNA double strand, with a Tm range of 70–85°C, preferably 75–80°C. The LAMP assimilation probe of this invention is stable in a 65°C reaction system without a template. With a template, the quencher probe is displaced, increasing the fluorescence value of the system. The displaced quencher probe can also be used as a primer for extension on the reaction product, increasing the reaction rate; the fluorescent probe alone will also generate additional fluorescence signals during subsequent extension.

[0035] In one embodiment, the concentration ratio of the quenching probe to the fluorescent probe in this invention is 0 to 7:1. Optionally, a single 0.08 μM fluorescent probe can be used, or the concentration ratio of the quenching probe to the fluorescent probe can be any ratio among 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, and 7:1. Experimental verification shows that the concentration of the quenching probe has no significant effect on the sensitivity of the novel assimilation probe FP1 / QP1, and a single fluorescent probe can also be used as a novel probe.

[0036] The LAMP assimilation probes described above in this invention can be applied to LAMP reaction kits for detecting any target analyte. These kits include LAMP primers for amplifying the target gene and the LAMP assimilation probes described above in this invention. Those skilled in the art can design corresponding target gene assimilation probes based on conventional LAMP primer design principles.

[0037] As one implementation method, when detecting Bordetella pertussis, LAMP primers are designed targeting specific conserved regions of the Bordetella pertussis IS481 gene. Each LAMP primer targets 6-8 different regions. The LAMP primers include a pair of F3 / B3 outer primers, a pair of FIP / BIP inner primers, and a pair of LF / LB loop primers. As one implementation method, the nucleotide sequence of the F3 primer is shown in SEQ ID NO.1, the nucleotide sequence of the B3 primer is shown in SEQ ID NO.2, the nucleotide sequence of the FIP primer is shown in SEQ ID NO.3, the nucleotide sequence of the BIP primer is shown in SEQ ID NO.4, the nucleotide sequence of the LF primer is shown in SEQ ID NO.5, and the nucleotide sequence of the LB primer is shown in SEQ ID NO.6. As a preferred implementation method, the micromolar concentration ratio of the F3 primer, B3 primer, FIP primer, BIP primer, LF primer, and LB primer is 0.2:0.2:1.6:1.6:0.8:0.8.

[0038] LAMP assimilation probes were designed based on the above LAMP primers. In this embodiment of the invention, three different assimilation probe models were designed to detect the Bordetella pertussis IS481 gene, as follows:

[0039] Assimilation probe (A): FP1 / QP1, whose nucleotide sequences are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively;

[0040] Assimilation probe (B): FP1 / QP2, whose nucleotide sequences are shown in SEQ ID NO.7 and SEQ ID NO.9, respectively;

[0041] Assimilation probe (C): FP1 / QP3, whose nucleotide sequences are shown in SEQ ID NO.7 and SEQ ID NO.10, respectively;

[0042] Three contrast probes were designed, as follows:

[0043] The conventional assimilation probe (D) is FP2 / QP4, whose nucleotide sequences are shown in SEQ ID NO.11 and SEQ ID NO.12, respectively.

[0044] Assimilation probe (E): FP3 / QP5, whose nucleotide sequences are shown in SEQ ID NO.13 and SEQ ID NO.14, respectively;

[0045] Assimilation probe (F): FP3 / QP6, whose nucleotide sequences are shown in SEQ ID NO.13 and SEQ ID NO.15, respectively.

[0046] Traditional assimilation probes only produce a fluorescent signal when the quenching probe is displaced from the assimilation probe, that is, at the moment the fluorescent probe and the quenching probe separate. However, the quenching probe will remain in the LAMP system and cannot continue to extend on the template or intermediate product.

[0047] The assimilation probe of the present invention generates a fluorescent signal when the quenching probe is displaced from the assimilation probe; and the free or displaced quenching probe in the system can also act as a primer to continue template (on the intermediate product) extension, further accelerating the reaction rate; at the same time, the individual fluorescent probe can also release additional fluorescent signals during the subsequent extension process.

[0048] Experiments show that the novel assimilation probe of this invention has higher amplification efficiency, higher sensitivity, and stronger fluorescence signal compared with traditional assimilation probes.

[0049] In one embodiment, the LAMP reaction kit of the present invention further includes DNA polymerase, and further includes Bst DNA polymerase, reaction buffer, dNTP mix, MgCl2, and double-distilled water. In one embodiment, the final concentration of the Bst DNA polymerase is 0.15-0.55 U / μL, the reaction buffer is 1×, the final concentration of the dNTP mix is ​​0.8-1.6 mM, and the final concentration of MgCl2 is 4.5-7.5 mM. More specifically, the final concentration of the Bst DNA polymerase is 0.32 U / μL, the reaction buffer is 1×, the final concentration of the dNTP mix is ​​1.2 mM, and the final concentration of MgCl2 is 6 mM. The initial concentrations of each component in the LAMP reaction kit are reasonably set according to the final concentration range; for example, the initial concentration of the Bst DNA polymerase is set to 4-15 U / μL, the reaction buffer to 10×, the initial concentration of the dNTP mix to 16-32 mM, and the initial concentration of MgCl2 to 70-130 mM.

[0050] The present invention also provides a method for loop-mediated isothermal amplification based on the above-mentioned LAMP assimilation probe or the above-mentioned LAMP reaction kit, wherein the target gene and the reagents in the above-mentioned LAMP reaction kit are mixed, LAMP amplification is performed, and the emitted fluorescence is measured.

[0051] As one implementation method, the 25 μL LAMP reaction system consists of: 1 μL of 8 U / μL Bst 3.0 DNA polymerase, 2.5 μL of 10X reaction buffer, 1.5 μL of 100 mM MgCl2, 1.2 μL of 25 mM dNTP mix, 5 μL of DNA template, 0.5 μL each of 10 μM M3 and 10 μM B3 primers, 0.4 μL each of 100 μM FIP and 100 μM BIP primers, 0.2 μL each of 100 μM MLF and 100 μM LB primers, 0.25 μL of 10 μM fluorescent probe, 0.4 μL of 10 μM quenching probe, and 5 μL of double-distilled water.

[0052] As one implementation method, the LAMP reaction temperature is 60-65℃, preferably 60℃, 61℃, 62℃, 63℃, 64℃, or 65℃, with the appropriate LAMP reaction temperature selected based on primer design and target sequence characteristics. As another implementation method, the LAMP reaction time is 20-50 min, more preferably 25-40 min, and even more preferably 30-35 min. Too short a reaction time will lead to incomplete amplification, while too long a reaction time will increase the risk of non-specific amplification. The LAMP reaction time is determined based on the target gene fragment length and the optimization of the reaction system. As another implementation method, fluorescence values ​​are collected every 0.5-2 min, preferably every 1 min.

[0053] The following examples use LAMP detection of Bordetella pertussis as an example to illustrate the technical solution of the present invention in detail. The following descriptions are merely a few embodiments of the present invention and are not intended to limit the invention in any way. Although the present invention is disclosed below with preferred embodiments, it is not intended to limit the invention. Any modifications or variations made by those skilled in the art without departing from the scope of the present invention, based on the disclosed technical content, are equivalent to equivalent implementations and fall within the scope of the technical solution.

[0054] Unless otherwise specified, the raw materials used in the embodiments of this application are all purchased commercially and used directly without any special treatment.

[0055] Unless otherwise specified, the analytical methods in the embodiments all adopt conventional instrument or equipment settings and conventional analytical methods.

[0056] Example 1

[0057] LAMP assimilation probe (A) was used to detect Bordetella pertussis.

[0058] 1. LAMP primer design:

[0059] (1) Based on the basic principles of LAMP ( Figure 1 The IS481 gene specific to Bordetella pertussis (GenBank, CP118366.1:1676771-1678462) was selected as the target gene for amplification, and the accuracy of the gene sequence was determined.

[0060] (2) Based on the target gene sequence determined in step (1), use the LAMP primer explorer online webpage (http: / / primer explorer.jp / lampv5e / index.html) to design specific LAMP primer sets for the specific conserved region of the Bordetella pertussis IS481 gene. These primers target 6 to 8 different regions. Each primer set includes a pair of F3 / B3 outer primers, a pair of FIP / BIP inner primers, and a pair of LF / LB loop primers.

[0061] The LAMP primer set for the Bordetella pertussis IS481 gene designed in this invention has the following nucleotide sequences:

[0062] F3: CCAGGATTTCATGGCATCGG (SEQ ID NO.1);

[0063] B3: CATCCAGCGCTTGCTCAC (SEQ ID NO.2);

[0064] FIP: TTCATCCAGTCGGCCTTGC-GCTCGGTGTTGGGAGTTCTG (SEQ ID NO.3);

[0065] BIP: TAAGGTCGGGTAAAGCGGTGCT-ACAATGGCTCGGCCTTTC (SEQ ID NO.4);

[0066] LF: GGGCTTACGCTCACACCTAC (SEQ ID NO.5);

[0067] LB: GATGCCCAGCTCATGGCACAG (SEQ ID NO. 6).

[0068] The assimilation probe (A) includes the fluorescent probe FP1 and the quencher probe QP1, whose nucleotide sequences are shown below:

[0069] FP1 is shown in SEQ ID NO.7:

[0070] ;

[0071] QP1 is shown in SEQ ID NO.8:

[0072] .

[0073] 2. Construction of the Real-time LAMP (qLAMP) system:

[0074] The primer concentration ratio, dNTP concentration, and Mg concentration in the reaction system were respectively analyzed. 2+ The concentration and reaction temperature were optimized by single-factor variation, while other conditions remained constant, and the Real-time LAMP reaction system (25 μL) and reaction conditions were finally determined.

[0075] Real-time LAMP reactions were performed according to the optimized reaction system in Table 1. The reaction conditions were set as follows: 65℃ for 30 min; fluorescence was collected once every 1 min, for 30 cycles. The detection results of Bordetella pertussis were determined by the Ct value and the fluorescence value of the amplified product.

[0076] Table 1 Real-time LAMP reaction system

[0077]

[0078] Example 2

[0079] LAMP assimilation probe (B) was used to detect Bordetella pertussis.

[0080] Except for the different LAMP assimilation probe sequence, the LAMP primers, reaction system and reaction conditions are the same as in Example 1.

[0081] LAMP assimilation probe (B) includes fluorescent probe FP1 and quencher probe QP2, whose nucleotide sequences are shown below:

[0082] FP1 is shown in SEQ ID NO.7:

[0083] ;

[0084] QP2 is shown in SEQ ID NO.9:

[0085] .

[0086] Example 3

[0087] LAMP assimilation probe (C) for detecting Bordetella pertussis.

[0088] Except for the different LAMP assimilation probe sequence, the LAMP primers, reaction system and reaction conditions are the same as in Example 1.

[0089] The LAMP assimilation probe (C) consists of the fluorescent probe FP1 and the quencher probe QP3, whose nucleotide sequences are shown below:

[0090] FP1 is shown in SEQ ID NO.7:

[0091] ;

[0092] QP3 is shown in SEQ ID NO.10:

[0093] .

[0094] Comparative Example 1

[0095] Traditional assimilation probe (D) for detecting Bordetella pertussis.

[0096] Except for the different assimilation probe sequences, the LAMP primers, reaction system and reaction conditions are the same as in Example 1.

[0097] Traditional assimilation probes (D) include the fluorescent probe FP2 and the quencher probe QP4, whose nucleotide sequences are shown below:

[0098] FP2 is shown in SEQ ID NO.11:

[0099] ;

[0100] QP4 is shown in SEQ ID NO.12:

[0101] .

[0102] Comparative Example 2

[0103] LAMP assimilation probe (E) for detecting Bordetella pertussis.

[0104] Except for the different LAMP assimilation probe sequence, the LAMP primers, reaction system and reaction conditions are the same as in Example 1.

[0105] The LAMP assimilation probe (E) includes the fluorescent probe FP3 and the quencher probe QP5, whose nucleotide sequences are shown below:

[0106] FP3 is shown in SEQ ID NO.13:

[0107] ;

[0108] QP5 is shown in SEQ ID NO.14:

[0109] .

[0110] Comparative Example 3

[0111] LAMP assimilation probe (F) was used to detect Bordetella pertussis.

[0112] Except for the different LAMP assimilation probe sequence, the LAMP primers, reaction system and reaction conditions are the same as in Example 1.

[0113] The LAMP assimilation probe (F) includes the fluorescent probe FP3 and the quencher probe QP6, whose nucleotide sequences are shown below:

[0114] FP3 is shown in SEQ ID NO.13:

[0115] ;

[0116] QP6 is shown in SEQ ID NO.15:

[0117] .

[0118] Experimental Example 1

[0119] The amplification efficiencies of the real-time fluorescence LAMP systems of the six assimilation probe models in Examples 1-3 and Comparative Examples 1-3 were compared, and the results are as follows: Figure 5As shown, the amplification efficiencies of the six assimilation probe models in the real-time fluorescence LAMP system varied significantly. The probe model with the best amplification efficiency was FP1 / QP1, while the probe model with the worst efficiency was FP3 / QP5. Compared with the traditional assimilation probe model FP2 / QP4, the probe model FP1 / QP1 of this invention has superior amplification efficiency.

[0120] Experimental Example 2

[0121] Comparison of amplification efficiency of the assimilation probe real-time fluorescent LAMP systems in Examples 1, 2 and Comparative Example 1.

[0122] Bordetella pertussis DNA at concentrations of 100,000, 10,000, 1,000, and 100 copies / mL was used as templates, with two replicates for each. The Bordetella pertussis IS481 gene was detected using the three assimilation probes from Examples 1, 2, and Comparative Example 1, thereby screening out the assimilation probe model with the highest amplification efficiency.

[0123] Based on the real-time fluorescent LAMP primer system established in Example 1, the amplification efficiency of the real-time fluorescent LAMP systems with three assimilation probes was compared. The experimental results are as follows: Figure 6 As shown, the positive rates of the real-time fluorescence LAMP systems for the three assimilation probe models were consistent: positive at concentrations of 1000, 10000, and 100000 copies / mL, and negative at 100 copies / mL. Considering the differences in Ct values ​​ΔCt (0.00–2.45) and fluorescence intensity differences in amplification curves ΔFn (57.22–642.43), the best probe model is preliminarily considered to be FP1 / QP1.

[0124] Table 2 Comparison of amplification efficiencies of the LAMP system using the assimilation probes of this invention

[0125]

[0126] Experimental Example 3

[0127] The effect of the concentration of quenching probe QP1 on the amplification efficiency of real-time fluorescent LAMP system.

[0128] To preliminarily evaluate the effect of the concentration of the quenching probe QP1 on the assimilation probe FP1 / QP1 in Example 1, two assimilation probes were used to detect the Bordetella pertussis IS481 gene: qLAMP was performed under two system conditions: the concentration of fluorescent probe FP1 was 0.08 μM, and the concentrations of quenching probe QP1 were 0 μM (a) and 0.16 μM (a), respectively; Bordetella pertussis DNA at concentrations of 500,000, 50,000, 5,000, and 500 copies / mL were used as templates, with two replicates for each. All other conditions were the same as in Example 1.

[0129] Four concentration gradients (500,000, 50,000, 5,000 and 500 copies / mL) of Bordetella pertussis DNA and a blank control ddH2O were used as templates to perform parallel experiments using the Bordetella pertussis nucleic acid detection kit (PCR-fluorescent probe method) (National Medical Device Registration Certificate 20203400152) from Shenzhen Yilifang Biotechnology Co., Ltd.

[0130] Based on the real-time fluorescence LAMP primer system established in Example 1, the amplification efficiency of the real-time fluorescence LAMP systems with two assimilation probes was compared. The results are as follows: Figure 7 As shown, when the template concentration is in the range of 500-500000 copies / mL, the concentration of the quenching probe QP1 has no significant effect on the sensitivity of the assimilation probe FP1 / QP1 of this invention, and a single fluorescent probe FP1 can be used as a novel probe.

[0131] Test Example 4

[0132] The optimal concentration ratio of FP1 and QP1 for the assimilation probe of this invention was studied.

[0133] Experimental Example 3 demonstrated that the concentration of the quenching probe QP1 had no significant effect on the sensitivity of the assimilation probe of this invention, but the concentration of QP1 still had some influence on the shape of the amplification curve. To investigate the optimal concentration ratio of FP1 and QP1 for the assimilation probe of this invention, five FP1 and QP1 concentration ratios were designed: a final FP1 concentration of 0.08 μM and final QP1 concentration gradients of 0 μM, 0.08 μM, 0.16 μM, 0.32 μM, and 0.56 μM. The Bordetella pertussis IS481 gene was detected using these five probe systems; Bordetella pertussis DNA at concentrations of 10000 and 2000 copies / mL was used as templates.

[0134] Based on the real-time fluorescent LAMP primer system established in Example 1, the real-time fluorescent LAMP systems with five different FP1 / QP1 ratio assimilation probes were validated, and the results are as follows: Figure 8 As shown, the optimal concentration ratio of FP1:QP1 in the novel assimilation probe is 0.08 μM:0.56 μM.

[0135] Experimental Example 5

[0136] This invention relates to a study on the repeatability and sensitivity of the assimilation probe LAMP system.

[0137] 1. To study the repeatability and sensitivity of the LAMP system of the assimilation probe FP1 / QP1 in Example 1 of this invention, seven concentrations of Bordetella pertussis sample nucleic acid (160,000, 80,000, 40,000, 20,000, 10,000, 5,000 and 2,500 copies / mL) were used as templates for qLAMP, with four replicates. A comparative conventional assimilation probe FP2 / QP4 system was used as a control. Parallel qPCR experiments were performed using the Bordetella pertussis nucleic acid detection kit (PCR-fluorescent probe method) (National Medical Device Registration Certificate 20203400152) from Shenzhen Yilifang Biotechnology Co., Ltd.

[0138] Based on the real-time fluorescence LAMP primer system established in Example 1, the real-time fluorescence LAMP systems of the assimilation probe FP1 / QP1 in Example 1 and the conventional assimilation probe FP2 / QP4 in Comparative Example 1 were tested.

[0139] The results are shown in Table 3 and Figure 9 As shown: For four replicates within seven concentration gradients (2500-160000 copies / mL), the positive rates of the two probe systems were consistent (28 / 28, 100%). This indicates that at the 2500 copies / mL level, there is no significant difference in sensitivity between the assimilation probe of this invention and the conventional assimilation probe in the qLAMP system. However, the qLAMP system of this invention has a smaller Ct value and a higher fluorescence threshold in the amplification curve. This suggests that the sensitivity of the assimilation probe FP1 / QP1 of this invention is superior to that of the conventional assimilation probe FP2 / QP4.

[0140] Table 3. Comparison of repeatability and sensitivity data of the LAMP system using the assimilation probe of this invention.

[0141]

[0142] 2. Change the concentration of the Bordetella pertussis sample nucleic acid to 32000, 16000, 8000, 4000, 2000, 1000 and 500 copies / mL as templates for qLAMP, and repeat the experimental procedure in step 1 above.

[0143] The results are shown in Table 4 and Figure 10As shown: For four replicates within six high concentration gradients (1000-32000 copies / mL), the positive rates of the two probe systems were consistent (24 / 24, 100%). However, in the four replicates at 500 copies / mL, the positive rate of the assimilation probe qLAMP system of Example 1 of this invention (4 / 4, 100%) was higher than that of the conventional probe qLAMP system of the comparative example (3 / 4, 75%). Furthermore, the Ct value of the probe system of this invention was smaller, and the fluorescence threshold of the amplification curve was higher. This indicates that the sensitivity and repeatability of the assimilation probe FP1 / QP1 of this invention are superior to those of the conventional assimilation probe FP2 / QP4 of Comparative Example 1.

[0144] Table 4. Comparison of repeatability and sensitivity data of the LAMP system using the assimilation probe of this invention.

[0145]

[0146] Experimental Example 6

[0147] The specificity of the assimilation probe LAMP system of this invention.

[0148] To investigate the specificity of the assimilation probe LAMP system of this invention, 10 Bordetella pertussis samples, 11 respiratory pathogen samples, and a blank control (water) were used as templates for the qLAMP system. The respiratory pathogen samples included influenza A / B, rhinovirus, adenovirus, respiratory syncytial virus, novel coronavirus, human bocavirus, Mycoplasma pneumoniae, Chlamydia pneumoniae, human metapneumovirus, and Legionella pneumophila.

[0149] Based on the real-time fluorescent LAMP primer system established in Example 1, the specificity of the real-time fluorescent LAMP system based on the assimilation probe of Example 1 was tested. The results are as follows: Figure 11 The positive rate of 10 Bordetella pertussis samples (blue curve) was 100%; no amplification curves were found in 11 respiratory pathogen samples and ddH2O (green curve), indicating that the assimilation probe of the present invention has good specificity.

[0150] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A LAMP primer and assimilation probe for detecting pertussis, characterized in that, The LAMP primers include F3 primer, B3 primer, FIP primer, BIP primer, LF primer, and LB primer; the nucleotide sequence of the F3 primer is shown in SEQ ID NO.1, the nucleotide sequence of the B3 primer is shown in SEQ ID NO.2, the nucleotide sequence of the FIP primer is shown in SEQ ID NO.3, the nucleotide sequence of the BIP primer is shown in SEQ ID NO.4, the nucleotide sequence of the LF primer is shown in SEQ ID NO.5, and the nucleotide sequence of the LB primer is shown in SEQ ID NO.

6. The LAMP assimilation probe includes a fluorescent probe and a quenching probe; the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.7, and the nucleotide sequence of the quenching probe is shown in SEQ ID NO.

8.

2. The LAMP primers and assimilation probes according to claim 1, characterized in that, The Tm range for the formation of a DNA double strand by the quenching probe and the fluorescent probe is 70–85 °C.

3. The LAMP primers and assimilation probes according to claim 1, characterized in that, The micromolar concentration ratio of the F3 primer, B3 primer, FIP primer, BIP primer, LF primer and LB primer is 0.2:0.2:1.6:1.6:0.8:0.

8.

4. A LAMP reaction kit for detecting pertussis, characterized in that, The kit includes the LAMP primers and assimilation probes as described in any one of claims 1 to 3.

5. The LAMP reaction kit according to claim 4, characterized in that, In the LAMP reaction kit, the final concentrations of the F3 primer, B3 primer, FIP primer, BIP primer, LF primer, and LB primer are 0.2 μM, 0.2 μM, 1.6 μM, 1.6 μM, 0.8 μM, and 0.8 μM, respectively.

6. The LAMP reaction kit according to claim 4, characterized in that, The final concentration of the fluorescent probe is 0.08 μM, and the final concentration of the quenching probe is 0.56 μM.

7. The LAMP reaction kit according to any one of claims 4 to 6, characterized in that, It also includes DNA polymerase.

8. The LAMP reaction kit according to any one of claims 4 to 6, characterized in that, It also includes any one or more of Bst DNA polymerase, reaction buffer, dNTP mix, MgCl2, and double-distilled water.

9. The LAMP reaction kit according to claim 8, characterized in that, The initial concentration of the Bst DNA polymerase was 4-15 U / μL, the reaction buffer was 10×, the initial concentration of the dNTP mix was 16-32 mM, and the initial concentration of MgCl2 was 70-130 mM.

10. The LAMP reaction kit according to claim 8, characterized in that, The final concentration of the Bst DNA polymerase is 0.15-0.55 U / μL, the reaction buffer is 1×, the final concentration of the dNTP mix is ​​0.8-1.6 mM, and the final concentration of MgCl2 is 4.5-7.5 mM.

11. A loop-mediated isothermal amplification method for non-disease diagnostic purposes based on the LAMP primers and assimilation probes according to any one of claims 1 to 3 or the LAMP reaction kit according to any one of claims 4 to 10, characterized in that, The pertussis gene and the reagents in the LAMP reaction kit according to any one of claims 4 to 9 are mixed to perform a LAMP amplification reaction, and the emitted fluorescence is measured.

12. The amplification method according to claim 11, characterized in that, The LAMP amplification reaction consisted of a 25 μL LAMP reaction system, specifically: 1 μL of 8 U / μL Bst 3.0 DNA polymerase, 2.5 μL of 10× reaction buffer, 1.5 μL of 100 mM MgCl2, 1.2 μL of 25 mM dNTP mix, 5 μL of DNA template, 0.5 μL each of 10 μM F3 and 10 μM B3 primers, 0.4 μL each of 100 μM FIP and 100 μM BIP primers, 0.2 μL each of 100 μM LF and 100 μM LB primers, 0.25 μL of 10 μM fluorescent probe, 0.4 μL of 10 μM quenching probe, and 5 μL of double-distilled water.

13. The amplification method according to claim 11, characterized in that, The LAMP amplification reaction was performed at a temperature of 60-65°C for 20-50 minutes.

14. The amplification method according to claim 11, characterized in that, Fluorescence values ​​are collected every 0.5 to 2 minutes.