Application of SNP molecular marker related to total number of piglets born trait

By detecting the SNP molecular marker at locus 33289690 on chromosome 9 in the pig genome, the problems of long cycle and high cost of traditional pig total litter size selection methods have been solved, enabling early and accurate detection and breeding of the total litter size trait in pigs, and improving breeding efficiency.

CN120624679BActive Publication Date: 2026-02-24HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510902916.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2026-02-24
Estimated Expiration
2045-07-01

AI Technical Summary

Technical Problem

Traditional phenotype-based methods for selecting pigs based on total litter size are time-consuming, costly, difficult to screen in the early stages, and highly susceptible to environmental factors, making it difficult to achieve efficient breeding.

Method used

Using the SNP molecular marker at locus 33289690 on chromosome 9 of the pig genome Sscrofa11.1.109, PCR primers were designed to perform genotyping by detecting C/T polymorphism, and individuals with favorable alleles were screened for early selection.

Benefits of technology

It enables early and accurate detection and breeding of total litter size in pigs, improving breeding efficiency and increasing the reproductive benefits of pigs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624679B_ABST
    Figure CN120624679B_ABST
Patent Text Reader

Abstract

The application belongs to the field of pig molecular marker assisted selection, and particularly relates to application of a SNP molecular marker related to pig total litter size. The SNP molecular marker is at the base of the 33289690th site of the 9th chromosome in pig genome Sscrofa11.1.109, the SNP site of the molecular marker has C / T polymorphism, and T is a favorable allelic variation of the pig total litter size. The superior allele of the SNP can increase the frequency of the superior allele generation by generation, increase the total litter size of pigs, accelerate the genetic improvement of pigs, and thus effectively improve the reproductive production efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of marker-assisted selection technology for pigs, and in particular to the application of a SNP molecular marker related to the total litter size trait in pigs. Background Technology

[0002] Total Number of Pigs Born (TNB) is one of the most critical reproductive traits in modern pig farming. With global population growth and the continued rise in meat consumption demand, improving pig reproductive efficiency has become an important strategic goal for ensuring the sustainable development of animal husbandry. Statistics show that for every 1 pig increase in TNB, unit breeding costs can be significantly reduced, feed and land resource consumption can be decreased, and the economic benefits of farms can be improved.

[0003] Genetic studies have shown that TNB has moderate to high heritability (approximately 0.3-0.5), indicating that this trait can be effectively improved through genetic modification. While traditional phenotype-based breeding is effective, it has significant limitations. Phenotypic data on sow reproductive traits can only be obtained after they reach sexual maturity (usually 12-18 months of age), resulting in excessively long generation intervals and low breeding efficiency. Furthermore, TNB is significantly affected by environmental factors (such as feeding management and stress), making it difficult to fully distinguish genetic potential based solely on phenotypic data. Therefore, traditional breeding methods, relying on phenotypic selection, face bottlenecks such as long cycles, high costs, and difficulties in early screening, necessitating more precise molecular marker technologies to accelerate the breeding process.

[0004] The rapid development of genomics technology in recent years has made it possible to explore the core genes and molecular mechanisms regulating total litter size. Molecular marker-assisted breeding utilizes the close linkage between molecular markers and target trait genes. By detecting molecular markers, the presence of the target gene can be detected, achieving the goal of selecting for the target trait. It has the advantages of being rapid, accurate, and unaffected by environmental conditions. Single nucleotide polymorphisms (SNPs) are a type of molecular marker, referring to changes in DNA sequence caused by variations in a single nucleotide at the same location in the genome between individuals. These changes can subsequently affect gene expression, transcriptional activity, and splicing modifications. Screening for genes and SNPs related to the total litter size trait in pigs, combined with marker-assisted breeding methods, provides an efficient tool for early selection of pigs and rapid screening of highly fertile sows. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker associated with total litter size in pigs, providing guidance for detecting total litter size performance in pigs or for marker-assisted breeding.

[0006] The technical solution of the present invention is as follows:

[0007] This invention provides a porcine SNP molecular marker located at the base position 33289690 on chromosome 9 in the porcine genome Sscrofa11.1.109. The SNP site of this molecular marker exhibits C / T polymorphism, where T is a favorable allele variation for increasing the total number of piglets born.

[0008] The porcine SNP molecular marker and the substance for detecting the porcine SNP molecular marker may be used in any of the following ways:

[0009] Used for detecting or assisting in the detection of the total number of piglets born;

[0010] Genetic breeding used to improve the total number of piglets born;

[0011] Preferably, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1.

[0012] In this invention, the substance for detecting porcine SNP molecular markers includes PCR primers for amplifying genomic DNA fragments, including the SNP sites, or a kit containing the primers.

[0013] Preferably, the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] Preferably, the kit also includes PCR amplification reagents.

[0015] The present invention also provides a method for detecting the total litter size trait in pigs, comprising: detecting the base type at position 33289690 on chromosome 9 of the pig genome, and finding that the total litter size of TC and CC genotype populations is less than that of the TT genotype population.

[0016] Preferably, the method for detecting the base type at position 33289690 on chromosome 9 of the pig genome includes: designing primers to amplify the nucleotide sequence shown in SEQ ID NO.1, using the primers to perform PCR amplification on pig genomic DNA, and detecting the genotype at position 500 in the gene sequence of the amplified product.

[0017] Further optimization was performed using Sanger sequencing to obtain the genotype at the 9:33289690C>T locus.

[0018] This invention also provides a genetic breeding method for increasing the total number of piglets born, comprising: determining the base type at locus 33289690 on chromosome 9 of breeding pigs in the core pig population, and making corresponding selections based on the base type:

[0019] In the breeding of pigs, individuals with the TT and TC bases at the 33289690 locus on chromosome 9 are selected, while CC-type individuals are eliminated, in order to increase the frequency of the T gene at this locus in each generation, thereby increasing the total number of piglets born in the offspring.

[0020] Preferably, the base at position 33289690 of the pig chromosome 9 is shown as the 500th bp of the sequence shown in SEQ ID NO.1.

[0021] The beneficial effects of this invention are:

[0022] This invention studies and identifies SNP molecular markers that affect the total number of piglets born. Using these molecular markers for early marker-assisted selection can accelerate the process of pig breed selection.

[0023] This invention predicts the total litter size trait in pigs by detecting the base types at the SNP sites of the molecular markers. The TC and TT genotype populations have a higher total litter size than the CC genotype population. By applying primer sets to amplify the molecular markers affecting the total litter size trait, an efficient and accurate marker-assisted breeding technology for pigs is established. Applying this technology to pig breeding allows for the selection of piglets with superior total litter size traits and the timely culling of inferior piglets, thereby increasing the number of piglets born and improving the reproductive efficiency of pig farms. Attached Figure Description

[0024] Figure 1 Manhattan plot (left) and QQ plot (right) of GWAS (Gross Scale for the Total Number of Pigs Born).

[0025] Figure 2 Figure showing the association analysis results between different SNP molecular marker genotypes and total litter size.

[0026] Figure 3 The Sanger sequencing result is for the 9:33289690C>T site. Detailed Implementation

[0027] This invention involves whole-genome resequencing of pig genomic DNA, comparing the resequencing data with the pig reference genome (Sscrofa11.1.109), obtaining all high-quality SNPs on the genome, and analyzing the correlation between each locus and the total litter size trait in pigs to obtain a molecular marker associated with the total litter size trait. The SNP molecular marker is located at the base position 33289690 on chromosome 9 in the pig genome Sscrofa11.1.109. The SNP site of this molecular marker has C / T polymorphism, where T is the favorable allele variation of the total litter size trait in pigs.

[0028] The nucleotide sequence of the SNP molecular marker of this invention is shown in SEQ ID NO:1:

[0029] (SEQ ID NO.1)。

[0030] The 9:33289690C>T site is located at position 500 from the 5' end of SEQ ID NO.1. The C / T polymorphism at this site is significantly associated with the total number of piglets born. The total number of piglets born in individuals with the CC genotype is significantly lower than that of individuals with the TC genotype (P<0.01), the total number of piglets born in individuals with the TC genotype is significantly lower than that of individuals with the TT genotype (P<0.01), and the total number of piglets born in individuals with the CC genotype is significantly lower than that of individuals with the TT genotype (P<0.001).

[0031] This invention provides substances for detecting the porcine SNP molecular marker, including PCR primers for amplifying genomic DNA fragments including the SNP sites, or a kit containing the primers. The primers for amplifying the SNP molecular marker of this invention include upstream primer F: 5'-CTACTTCTGTGGACCTTCCTGTGTG-3' (SEQ ID NO.2) and downstream primer R: 5'-GTGTGGTGATAGGGTTAATGTTTTG-3' (SEQ ID NO.3). The kit also includes PCR amplification reagents.

[0032] In this invention, the preferred PCR amplification reagent is 2×Taq Master Mix (Dye). 2Taq Master Mix (Dye) is prepared by pre-mixing Taq DNA polymerase, dNTP mixture, MgCl2 and reaction buffer into a mixture of 2 times concentration and then optimizing the ratio. It has good amplification efficiency and high detection sensitivity.

[0033] The above-described primer set was used to amplify porcine genomic DNA by PCR. As one implementation method, the PCR amplification program consisted of 94°C pre-denaturation for 1 min, followed by 98°C denaturation for 10 s, 63°C annealing for 15 s, and 72°C extension for 45 s, for 34 cycles, with a final extension at 72°C for 5 min. The obtained amplified products were sequenced to detect the genotype at the 9:33289690C>T locus.

[0034] The criteria for judging the quality of a pig's total litter size are:

[0035] If the genotype at the 9:33289690C>T locus is TT, the pig will have a large total litter size.

[0036] If the genotype at the 9:33289690C>T locus is TC, the total number of piglets born to this pig is moderate.

[0037] If the genotype of the 9:33289690C>T locus is CC, the pig will have a low total litter size.

[0038] This invention does not specifically limit the sequencing method; any sequencing method known in the art can be used. In this embodiment, Sanger sequencing is used to determine the amplified DNA sequence. As one implementation method, DNA sequencing is performed at Aoke (Wuhan) Biotechnology Co., Ltd., with two reactions for gene fragment sequencing. This invention determines the quality of the total litter size trait in pigs based on the base type at position 500 from the 5' end of the sequence, thereby enabling the detection and optimization of the total litter size trait in pigs through genetic breeding.

[0039] The SNP molecular markers of this invention can be applied to association analysis of genotypes related to total litter size in pigs or traits related to total litter size in pigs, providing a new molecular marker resource for marker-assisted selection of pig reproductive performance.

[0040] The technical solution of the present invention will now be described in more detail with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0041] The reagents and consumables used in this invention are all commercially available products that can be purchased from the market.

[0042] The following uses the Eqing Black Pig as an example to illustrate the technical solution of this invention, but it is not intended to limit the technical solution of this invention. Those skilled in the art can apply the technical solution of this invention to other pig breeds to detect and optimize the total litter size trait, which also falls within the protection scope of this invention.

[0043] Example 1

[0044] Screening for molecular markers associated with total piglet number

[0045] (1) Data collection on reproductive traits of Eqing Black Pig

[0046] We selected 244 female Eqing Black Pigs from Qingping Breeding Pig Farm in Dangyang City, Hubei Province, and collected their total litter size trait data.

[0047] (2) Sample collection and genomic DNA extraction of Eqing black pigs

[0048] Ear or tail tissues from the above-mentioned Eqing Black Pig sows were collected using ear-tapping forceps and placed in 1.5 mL centrifuge tubes containing 75% alcohol, then stored at -20°C. Genomic DNA was extracted from the samples using a universal column-type genomic DNA extraction kit from Kangwei Century, following the manufacturer's instructions. After passing quality control, the samples were stored at -20°C.

[0049] (3) Quality control of whole genome resequencing and SNP detection

[0050] Samples that passed quality control were used to construct sequencing libraries using the YZSeq Tn5 Library Prep Kit. After library construction, quality control was performed, and samples that passed were sequenced on the DNBSEQ-T7B platform to obtain raw reads. The results were stored in fastq file format.

[0051] The raw data was filtered using FASP software: adapter sequences were removed; reads with more than 3% N bases were removed; reads shorter than 30 bases were removed; and reads with more than 40% low-quality bases (quality value less than 15) were removed. The final result was clean data that met the requirements for data analysis.

[0052] Clean reads were aligned to the pig reference genome (Sscrofa11.1.109) using BWA software. The alignment results were output as a SAM file. The SAM file was compressed, sorted, and duplicate reads were removed using Sambamba software. SNP sites were detected in the sorted and deduplicated BAM file using Sentieon software.

[0053] SNPs were filtered using BCFtools software with the following parameters: QUAL < 30.0 || QD < 2.0 || FS > 60.0 || MQ < 40.0 || SOR > 4.0 || ReadPosRankSum < -8.0. VCFtools was then used for quality control: variants with a deletion rate higher than 0.5% were removed; variants with sequencing depths less than 3 and greater than 100 were removed; variants with 2 alleles were retained. Plink 2.0 was then used for even stricter quality control of the VCFtools output files, with the following conditions: retaining autosomal variants; filtering out variants with a minimum allele frequency less than 5%; filtering out variants with a deletion rate higher than 10%; and filtering out variants that did not conform to Hardy-Weinberg equilibrium. Finally, 13,899,481 high-quality SNPs were obtained for subsequent analysis.

[0054] (4) GWAS analysis

[0055] GWAS analysis was performed on the total number of piglets (TNB) trait of Eqing Black Pigs using the MLM model of rMVP software, generating Manhattan plots and QQ plots. Figure 1 Using P = 2.48e-06 as the threshold for significant SNP sites, we obtained SNP sites that were significantly associated with the total litter size trait of Eqing Black Pigs.

[0056] Example 2

[0057] Association analysis of different genotypes of significant SNPs with total litter size

[0058] For significant SNPs identified by GWAS, genotypic data of the C>T mutation site at position 33289690 on chromosome 9 of each Eqing Black pig were extracted using Plink software. Individuals with the same genotype were grouped together, and the influence of different genotypes on the phenotype was detected using a one-way ANOVA test in SPSS 26.0 software. Statistical data are expressed as mean ± standard deviation, * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. Finally, GraphPadPrism 8 software was used for plotting.

[0059] The results show ( Figure 2 (or Table 1) The mutation at the 9:33289690C>T site leads to an increase in the total number of piglets born in Eqing Black Pigs. The average total number of piglets born for the wild CC genotype, the heterozygous TC mutant genotype, and the homozygous TT mutant genotype are 9.35, 10.30, and 11.79, respectively. The heterozygous TC genotype is significantly higher than the wild CC genotype (P<0.01), and the homozygous TT genotype is significantly higher than both the wild CC genotype and the heterozygous TC genotype (P<0.01). Therefore, this mutation is beneficial to the total number of piglets born. Both the TC and TT mutant genotypes are favorable alleles, and selection of individuals with this mutation should be strengthened during breeding.

[0060] Table 19: Association analysis between different genotypes at the 33289690C>T locus and total litter size

[0061] genotype Number of individuals Total number of piglets born (heads) Comparison group P-value CC 106 9.35±2.35 CCvsTC 0.003** TC 95 10.30±2.12 TCvsTT 0.003** TT 26 11.79±2.46 CCvsTT 0.0001***

[0062] Example 3

[0063] Validation of polymorphic sites

[0064] To verify the authenticity and reliability of the SNP loci obtained from high-throughput sequencing, rather than being caused by sequencing errors, six piglets that had already given birth were selected as samples and labeled as 1-6 respectively. The total number of piglets born to each pig was recorded, and the DNA sequence of the pig samples was extracted. Sanger sequencing was performed on the genotype of the 9:33289690C>T locus.

[0065] 1. Primer Design: The "subseq" parameter of the seqtk software was used to extract 500 bp of sequence information upstream and downstream of the 9:33289690 locus. Based on the extracted 1000 bp DNA sequence, primers were designed using Primer Premier 5.0 software.

[0066] F: CTACTTCTGTGGACCTTCCTGTGTG;

[0067] R: GTGTGGTGATAGGGTTAATGTTTTG;

[0068] The primer amplification sequence information is as follows, where the 9:33289690C>T site is located at the 500th position from the 5' end of the sequence and is marked in bold. The underlined part is the corresponding sequence of the primer.

[0069]

[0070] 2. PCR amplification: Add 1 μL of DNA template, 8 μL of double-distilled water, 10 μL of 2×Es Taq MasterMix (Dye), and 0.5 μL of each primer to a 20 μL system.

[0071] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 1 min, followed by 98℃ denaturation for 10 s, 63℃ annealing for 15 s, 72℃ extension for 45 s, for 34 cycles, and a final extension at 72℃ for 5 min.

[0072] 3. Sanger Sequencing: The DNA amplification products were sequenced at Aoke (Wuhan) Biotechnology Co., Ltd., with two sequencing reactions for each gene fragment. The obtained sequences were compared with the pig reference genome (Sscrofa11.1.109) in the Ensembl genome to determine the mutation status of the corresponding SNP sites.

[0073] Table 2. Total number of piglets born and genotypes of the 9:33289690C>T locus in the sample pigs.

[0074] Sample number Total number of offspring (feet) genotype 1 9.14 CC 2 9.43 CC 3 10 CC 4 10.8 TC 5 11 TC 6 11.67 TC

[0075] Sequencing results as follows Figure 3 As shown, where Figure 3 In the sample, A, B, and C are CC genotype samples, and D, E, and F are TC genotype samples, all of which match the total litter size trait of the pigs being tested.

[0076] In summary, the SNP molecular markers related to the average total number of piglets produced by pigs provided by this invention can be used to identify the total number of piglets produced by pigs based on genotype, enabling early selection and accelerating the breeding process.

[0077] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a substance for detecting porcine SNP molecular markers in any of the following aspects, characterized in that, Used for detecting or assisting in the detection of the total litter size trait of Eqing Black Pigs; Genetic breeding for improving the total litter size of Eqing Black Pigs; The SNP molecular marker is located at position 33289690 on chromosome 9 in the pig reference genome Sscrofa11.1.

109. The SNP site of this molecular marker has C / T polymorphism, where T is the favorable allele variation for total pig litter size.

2. The application according to claim 1, characterized in that, The substance for detecting porcine SNP molecular markers includes PCR primers for amplifying genomic DNA fragments, including the SNP sites, or a kit containing the primers.

3. The application according to claim 2, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The application according to claim 2, characterized in that, The kit also includes PCR amplification reagents.

5. A method for detecting the total litter size trait of Eqing Black Pigs, characterized in that, The base type at locus 33289690 on chromosome 9 in the Sscrofa11.1.109 genome of Eqing Black Pig was detected. The total litter size of the TC and CC genotype populations was less than that of the TT genotype population.

6. The method according to claim 5, characterized in that, The method for detecting the base type at position 33289690 on chromosome 9 in the genome Sscrofa11.1.109 of Eqing Black Pig includes: designing primers to amplify the nucleotide sequence shown in SEQ ID NO.1, using the primers to perform PCR amplification on the genomic DNA of Eqing Black Pig, and detecting the genotype at position 500 in the gene sequence of the amplified product.

7. The method according to claim 5, characterized in that, The genotype of the 9:33289690C>T locus was obtained using Sanger sequencing.

8. A genetic breeding method for increasing the total litter size trait of Eqing Black Pigs, characterized in that, The base type at locus 33289690 on chromosome 9 in the Sscrofa11.1.109 genome of the breeding pigs in the core Eqing Black Pig population was determined, and corresponding selections were made based on this base type: In the breeding of breeding pigs, individuals with the TT and TC bases at the 33289690 locus on chromosome 9 of pigs are selected, while CC-type individuals are eliminated, in order to increase the frequency of the T gene at this locus in each generation, thereby increasing the total litter size trait of the offspring Eqing Black Pigs.

Citation Information

Patent Citations

  • SNP (single nucleotide polymorphism) locus relevant to litter size on sow chromosome 9

    CN105543356A