T7-293t cell and its application in bovine parainfluenza virus type 3 infectious clone rescued virus

Abstract

The present application relates to the technical field of genetic engineering, in particular to a T7-293T cell and application of the T7-293T cell in bovine parainfluenza virus type 3 infectious clone rescued virus, and the T7-293T cell provided by the present application has the preservation number of CGMCC No.46335.The T7-293T cell provided by the present application is a 293T cell stably expressing T7 RNA polymerase, and has the advantages of high transfection efficiency and cheap transfection reagent.Further, the present application establishes a method for bovine parainfluenza virus type 3 infectious clone rescued virus based on the T7-293T cell, constructs three genes of NP, P and L of bovine parainfluenza virus type 3 into the same helper plasmid, and co-transfects the T7-293T cell with the full-length gene plasmid of the virus, so as to avoid the low efficiency of co-transfecting four plasmids, and further improve the success rate of bovine parainfluenza virus type 3 infectious clone rescued virus.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a T7-293T cell and application of the T7-293T cell in bovine parainfluenza virus type 3 infectious clone rescued virus. BACKGROUND

[0002] Bovine parainfluenza virus type 3 (BPIV3) is one of the main pathogens of bovine respiratory disease. It can cause fever, cough, runny nose, mental and appetite decline in cattle, thereby causing productivity decline, and often mixed infection with bovine respiratory syncytial virus, bovine viral diarrhea, contagious bovine rhinotracheitis, bovine pasteurella multocida, and other pathogens, and causes bovine respiratory syndrome. At present, there is no effective treatment for the disease, and the main method for prevention and control is vaccination. There is no vaccine on the market in China, and there are traditional bovine parainfluenza inactivated vaccine and attenuated live vaccine abroad, but there are certain limitations in immunization effect and safety. In order to control the infection of bovine parainfluenza virus, it is necessary to develop a new safe and effective vaccine.

[0003] The full-length infectious clone of the virus is based on the genetic material of the virus, and an infectious clone plasmid is constructed in vitro, and live virus is rescued in cells or susceptible hosts. This technology has important significance for the study of biological characteristics of viruses and the development of vaccines. Therefore, the full-length infectious clone based on BPIV3 can provide important technical support for the study of BPIV3 biological characteristics and the development of related biological products.

[0004] BSR T7 / 5 cells are BHK-21 cells stably expressing T7 RNA polymerase, which are obtained by lentivirus infection. At present, the bovine parainfluenza virus type 3 infectious clone rescued virus is mostly completed by using this cell. BSR T7 / 5 cells are not preserved in domestic cell banks and the American Type Culture Collection (ATCC), and it is difficult for ordinary researchers to obtain the cells.

[0005] At present, the bovine parainfluenza virus type 3 infectious clone rescued virus needs to construct four kinds of plasmids containing NP, P, L and full-length genes of the virus, and then co-transfect them into BSR T7 / 5 cells. After 24 hours, the supernatant is inoculated into MDBK cells, and the cells are cultured until cytopathic effect occurs. Only when the four different plasmids are successfully transfected into a cell, can the replicable virus particles be produced. However, the transfection efficiency of BSR T7 / 5 cells is low, which makes the probability of this situation even lower. This is an important reason why the bovine parainfluenza virus type 3 infectious clone rescued virus is prone to failure. SUMMARY

[0006] In order to solve the above problems, the application provides a T7-293T cell and application thereof in bovine parainfluenza virus type 3 infectious clone rescued virus.

[0007] In order to achieve the above object, the application provides the following technical scheme.

[0008] The application provides a T7-293T cell expressing T7 RNA polymerase, and the preservation number is CGMCC No.46335.

[0009] The application provides application of the T7-293T cell in the preparation of bovine parainfluenza virus type 3 infectious clone rescued virus products.

[0010] The application provides a bovine parainfluenza virus type 3 infectious clone rescued virus kit, which comprises the T7-293T cell, the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL.

[0011] The BPIV3-p15A plasmid comprises a LacZ-p15A vector and a bovine parainfluenza virus type 3 full-length gene sequence cloned into the LacZ-p15A vector; the nucleotide sequence of the LacZ-p15A vector is shown as SEQ ID NO.8.

[0012] The auxiliary plasmid pIRES2-NPL comprises a pIRES2-EGFP vector and a homologously recombined gene fragment; the gene fragment comprises a nucleoprotein gene sequence of bovine parainfluenza virus type 3, a phosphoprotein gene sequence of bovine parainfluenza virus type 3, an antibiotic resistance gene and a large polymerase protein gene sequence of bovine parainfluenza virus type 3.

[0013] Preferably, the construction method of the BPIV3-p15A plasmid comprises:

[0014] The bovine parainfluenza virus type 3 full-length gene sequence is divided into four segments for amplification, and the amplified target fragments are cloned into the LacZ-p15A vector to obtain the BPIV3-p15A plasmid; the nucleotide sequences of the four pairs of primers used for amplification are shown as SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, and SEQ ID NO.15 and SEQ ID NO.16, respectively.

[0015] Preferably, the amplification is RT-PCR amplification; the template of the RT-PCR amplification is the RNA of BPIV3-B1 strain; the preservation number of the BPIV3-B1 strain is CGMCC No. 46410.

[0016] Preferably, the antibiotic resistance gene is ampicillin (AmpR) resistance gene.

[0017] Preferably, the construction method of the helper plasmid pIRES2-NPL comprises:

[0018] linearized pIRES2-EGFP vector is obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO. 17 and SEQ ID NO. 18 as templates; NP gene is obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO. 19 and SEQ ID NO. 20 as templates; the linearized pIRES2-EGFP vector and the NP gene are subjected to homologous recombination to obtain pIRES-NP vector;

[0019] linearized pIRES-NP vector is obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO. 21 and SEQ ID NO. 22 as templates; P gene is obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO. 23 and SEQ ID NO. 24 as templates; the linearized pIRES-NP vector and the P gene are subjected to homologous recombination to obtain pIRES-NP-P vector;

[0020] linearized pIRES-NP-P vector is obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO. 25 and SEQ ID NO. 26 as templates; AmpR resistance gene is obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO. 27 and SEQ ID NO. 28 as templates; the linearized pIRES-NP-P vector and the AmpR resistance gene are subjected to homologous recombination to obtain pIRESA-NP-P vector;

[0021] The linearized pIRESA-NP-P vector is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 29 and SEQ ID NO. 30 as templates for amplification; the L gene is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 31 and SEQ ID NO. 32 as templates for amplification; the linearized pIRESA-NP-P vector and the P gene are subjected to homologous recombination to obtain the helper plasmid pIRES2-NPL.

[0022] Preferably, the vector containing the full-length gene sequence of bovine parainfluenza virus 3 is a LacZ-p15A vector; and the vector containing the AmpR resistance gene is a LacZ-p15A vector.

[0023] The application provides a method for preparing a bovine parainfluenza virus 3 infectious clone rescued virus, comprising the following steps:

[0024] The BPIV3-p15A plasmid and the helper plasmid pIRES2-NPL are co-transfected into T7-293T cells to obtain a bovine parainfluenza virus 3 infectious clone rescued virus; the T7-293T cells are the T7-293T cells in the kit or the T7-293T cells in the kit; the BPIV3-p15A plasmid and the helper plasmid pIRES2-NPL are the BPIV3-p15A plasmid and the helper plasmid pIRES2-NPL in the kit.

[0025] Preferably, the mass ratio of the BPIV3-p15A plasmid and the helper plasmid pIRES2-NPL is 1:1.

[0026] Beneficial effects:

[0027] The application provides a T7-293T cell expressing T7 RNA polymerase, with a preservation number of CGMCC No. 46335. The T7-293T cell provided by the application is a 293T cell stably expressing T7 RNA polymerase, which can be used not only for bovine parainfluenza virus 3 infectious clone rescued virus, but also has an advantage of high transfection efficiency and cheap transfection reagent, and can improve the success rate of virus rescue, compared with the BSR T7 / 5 cell (using a liposome transfection reagent) for virus rescue.

[0028] Further, the application establishes a method for rescuing virus of infectious clone of bovine parainfluenza virus type 3 based on T7-293T cells, constructs three genes of NP, P and L of bovine parainfluenza virus type 3 into the same auxiliary plasmid, and co-transfects T7-293T cells with the full-length gene plasmid of the virus, so as to avoid the low efficiency of co-transfecting four plasmids, and further improve the success rate of rescuing virus of infectious clone of bovine parainfluenza virus type 3 (cytopathic effect appears on the 5th day after transfection). BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0030] Figure 1 It is an electrophoretogram of T7 RNA polymerase sequence;

[0031] Figure 2 It is a plasmid map of LacZ-p15A vector;

[0032] Figure 3 It is an electrophoretogram of amplification product of gene fragment of bovine parainfluenza virus type 3;

[0033] Figure 4 It is a cytopathic effect map of rescued virus of bovine parainfluenza virus type 3.

[0034] Biological preservation description

[0035] T7-293T cells, classified as 293T cell strain stably expressing T7 RNA polymerase, were preserved in China General Microbiological Culture Collection Center on March 26, 2025, the preservation address is No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beichen West Road 1st Courtyard, Chaoyang District, Beijing, and the preservation number is CGMCC No. 46335.

[0036] BPIV3-B1 strain, classified as bovine parainfluenza virus type 3, was preserved in China General Microbiological Culture Collection Center on March 26, 2025, the preservation address is No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beichen West Road 1st Courtyard, Chaoyang District, Beijing, and the preservation number is CGMCC No. 46410. DETAILED DESCRIPTION

[0037] The application provides a T7-293T cell expressing T7 RNA polymerase, and the preservation number is CGMCC No. 46335.

[0038] The T7-293T cell provided by the application is a cell constructed based on 293T cells and stably expressing T7 RNA polymerase, and can be used for rescuing virus from bovine parainfluenza virus type 3 infectious clone, and compared with the virus rescued by BSR T7 / 5 cells (using a liposome transfection reagent), the T7-293T cell has an advantage of high transfection efficiency and cheap transfection reagent, and can improve the success rate of virus rescue.

[0039] The application provides application of the T7-293T cell in preparation of a bovine parainfluenza virus type 3 infectious clone virus rescue product.

[0040] The application provides a kit for rescuing virus from a bovine parainfluenza virus type 3 infectious clone, comprising the T7-293T cell, a BPIV3-p15A plasmid and an auxiliary plasmid pIRES2-NPL.

[0041] The BPIV3-p15A plasmid comprises a LacZ-p15A vector and a full-length gene sequence of bovine parainfluenza virus type 3 cloned into the LacZ-p15A vector; the nucleotide sequence of the LacZ-p15A vector is shown as SEQ ID NO. 8.

[0042] The auxiliary plasmid pIRES2-NPL comprises a pIRES2-EGFP vector and a homologously recombined gene fragment; the gene fragment comprises a nucleoprotein gene sequence of bovine parainfluenza virus type 3, a phosphoprotein gene sequence of bovine parainfluenza virus type 3, an antibiotic resistance gene and a large polymerase protein gene sequence of bovine parainfluenza virus type 3.

[0043] The LacZ-p15A vector provided by the application sequentially comprises a beta-galactosidase (LacZ alpha) coding sequence, a hammerhead ribozyme (HamRz) coding sequence, a T7 promoter, a p15A replicon, an AmpR resistance gene, a T7 terminator and a hepatitis D virus ribozyme (HdvRz) coding sequence. The beta-galactosidase (LacZ alpha) is used for blue-white spot screening, and the screening efficiency of constructing a BPIV3 full-length gene fragment clone is improved. The hammerhead ribozyme (HamRz) has a core sequence of 58 nt, and has a self-cleavage modification site at C at the 3' end. The hepatitis D virus ribozyme (HdvRz) has a core sequence of 88 nt, and has a self-cleavage modification site at G at the 5' end. The HamRz and the HdvRz are introduced into both ends of the BPIV3 virus genome, respectively, and the end of the genomic RNA is accurately cut through the ribozyme activity, so that the rescue efficiency of the recombinant virus is improved. The T7 promoter is a high-efficiency and specific prokaryotic promoter, and gene transcription is realized through specific binding with a T7 RNA polymerase. The p15A replicon is a low-copy replicon, and can accommodate a large fragment gene (>10 kb) insertion. The AmpR resistance gene is used for clone screening. The T7 terminator sends a termination signal to the T7 RNA polymerase through a specific sequence (such as a hairpin structure and a U-rich sequence), promotes the termination of RNA synthesis, and avoids the read-through phenomenon.

[0044] The application constructs three genes of NP, P and L of bovine parainfluenza virus type 3 into the same helper plasmid (helper plasmid pIRES2-NPL), and co-transfects T7-293T cells with a full-length gene plasmid (BPIV3-p15A plasmid) to avoid the low efficiency of simultaneous transfection of four plasmids, thereby further improving the success rate of virus rescue (cytopathic effect appears on the fifth day after transfection).

[0045] As an embodiment, the construction method of the BPIV3-p15A plasmid comprises the following steps:

[0046] The full-length gene sequence of bovine parainfluenza virus type 3 is divided into four segments for amplification, and the amplified target fragments are cloned into the LacZ-p15A vector to obtain the BPIV3-p15A plasmid. The nucleotide sequences of the four pairs of primers used for amplification are as shown in SEQ ID NO. 9 and SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12, SEQ ID NO. 13 and SEQ ID NO. 14, and SEQ ID NO. 15 and SEQ ID NO. 16, respectively.

[0047] As an implementation form, the amplification is RT-PCR amplification; a template of the RT-PCR amplification is RNA of a BPIV3-B1 strain; a preservation number of the BPIV3-B1 strain is CGMCC No. 46410.

[0048] As an implementation form, the antibiotic resistance gene is an AmpR resistance gene.

[0049] As an implementation form, a construction method of the helper plasmid pIRES2-NPL comprises:

[0050] A linearized pIRES2-EGFP vector is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 17 and SEQ ID NO. 18 to amplify a pIRES2-EGFP vector as a template; an NP gene is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 19 and SEQ ID NO. 20 to amplify a vector containing a full-length gene sequence of bovine parainfluenza virus 3 as a template; and the linearized pIRES2-EGFP vector and the NP gene are subjected to homologous recombination to obtain a pIRES-NP vector;

[0051] A linearized pIRES-NP vector is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 21 and SEQ ID NO. 22 to amplify the pIRES-NP vector as a template; a P gene is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 23 and SEQ ID NO. 24 to amplify a vector containing a full-length gene sequence of bovine parainfluenza virus 3 as a template; and the linearized pIRES-NP vector and the P gene are subjected to homologous recombination to obtain a pIRES-NP-P vector;

[0052] A linearized pIRES-NP-P vector is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 25 and SEQ ID NO. 26 to amplify the pIRES-NP-P vector as a template; an AmpR resistance gene is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 27 and SEQ ID NO. 28 to amplify a vector containing the AmpR resistance gene as a template; and the linearized pIRES-NP-P vector and the AmpR resistance gene are subjected to homologous recombination to obtain a pIRESA-NP-P vector;

[0053] The linearized pIRESA-NP-P vector is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 29 and SEQ ID NO. 30 as templates for amplification; the L gene is obtained by using primers with nucleotide sequences as shown in SEQ ID NO. 31 and SEQ ID NO. 32 as templates for amplification; the linearized pIRESA-NP-P vector and the P gene are subjected to homologous recombination to obtain the auxiliary plasmid pIRES2-NPL.

[0054] As an implementation form, the vector containing the full-length gene sequence of bovine parainfluenza virus 3 is a LacZ-p15A vector; and the vector containing the AmpR resistance gene is a LacZ-p15A vector.

[0055] The application provides a method for preparing a bovine parainfluenza virus 3 infectious clone rescued virus, comprising the following steps:

[0056] The BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are co-transfected into T7-293T cells to obtain a bovine parainfluenza virus 3 infectious clone rescued virus; the T7-293T cells are the T7-293T cells in the kit or the T7-293T cells in the kit described in the above technical solution; and the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL are the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL in the kit described in the above technical solution.

[0057] As an implementation form, the mass ratio of the BPIV3-p15A plasmid and the auxiliary plasmid pIRES2-NPL is 1:1.

[0058] The rescue method provided by the application constructs three genes NP, P and L of bovine parainfluenza virus 3 into the same auxiliary plasmid, and co-transfects T7-293T cells with a virus full-length gene plasmid, thereby avoiding the low efficiency of co-transfecting four plasmids, and further improving the success rate of bovine parainfluenza virus 3 infectious clone rescued virus (cytopathic effect appears on the fifth day after transfection).

[0059] In order to further illustrate the application, a T7-293T cell provided by the application and the application thereof in bovine parainfluenza virus 3 infectious clone rescued virus are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the protection scope of the application.

[0060] Example 1 Construction of T7-293T stable cell line

[0061] 1. Construction of T7 RNA polymerase gene expression vector

[0062] According to the whole genome sequence of E. coli BL21 (DE3) (AM946981.2), the homologous arm primers (SEQ ID NO. 1 and SEQ ID NO. 2) were designed, the genomic DNA of E. coli BL21 (DE3) was extracted, the T7 RNA polymerase sequence was amplified by PCR, the pCDNA3.1 vector was digested by EcoRI, and the T7 RNA polymerase sequence was homologously recombined into the pCDNA3.1 vector using the homologous recombination cloning kit of Shanghai Yixing Hieff Universal II One Step Cloning Kit to obtain the T7-pCDNA vector.

[0063] The T7-pCDNA vector was used as a template, and the primers SEQ ID NO. 3 and SEQ ID NO. 4 were used for amplification to obtain a linearized T7-pCDNA vector without NeoR / KanR gene sequence.

[0064] The puromycin N-acetyltransferase (PAC) gene sequence (SEQ ID NO. 7) was synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. (hereinafter referred to as Shanghai Shengong), and the PAC sequence shown in SEQ ID NO. 7 was used as a template, and the homologous arm primers (SEQ ID NO. 5 and SEQ ID NO. 6) were used for amplification to obtain a PAC sequence containing a homologous arm, and the PAC sequence containing a homologous arm was homologously recombined into the linearized T7-pCDNA vector. The DH5α competent cells were transformed, and the plasmid was extracted and named T7-PAC-pCDNA.

[0065] SEQ ID NO. 1: actgtgctggatatctgcagatgaacacgattaacatcgctaagaacg (the nucleotide sequence direction is 5'-3', the same below);

[0066] SEQ ID NO. 2: ccactagtccagtgtggtggttacgcgaacgcgaagtccg;

[0067] SEQ ID NO. 3: tcctgtctcttgatcagatccgaaaat;

[0068] SEQ ID NO. 4: cacgagatttcgattccaccg;

[0069] SEQ ID NO. 5: gatctgatcaagagacaggaatgaccgagtacaagcccacg;

[0070] SEQ ID NO. 6: ggtggaatcg aaatctcgtg tcaggcaccg ggcttgc

[0071] SEQ ID NO. 7:

[0072] atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtcccccgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgacccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga.

[0073] 2. Transfection of 293T cells (human kidney epithelial cell line) with T7-PAC-pCDNA plasmid

[0074] The 293T cells were inoculated into a 6-well plate one day before transfection, and the cell density was 70%-80% at the time of transfection. 2 μg of T7-PAC-pCDNA plasmid was diluted with 100 μL of serum-free DMEM medium, and then 4 μL of PEI transfection reagent (concentration 1 mg / mL) was added, mixed gently, and incubated at room temperature for 15 min to prepare the DNA-PEI complex. The DNA-PEI complex was added to the cells, the culture plate was shaken, and the medium was mixed. The cells were incubated at 37°C in a 5% CO2 incubator for 24 h, trypsinized, inoculated into a T25 cell culture bottle, and a blank control cell bottle was set up, and both were added with puromycin at a final concentration of 4 μg / mL. The cells were incubated at 37°C in a 5% CO2 incubator for 5-7 days until the blank control cells died. After the transfected cells grew to fullness, the final concentration of puromycin was maintained at 4 μg / mL, and the cells were subcultured for 3 times to obtain the T7-293T stable cell line.

[0075] 3. Verification of T7-293T stable cell line

[0076] The T7-293T cell RNA was extracted by the Trizol method, and the T7 RNA polymerase sequence was amplified by RT-PCR using the primers shown in SEQ ID NO. 1 and SEQ ID NO. 2. The purpose band proved that the T7-293T stable cell line was successfully constructed, as shown in Figure 1 , wherein M is Marker, and lane 1 is the T7 RNA polymerase sequence. The T7-293T cell line was preserved in the China General Microbiological Culture Collection Center, and the preservation number was CGMCC No. 46335.

[0077] Example 2 Construction of bovine parainfluenza virus type 3 full-length gene plasmid

[0078] 1. The LacZ-p15A vector was synthesized by Shanghai Shengong, which sequentially contained a β-galactosidase (LacZα) coding sequence, a hammerhead ribozyme (HamRz) coding sequence, a T7 promoter, a p15A replicon, an AmpR resistance gene, a T7 terminator, and a hepatitis D virus ribozyme (HdvRz) coding sequence, as shown in SEQ ID NO. 8, and the plasmid map is shown in Figure 2 .

[0079] SEQ ID NO. 8:

[0080]

[0081] 2. Refer to the full-length gene sequence of bovine parainfluenza virus type 3 on GeneBank, design primers in the conserved region, divide the full-length gene into 4 segments, and add BsmBI enzyme cutting sites to the upstream and downstream primers. Extract the RNA of BPIV3-B1 strain (preservation number CGMCC No. 46410) by using a virus DNA / RNA extraction kit, and use primer pair 1 (indicated by SEQ ID NO. 9 and SEQ ID NO. 10), primer pair 2 (indicated by SEQ ID NO. 11 and SEQ ID NO. 12), primer pair 3 (indicated by SEQ ID NO. 13 and SEQ ID NO. 14), and primer pair 4 (indicated by SEQ ID NO. 15 and SEQ ID NO. 16) to perform RT-PCR amplification of the target fragments, respectively. The electrophoresis result is shown in FIG. 2. Figure 3 wherein M is Marker, lane 1 is the amplification product of primer pair 1, lane 2 is the amplification product of primer pair 2, lane 3 is the amplification product of primer pair 3, and lane 4 is the amplification product of primer pair 4.

[0082] The Golden Gate cloning method is used, 75 ng of LacZ-p15A vector, 150 ng of PCR product, 1 μL of Esp3I (BsmBI) restriction endonuclease, 1 μL of T4 ligase, 2 μL of 10× T4 ligase buffer, and water are added to 20 μL to configure the reaction system. The reaction steps are as follows: 37°C for 1 min, 16°C for 1 min, 30 cycles, and 60°C for 5 min to terminate the reaction. The reaction product is transformed into DH5α competent cells, 10 μL of 0.1M IPTG and 10 μL of X-gal (20 mg / mL) are added, and AmpR resistant LB plates are coated and cultured at 37°C overnight. White colonies are picked and identified by PCR using primer pairs 1-4. The positive colonies are identified, cultured at 37°C and 250 rpm overnight, and the plasmid is extracted and named BPIV3-p15A.

[0083] SEQ ID NO. 9: cgcggatccggctaccgtctctgaagagacttgcttgggaatattaattc;

[0084] SEQ ID NO. 10: acgcgtcgacggctaccgtctcgtccgcattgtttaggacattc;

[0085] SEQ ID NO. 11: cccaagcttggctaccgtctcgcggatactgcatcgaagatagactttctagcag;

[0086] SEQ ID NO. 12: acgcgtcgacggctaccgtctcttttggtgtcgtctttgcactgacttttggtctg;

[0087] SEQ ID NO. 13: acgcgtcgacggctaccgtctctcaaattcaaaaatggaatattgg;

[0088] SEQ ID NO. 14: acgcgtcgacggctaccgtctcgacaataaggatctccaacatatattg;

[0089] SEQ ID NO. 15: cccaagcttggctaccgtctcgttgtccaccatcagatattgaacatttaccac;

[0090] SEQ ID NO. 16: ggctaccgtctcaagtcaccaaacaagagaaaaactc.

[0091] Example 3 Construction of bovine parainfluenza virus type 3 NP, P, L gene expression plasmid

[0092] According to the full-length gene of bovine parainfluenza virus type 3, primers were designed, and the NP gene was amplified by PCR with the plasmid BPIV3-p15A as a template. The NP gene was homologously recombined downstream of the CMV promoter of the pIRES2-EGFP vector to obtain the plasmid pIRES-NP; wherein the nucleotide sequence of the linearization primer of the pIRES2-EGFP vector is shown as SEQ ID NO. 17 and SEQ ID NO. 18, and the nucleotide sequence of the NP gene amplification primer is shown as SEQ ID NO. 19 and SEQ ID NO. 20.

[0093] The P gene was amplified by PCR with the plasmid BPIV3-p15A as a template, and the P gene was homologously recombined downstream of the internal ribosome entry site (IRES) in the vector pIRES-NP to replace the EGFP gene, to obtain the plasmid pIRES-NP-P; wherein the nucleotide sequence of the linearization primer of the pIRES-NP vector is shown as SEQ ID NO. 21 and SEQ ID NO. 22, and the nucleotide sequence of the P gene amplification primer is shown as SEQ ID NO. 23 and SEQ ID NO. 24.

[0094] ​​​​​AmpR resistance gene was amplified by PCR using the vector LacZ-p15A as a template, and inserted into the pIRES-NP-P vector between the SV40 polyadenylation signal and the SV40 promoter by homologous recombination to obtain the plasmid pIRESA-NP-P; wherein the nucleotide sequences of the linearization primers of the pIRES-NP-P vector are shown as SEQ ID NO. 25 and SEQ ID NO. 26, and the nucleotide sequences of the amplification primers of the AmpR resistance gene are shown as SEQ ID NO. 27 and SEQ ID NO. 28.

[0095] L gene was amplified by PCR using the plasmid BPIV3-p15A as a template, and inserted into the pIRESA-NP-P vector downstream of the SV40 promoter by homologous recombination to replace the NeoR / KanR gene to obtain the plasmid pIRESA-NP-P-L (denoted as pIRES2-NPL); wherein the nucleotide sequences of the linearization primers of the pIRESA-NP-P vector are shown as SEQ ID NO. 29 and SEQ ID NO. 30, and the nucleotide sequences of the fragmentation primers of the L gene are shown as SEQ ID NO. 31 and SEQ ID NO. 32.

[0096] SEQ ID NO. 17: gcgctagcggatctgacg;

[0097] SEQ ID NO. 18: gcatttggaaacaactaacctctgcagtcgacggtaccg;

[0098] SEQ ID NO. 19: accgtcagatccgctagcgccaccatgctgagtctatttgacacattcagtgcgc;

[0099] SEQ ID NO. 20: ggttagttgtttccaaatgcact;

[0100] SEQ ID NO. 21: ggttgtggccatattatcatcgt;

[0101] SEQ ID NO. 22: cggccgcgactctagatcataa;

[0102] SEQ ID NO. 23: atgataatatggccacaaccatggaaaacaatgttaaagacaatca;

[0103] SEQ ID NO. 24: atgatctagagtcgcggccggagttggatccttggttggct;

[0104] SEQ ID NO. 25: cactgattaagcattggtaacgcttacaatttacgccttaagat;

[0105] SEQ ID NO. 26: cctgaggcggaaagaacca;

[0106] SEQ ID NO. 27: ttaccaatgcttaatcagtgaggca;

[0107] SEQ ID NO. 28: ctggttctttccgcctcaggcgcggaacccctatttgtt;

[0108] SEQ ID NO. 29: cgatcctcatcctgtctcttgat;

[0109] SEQ ID NO. 30: tcaaccattaactctcagcaaggctaactgaaacacggaagg;

[0110] SEQ ID NO. 31 : aagagacaggatgaggatcggccaccatggacaccgaatcccacag;

[0111] SEQ ID NO. 32: tgctgagagttaatggttgaaccaaacaagagaaaaactctgtttgttatatatat.

[0112] Example 4 Bovine parainfluenza virus type 3 rescue method

[0113] T7-293T cells were inoculated into 6-well plates the day before transfection, and the cell density was 70%-80% at the time of transfection. 100 μL of serum-free DMEM medium was taken, 0.5 μg of the plasmid BPIV3-p15A constructed in Example 2 and 0.5 μg of the expression helper plasmid pIRES2-NPL constructed in Example 3 were added, and then 3 μL of PEI transfection reagent (concentration 1 mg / mL) was added, mixed gently, and incubated at room temperature for 15 min to prepare a DNA-PEI complex. The DNA-PEI complex was added to the T7-293T cells, the culture plate was shaken, and the medium was mixed. Incubate in a 37°C, 5% CO2 incubator for 8 h. Trypsinize the cells, mix with MDBK cells, inoculate a T25 cell culture flask, and the cell density is about 40%-60%, and maintain the culture with DMEM medium containing 1% bovine serum. 5-7 days after the MDBK cells showed cytopathic effect (see Figure 4 ), indicating that the bovine parainfluenza virus type 3 was successfully rescued.

[0114] Example 5 Comparison of rescue efficiency of single helper plasmid and multiple helper plasmids

[0115] Referring to the bovine parainfluenza virus type 3 rescue method of Example 4, the transfection reagent is 3 μL of PEI, and according to Table 1, it is divided into 4 groups. Groups 1 and 2 use T7-293T cells as transfection cells, group 1 transfects full-length gene plasmid BPIV3-p15A and helper plasmid pIRES2-NPL, and group 2 transfects full-length gene plasmid BPIV3-p15A and 3 helper plasmids pCI-NP, pCI-P and pCI-L. 8 h after transfection, mix with MDBK cells and culture for 7 days, and observe the cytopathic effect. If there is no cytopathic effect, blind passage for 3 generations.

[0116] Groups 3 and 4 use BHK-21 cells as transfection cells, group 3 transfects full-length gene plasmid BPIV3-p15A, helper plasmid pIRES2-NPL and pCGSSS-T7, and group 4 transfects full-length gene plasmid BPIV3-p15A, helper plasmid pCI-NP, pCI-P, pCI-L and pCGSSS-T7. 8 h after transfection, mix with MDBK cells and culture for 7 days, and observe the cytopathic effect. If there is no cytopathic effect, blind passage for 3 generations, and the transfection method refers to Chinese patent CN116479016A.

[0117] The construction method of plasmids pCI-NP, pCI-P, pCI-L and pCGSSS-T7 is described in Chinese patent CN116479016A. The methods for constructing pCI-NP, pCI-P, pCI-L and pCGSSS-T7 are described in Chinese patent CN116479016A. The most basic gene construction is to construct the target gene to the CMV promoter.

[0118] The cytopathic effect results are shown in Table 1.

[0119] Table 1 Cytopathic effect of different groups

[0120]

[0121] The results show that group 1 appears cytopathic effect at the 5th day; group 2 appears cytopathic effect at the 3rd generation; group 3 and group 4 have no cytopathic effect. The experimental results show that the bovine parainfluenza virus type 3 rescue method based on the T7-293T cell line of the present application is obviously superior to the virus rescue method of transfecting BHK-21 cells with multiple helper plasmids.

[0122] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. A kit for rescuing bovine parainfluenza virus type 3 infectious clones, characterized in that, Including T7-293T cells, BPIV3-p15A plasmid, and helper plasmid pIRES2-NPL; The T7-293T cells have the accession number CGMCC No. 46335; The BPIV3-p15A plasmid includes the LacZ-p15A vector and the full-length gene sequence of bovine parainfluenza virus type 3 cloned into the LacZ-p15A vector; the nucleotide sequence of the LacZ-p15A vector is shown in SEQ ID NO. 8; The helper plasmid pIRES2-NPL includes the pIRES2-EGFP vector and a homologous recombination gene fragment; the gene fragment includes the nucleoprotein gene sequence of bovine parainfluenza virus type 3, the phosphoprotein gene sequence of bovine parainfluenza virus type 3, the antibiotic resistance gene, and the large polymerase protein gene sequence of bovine parainfluenza virus type 3.

2. The reagent kit according to claim 1, characterized in that, The method for constructing the BPIV3-p15A plasmid includes: The full-length gene sequence of bovine parainfluenza virus type 3 was divided into four segments for amplification. The amplified target fragment was cloned into the LacZ-p15A vector to obtain the BPIV3-p15A plasmid. The nucleotide sequences of the four pairs of primers used for amplification are shown in SEQ ID NO. 9 and SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12, SEQ ID NO. 13 and SEQ ID NO. 14, and SEQ ID NO. 15 and SEQ ID NO. 16, respectively.

3. The reagent kit according to claim 2, characterized in that, The amplification was performed by RT-PCR; the template for the RT-PCR amplification was the RNA of the BPIV3-B1 virus strain; the preservation number of the BPIV3-B1 virus strain was CGMCC No. 46410.

4. The reagent kit according to claim 1, characterized in that, The antibiotic resistance gene is an ampicillin resistance gene.

5. The reagent kit according to claim 1, characterized in that, The method for constructing the helper plasmid pIRES2-NPL includes: Using the pIRES2-EGFP vector as a template, amplification was performed using primers with nucleotide sequences shown in SEQ ID NO.17 and SEQ ID NO.18 to obtain the linearized pIRES2-EGFP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification was performed using primers with nucleotide sequences shown in SEQ ID NO.19 and SEQ ID NO.20 to obtain the NP gene; homologous recombination was performed between the linearized pIRES2-EGFP vector and the NP gene to obtain the pIRES-NP vector; Using the pIRES-NP vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.21 and SEQ ID NO.22 to obtain a linearized pIRES-NP vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.23 and SEQ ID NO.24 to obtain the P gene; homologous recombination was performed between the linearized pIRES-NP vector and the P gene to obtain the pIRES-NP-P vector; Using the pIRES-NP-P vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.25 and SEQ ID NO.26 to obtain the linearized pIRES-NP-P vector; using the vector containing the ampicillin resistance gene as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.27 and SEQ ID NO.28 to obtain the ampicillin resistance gene; homologous recombination was performed between the linearized pIRES-NP-P vector and the ampicillin resistance gene to obtain the pIRESA-NP-P vector; Using the pIRESA-NP-P vector as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.29 and SEQ ID NO.30 to obtain the linearized pIRESA-NP-P vector; using a vector containing the full-length gene sequence of bovine parainfluenza virus type 3 as a template, amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.31 and SEQ ID NO.32 to obtain the L gene; homologous recombination was performed between the linearized pIRESA-NP-P vector and the P gene to obtain the helper plasmid pIRES2-NPL.

6. The reagent kit according to claim 5, characterized in that, The vector containing the full-length gene sequence of bovine parainfluenza virus type 3 is the LacZ-p15A vector; the vector containing the ampicillin resistance gene is the LacZ-p15A vector.

7. A method for preparing an infectious clone of bovine parainfluenza virus type 3 to rescue the virus, characterized in that, include: The BPIV3-p15A plasmid and the helper plasmid pIRES2-NPL were co-transfected into T7-293T cells to obtain an infectious clone of bovine parainfluenza virus type 3, which was rescued from the virus. The T7-293T cells were the same as those in the kit described in any one of claims 1 to 6. The BPIV3-p15A plasmid and the helper plasmid pIRES2-NPL were the same as those in the kit described in any one of claims 1 to 6.

8. The method according to claim 7, characterized in that, The mass ratio of the BPIV3-p15A plasmid to the helper plasmid pIRES2-NPL is 1:1.

Images