Personal care composition
By combining arginine with C7-C9 dicarboxylic acids or their esters, a personal care composition for topical application is formed, which solves the problem of decreased stability of existing anti-aging cosmetics and achieves synergistic improvement in the gene expression of type 1 collagen and anti-aging effects on the skin.
Patent Information
- Application Number
- CN202480011585.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-14
- Filing Date
- 2024-01-22
- Publication Date
- 2025-09-16
AI Technical Summary
The addition of retinoic acid precursors to existing anti-aging cosmetic compositions leads to decreased stability, necessitating the development of new active ingredient combinations to provide equivalent or better anti-aging benefits, especially through safe, skin-friendly compounds to achieve synergistic improvements in type 1 collagen gene expression.
Arginine is combined with a C7-C9 dicarboxylic acid or its ester in a weight ratio ranging from 50:1 to 1:1, and the composition does not contain a 1:1 ratio of arginine and dimethyl pimelate. A cosmetically acceptable carrier and other ingredients such as retinoids, fatty alcohols, moisturizers, skin lighteners, sunscreens, etc. are added to form a personal care composition for topical application.
Boosts gene expression of type 1 collagen, providing synergistic anti-aging benefits, improving skin elasticity and wrinkles, enhancing skin smoothness and evenness, suitable for exposed areas of the face and body.
Smart Images

Figure BDA0005537572810000031 
Figure BDA0005537572810000041 
Figure BDA0005537572810000131
Abstract
Description
Technical Field
[0001] The present invention relates to an anti-aging composition that confers such benefits upon topical application by combining specific amino acids with certain dicarboxylic acids or their esters. Background Art
[0002] Most people desire youthful, elastic skin with an even skin tone and smooth texture. However, human skin is susceptible to various factors, such as skin diseases, environmental changes (wind, air conditioning, sun exposure, pollution, blue light, etc.), or natural aging (physiological aging). Over time, fine lines, wrinkles, a sallow or sallow complexion, sagging skin, pigmentation, age spots, and various other signs of aging appear on the face. People address these issues through improved nutrition, balanced exercise, and a healthy lifestyle. While these activities are considered beneficial to health and believed to slow the aging process, including making the skin look younger, people tend to use cosmetics to at least temporarily cover up any visible signs of aging, especially on the skin. As a result, the demand for anti-aging cosmetics targeting these visible signs of aging has grown significantly.
[0003] In recent years, cosmetic compositions featuring retinoic acid precursors (e.g., retinol) have become quite prominent. Retinol, also known as vitamin A, and its many ester derivatives and members of the retinoid family, such as retinyl propionate, when applied topically, can effectively reduce fine lines and wrinkles, smooth the skin, and improve uneven skin tone. Although retinoids have many benefits, adding retinoic acid precursors to cosmetic compositions typically results in decreased stability of the composition. Therefore, there is a need in the art to develop new active ingredient combinations to provide equivalent or even better anti-aging benefits. It is particularly preferred that such active ingredients are well-known and have a proven history of safe use on the skin. While seeking to develop this technology, the inventors discovered a very special amino acid (i.e., arginine) in combination with certain dicarboxylic acids (i.e., C7-C9 dicarboxylic acids) or their esters, which work synergistically to increase the content of collagen, which is an indicator of anti-aging benefits.
[0004] Arginine has been shown to have some anti-wrinkle benefits when used alone or in combination with certain other herbal ingredients in creams or ointments (e.g., HU20040001422). The dicarboxylic acids or esters claimed in the present composition do not appear to have such benefits. Therefore, the inventors were surprised to find that the combination of these two compounds synergistically improved type 1 collagen gene expression, an indicator of anti-aging benefits. Summary of the Invention
[0005] It is therefore an object of the present invention to provide a topical composition that imparts synergistically improved anti-aging benefits to the skin.
[0006] It is another object of the present invention to impart this benefit by using commonly used skin-friendly compounds such as amino acids and dicarboxylic acids. SUMMARY OF THE INVENTION
[0008] A first aspect of the present invention relates to a personal care composition comprising
[0009] (i) arginine;
[0010] (ii) a C7 to C9 dicarboxylic acid or an ester thereof; and
[0011] (iii) a cosmetically acceptable carrier;
[0012] wherein the weight ratio of arginine to dicarboxylic acid or ester thereof is in the range of 50:1 to 1:1; and wherein the composition does not comprise arginine and dimethyl pimelate in a weight ratio of 1:1.
[0013] Another aspect of the present invention relates to a method of imparting anti-aging benefits to the skin, comprising the step of applying the composition of the first aspect to a desired skin surface. DETAILED DESCRIPTION
[0014] These and other aspects, features, and advantages will become apparent to those skilled in the art upon reading the following detailed description and the appended claims. For the avoidance of doubt, any feature of one aspect of the present invention may be applied to any other aspect of the present invention. The word "comprising" is intended to mean "including," but does not necessarily mean "consisting of" or "composed of." In other words, the listed steps or options are not necessarily exhaustive. It should be noted that the examples given in the following description are intended to illustrate the present invention and are not intended to limit the present invention to these examples themselves. Similarly, unless otherwise indicated, all percentages are weight / weight percentages. Except in the operating and comparative examples or otherwise explicitly indicated, all numbers in this specification and claims indicating amounts of materials or reaction conditions, physical properties of materials, and / or uses should be understood to be modified by the word "about." Numerical ranges expressed in the format "from x to y" should be understood to include x and y. When multiple preferred ranges are described for a particular feature in the format "from x to y," it should be understood that all ranges combining the different endpoints are also contemplated.
[0015] The compositions of the present invention are intended for personal care or cosmetic use and may also be referred to as personal care compositions or cosmetic compositions. As used herein, "personal care compositions" are intended to include compositions that are applied topically, i.e., to the outer surface of human skin. Such compositions may be classified as leave-on or rinse-off and include any product that is applied to the human body to improve appearance, cleansing, odor control, or overall aesthetics. The compositions are preferably leave-on. The compositions of the present invention may be in the form of a liquid, lotion, cream, foam, stick, serum, essence, or gel. Preferred compositions include leave-on gels, lotions, serums, or creams, preferably in the form of a serum or cream.
[0016] As used herein, "skin" is intended to include the skin on the face and body (eg, neck, chest, back, arms, hands, and legs), especially exposed portions thereof.
[0017] The present invention relates to a personal care composition comprising (i) arginine and (ii) a C7 to C9 dicarboxylic acid or an ester thereof; and (iii) a cosmetically acceptable carrier.
[0018] Arginine is an amino acid with the following chemical structure
[0019]
[0020] The molecule is characterized by a guanidine group attached to a standard amino acid backbone. Arginine (Arg) residues are a common component of proteins. Like all amino acids, it is a white, water-soluble solid. The inventors have experimented with other amino acids, particularly lysine, which is in the same family as arginine. They found that none of the other amino acids, including lysine, when combined with the dicarboxylic acids or esters of the present invention, imparted synergistic anti-aging benefits in a manner similar to arginine. Arginine may be present in an amount of 0.1 to 5% by weight of the composition, preferably 0.5 to 2.5% by weight.
[0021] The composition of the present invention comprises a C7 to C9 dicarboxylic acid or an ester thereof. Preferably, the dicarboxylic acid or an ester thereof is selected from one or more of pimelic acid, dimethyl pimelate, suberic acid and azelaic acid.
[0022] The chemical structure of the above compound is as follows:
[0023]
[0024] The most preferred dicarboxylic acid is pimelic acid.The dicarboxylic acid or its ester is preferably present in an amount of 0.05 to 1.5 wt %, more preferably 0.1 to 1.0 wt %, based on the weight of the composition.
[0025] The weight ratio of arginine to dicarboxylic acid or its ester is in the range of 50:1 to 1:1. Examples of such weight ratios include 50:1, 45:1, 40:1, 35:1, 30:1, 25:1, 5:1, 4:1, 3:1, 2:1 and 1:1. Thus, the weight ratio of arginine to dicarboxylic acid or its ester is preferably 45:1 to 1:1, preferably 40:1 to 1:1, preferably 35:1 to 1:1, preferably 30:1 to 1:1, preferably 25:1 to 1:1, preferably 5:1 to 1:1, preferably 4:1 to 1:1, preferably 3:1 to 1:1, preferably 2:1 to 1:1.
[0026] For example, when the weight ratio of arginine to dicarboxylic acid or its ester is 5:1, the amount of arginine present is 5 times the amount of dicarboxylic acid or its ester. For example, when 0.005 wt% of arginine is taken, the amount of pimelic acid is 0.001 wt%.
[0027] The composition does not include arginine and dimethyl pimelate in a weight ratio of 1:1.
[0028] Preferably, the composition does not comprise arginine and a C7 to C9 dicarboxylic acid or ester thereof in a weight ratio of 20:1 or 10:1. Preferably, the composition does not comprise arginine and a C7 to C9 dicarboxylic acid or ester thereof in a weight ratio ranging from 20:1 to 10:1.
[0029] Preferably, the composition comprises arginine and a C7 to C9 dicarboxylic acid or ester thereof in a weight ratio that confers a synergistic anti-aging benefit.The anti-aging benefit is preferably measured based on gene expression of type 1 collagen, which is an indicator of anti-aging benefit.
[0030] The compositions of the present invention may additionally comprise known anti-aging agents, namely retinoids. Typically, the retinoid is selected from retinyl esters, retinol, retinal, retinoic acid, or mixtures thereof. More preferably, the retinoid comprises retinol, retinyl esters, or mixtures thereof. Particularly preferred retinoids are selected from all-trans retinol, retinyl palmitate, retinyl acetate, retinyl propionate, or mixtures thereof. Most preferred retinoids are selected from retinyl palmitate, retinyl propionate, or mixtures thereof.
[0031] Preferably, the amount of retinoid in the composition is 0.001 to 0.5 wt %, more preferably 0.01 to 0.2 wt %, based on the weight of the composition.
[0032] The compositions of the present invention preferably include a suitable fatty alcohol. Fatty alcohols useful in the present invention include compounds having 10 to 20 carbon atoms in the fatty chain. Particularly preferred fatty alcohols are cetyl alcohol, myristyl alcohol, palmityl alcohol, or stearyl alcohol. The most preferred fatty alcohol for use in the present invention is cetyl alcohol. The fatty alcohol is preferably present in an amount of 0.1 to 2 weight percent, more preferably 0.4 to 1.0 weight percent, based on the weight of the composition.
[0033] The composition of the present invention preferably includes a humectant. A humectant is a compound that helps retain water loss from the composition. The humectant is preferably selected from one or more of glycerin, sorbitol, saccharide isomers, 1,2-hexanediol, 2,3-butylene glycol, panthenol, pentylene glycol, propylene glycol, polyglyceryl laurate, sodium PCA, lactic acid, sodium lactate, potassium lactate, acetamide MEA, hydroxyethyl urea, sodium hyaluronate, or hydrolyzed hyaluronic acid.
[0034] Preferably, the composition further comprises one or more skin lightening agents. These agents may be selected from niacinamide, pyridinamide, isonicotinamide, resorcinol, phenylethylresorcinol, 4-alkylresorcinol, vitamin B6, vitamin C, vitamin A, glutathione precursors, galadin, adapalene, ammonium lactate, arbutin, butylated hydroxyanisole, butylated hydroxytoluene, citrate, deoxyarbutin, 1,3-diphenylpropane derivatives, 2,5-dihydroxybenzoic acid and its derivatives, 2-(4-acetoxyphenyl)-1,3-dithiane, 2-(4-hydroxyphenyl)-1,3-dithiane, ellagic acid, glucopyranosyl-1-ascorbate, gluconic acid, glycolic acid, 4-hydroxy-5-methyl-3[2H]-furanone, 4-hydroxyanisole and its derivatives. 4-Hydroxybenzoic acid derivatives, hydroxyoctanoic acid, inositol ascorbate, lactic acid, linoleic acid, magnesium ascorbyl phosphate, 5-octanoylsalicylic acid, salicylic acid, 3,4,5-trihydroxybenzyl derivatives, acetylglucosamine, Symwhite, calcium pantothenate (Melano-block), Seppiwhite, 12-hydroxystearic acid, and mixtures thereof. More preferred skin lightening agents for use in the composition include niacinamide, pyridinamide, isonicotinamide, 12-hydroxystearic acid, resorcinol, phenethylresorcinol, 4-alkylresorcinol, conjugated linoleic acid (CLA), or galadin. More preferred skin lightening agents are selected from niacinamide, CLA, and 4-alkylresorcinol, and mixtures thereof. Examples of 4-alkyl-substituted resorcinols include 4-methylresorcinol, 4-ethylresorcinol (ER), 4-propylresorcinol (IPR), 4-butylresorcinol (BR), 4-pentylresorcinol (HR), 4-heptylresorcinol, 4-octylresorcinol, and mixtures thereof. Preferred 4-alkyl-substituted resorcinols are ER, BR, HR, and mixtures thereof. More preferred 4-alkyl-substituted resorcinols are ER, HR, and mixtures thereof. The alkyl group in the 4-alkyl-substituted resorcinol can be either a linear or branched chain. For example, the alkyl group can be a linear chain, such as 4-propylresorcinol, or a branched chain, such as 4-isopropylresorcinol (IPR). Preferably, the composition comprises 0.1 to 5% by weight, more preferably 0.1 to 3% by weight, and even more preferably 0.1 to 1% by weight of the skin lightening agent.
[0035] The composition may additionally comprise a sunscreen, such as an inorganic sunscreen, for example zinc oxide, titanium dioxide, iron oxide and silicon dioxide, for example fumed silica. Such sunscreens are preferably added in an amount of 0.1 to 5 wt % based on the total weight of the sunscreen composition.
[0036] The composition of the present invention may comprise an organic UV-A sunscreen selected from dibenzoylmethane derivatives, triazine derivatives, benzophenone derivatives and mixtures thereof. In a preferred embodiment, the UV-A sunscreen comprises or is a dibenzoylmethane derivative, such as butyl methoxydibenzoylmethane (sold under the trade name Parsol 1789).
[0037] Typically, the compositions of the present invention may comprise from 0.1 to 15 wt% UV-A sunscreen, based on the total weight of the composition, more preferably from 0.1 to 10%, most preferably from 1 to 5%, and including all ranges subsumed therein.
[0038] The composition of the present invention may also include an organic UV-B sunscreen. Suitable UV-B sunscreens may be selected from benzophenones, anthranilates, salicylates, cinnamates, camphor, benzalmalonates, triazines, and derivatives thereof. In a preferred embodiment, the organic UV-B sunscreen comprises or is a cinnamate derivative, such as ethylhexyl methoxycinnamate (sold under the trade name Parsol MCX).
[0039] Typically, the composition comprises from 0.1 to 20 wt% UV-B sunscreen, more preferably from 0.5 to 18%, most preferably from 1 to 15%, based on the total weight of the composition, and including all ranges subsumed therein.
[0040] The compositions of the present invention comprise a cosmetically acceptable carrier. The cosmetically acceptable carrier is preferably in the form of an oil, liquid, stick, cream, lotion, spray, or gel. The cosmetically acceptable carrier preferably includes ingredients such as surfactants, for example, nonionic surfactants, fatty acids, soaps, water, polymers, emollients, solvents, powders, preservatives, or optional ingredients. The various possible ingredients included in the cosmetically acceptable carrier are described in detail below.
[0041] Preferably, the composition comprises a nonionic surfactant. More preferably, the nonionic surfactant is selected from those having an HLB value of 9 to 20, preferably 10 to 19, more preferably 12 to 18, even more preferably 13 to 17, yet more preferably 15 to 17.
[0042] HLB is calculated using the Griffin method, where HLB = 20 x Mh / M, where Mh is the molecular weight of the hydrophilic portion of the molecule and M is the molecular weight of the entire molecule, with the result being anywhere in the range of 0 to 20.
[0043] Preferably, the nonionic surfactant having an HLB value in the range of 9 to 20 is selected from the group consisting of fatty alcohol ethoxylates, alkylphenol ethoxylates, polyoxyethylene sorbitan alkyl esters and mixtures thereof. Preferably, the nonionic surfactant is one having at least 9 oxyalkylene groups, preferably at least 9 oxyethylene groups.
[0044] Examples of fatty alcohol ethoxylates that can be used as nonionic surfactants in the composition include polyoxyethylene lauryl ether (HLB = 16.9; 35 commercially available), polyoxyethylene (20) cetyl ether (HLB = 16; can be 58 commercially available), polyethylene glycol octadecyl ether (HLB = 18.8; can be 700 commercially available) and Laureth-9 (C12EO9; HLB = 14.3; can L9 was purchased commercially).
[0045] Examples of alkylphenol ethoxylates that can be used as nonionic surfactants in the composition include octylphenol ethoxylate (HLB = 15.5; Triton TM X165 is commercially available), octylphenol ethoxylate (HLB = 17.6; Triton TM X405 commercially available) and octylphenol ethoxylate (HLB = 18.4; available from Triton TM X705 was purchased commercially).
[0046] Examples of polyoxyethylene sorbitan alkyl esters that can be used as nonionic surfactants in the composition include polyoxyethylene sorbitan monolaurate (HLB = 13.3; can be 21 commercially available), polyoxyethylene sorbitan monolaurate (HLB = 16.7; can be 20 commercially available), polyoxyethylene sorbitan monopalmitate (HLB = 15.6; can be 40 commercially available) and polyoxyethylene sorbitan monostearate (HLB = 14.9; can be 60 was purchased commercially).
[0047] Even more preferably, the nonionic surfactant having an HLB value ranging from 9 to 20 that may be present in the composition is a fatty alcohol ethoxylate with a saturated carbon chain having an HLB higher than 15.5.
[0048] Preferably, the composition comprises from 0.5 to 5 wt%, more preferably from 1 to 4 wt%, even more preferably from 2 to 3 wt% of a nonionic surfactant having an HLB in the range of 9 to 20.
[0049] Preferably, the composition of the present invention is provided in the form of a vanishing cream. Vanishing cream means that when applied and rubbed onto human skin, it disappears on the skin without leaving any obvious traces of the composition. When fatty acids are present in the composition together with soap, a so-called vanishing cream effect is produced. Preferably, the leave-on composition contains fatty acids having 10 to 30, more preferably 12 to 25, even more preferably 14 to 20, and still more preferably 16 to 18 carbon atoms. Examples of fatty acids that can be used in the composition include nonanoic acid, lauric acid, myristic acid, palmitic acid, stearic acid, isostearic acid, oleic acid, linoleic acid, arachidic acid, behenic acid, erucic acid and mixtures thereof. Preferably, the fatty acid that can be used is stearic acid or palmitic acid or a mixture thereof. The fatty acid in the present invention is preferably a mixed acid (hystric acid), which is essentially (usually about 90 to 95%) a mixture of stearic acid and palmitic acid in a ratio of 55:45 to 45:55.
[0050] Preferably, the composition comprises 2 to 25 wt. %, more preferably 6 to 20 wt. %, even more preferably 10 to 18 wt. % fatty acid.
[0051] Preferably, the composition comprises soap. Soap, when present in combination with fatty acids in the composition, provides the aforementioned vanishing effect. Preferably, the soap in the composition is typically prepared by in situ neutralization of any fatty acids present in the composition. Therefore, the carbon chain length of the soap preferably corresponds to the chain length of the fatty acids in the composition. Soap is formed from fatty acids using an alkali metal hydroxide such as sodium hydroxide or potassium hydroxide. Of the two, potassium hydroxide is more preferred. Therefore, the soap is preferably a potassium soap (a potassium salt of a fatty acid).
[0052] Preferably, the composition comprises from 0.1 to 10%, more preferably from 0.5 to 7%, even more preferably from 0.5 to 3% soap by weight of the composition.
[0053] Preferably, the composition comprises water in an amount of 5 to 99.9 wt%, more preferably 10 to 95 wt%, even more preferably 15 to 90 wt%, further more preferably 20 to 80 wt%, still more preferably 25 to 75 wt%, yet more preferably 30 to 70 wt%.
[0054] Preferably, the composition comprises a polymer, which acts as a thickener in the composition and improves the sensory properties of the composition.
[0055] The polymer is preferably selected from the following classes:
[0056] - Acrylates / R-methacrylate copolymers, such as acrylates / stearyl methacrylate copolymer (available from Aculyn TM22 commercially available) and acrylates / beheneth-25 methacrylate copolymer (available from Aculyn TM 28 commercially available),
[0057] - Acrylates / R-methacrylate crosspolymer, such as Acrylates / Steareth-20 Methacrylate Crosspolymer (available from Aculyn TM 88 commercially available),
[0058] - Acrylates copolymer (Aculyn TM 33 commercially available),
[0059] - Acrylates / R-alkyl acrylate crosspolymer, such as acrylates / C10-C30 alkyl acrylate crosspolymer (available from Pemulen TM TR-2 is commercially available),
[0060] - copolymer of ammonium acryloyldimethyltaurate and vinylpyrrolidone (can be AVC was purchased commercially),
[0061] - copolymer of sodium acryloyldimethyl taurate and vinyl pyrrolidone (can be AVS is commercially available); and
[0062] - Acryloyldimethyltaurate crosspolymer with R-alkyl acrylate and methacrylate such as ammonium acryloyldimethyltaurate / beheneth-25 methacrylate crosspolymer (can HMB and BLV was purchased commercially).
[0063] Preferably, the composition comprises from 0.1 to 5 wt %, more preferably from 0.5 to 4 wt %, still more preferably from 0.75 to 2.75 wt % polymer.
[0064] Preferably, the composition comprises an emollient. Examples of emollients that can be used in leave-on compositions include stearyl alcohol, glyceryl monoricinoleate, mink oil, isopropyl isostearate, isobutyl palmitate, isocetyl stearate, oleyl alcohol, isopropyl laurate, hexyl laurate, decyl oleate, 10ummarized-2-ol, isocetyl alcohol, eicosanol, behenyl alcohol, cetyl palmitate, silicone oils (e.g., dimethicone), dibutyl sebacate, isopropyl myristate, isopropyl palmitate, isopropyl stearate, butyl stearate, polyethylene glycol, triethylene glycol, lanolin, cocoa butter, corn oil, cottonseed oil, olive oil, palm kernel oil, rapeseed oil, safflower seed oil, evening primrose oil, soybean oil, sunflower seed oil, avocado oil, sesame oil, and coconut oil. Peanut oil, castor oil, acetylated lanolin alcohol, petrolatum, mineral oil, butyl myristate, isopropyl linoleate, lauryl lactate, myristyl lactate, decyl oleate, myristyl myristate, and mixtures thereof.
[0065] Preferably, the composition comprises a solvent. Examples of solvents that can be used in the composition include ethanol, isopropyl alcohol, acetone, ethylene glycol monoethyl ether, diethylene glycol monobutyl ether, diethylene glycol monoethyl ether, and mixtures thereof.
[0066] Preferably, the composition comprises a powder. Examples of powders that can be used in the composition include chalk, talc, Fuller's earth, kaolin, starch, gums, colloidal silica, sodium polyacrylate, tetraalkyl and / or trialkylaryl ammonium montmorillonite, chemically modified magnesium aluminum silicate, organically modified montmorillonite clay, hydrated aluminum silicate, fumed silica, carboxyvinyl polymers, sodium carboxymethylcellulose, ethylene glycol monostearate, and mixtures thereof.
[0067] Preferably, the composition contains a preservative to prevent the growth of potentially harmful microorganisms. Examples of ingredients that can be used as preservatives include alkyl parahydroxybenzoates, hydantoin derivatives, propionates, and various quaternary ammonium compounds. More preferably, ingredients that can be used as preservatives include sodium benzoate, iodopropynyl butylcarbamate, methylisothiazolinone, iodopropynyl butylcarbamate, phenoxyethanol, methylparaben, propylparaben, imidazolidinyl urea, sodium dehydroacetate, ethylhexylglycerin, benzyl alcohol, alkanediols, and mixtures thereof. Alkanediols suitable for use as preservatives are C6-C8 substituted ortho-hydroxy groups. 12 Illustrative examples include 1,2-octanediol (octanediol), 2,3-octanediol, 1,2-nonanediol, 1,2-decanediol, 1,2-hexanediol, 3,4-octanediol, mixtures thereof, and the like, with octanediol generally being most preferred.
[0068] When present in the composition, the preservative is preferably added in an amount of 0.001 to 5% by weight, more preferably 0.01 to 3% by weight, most preferably 0.02 to 2% by weight, even most preferably 0.25 to 1.5%.
[0069] Preferably, the composition comprises a range of other optional ingredients including antioxidants, binders, buffers, colorants, astringents, fragrances, sunscreens, conditioners, exfoliants, pH adjusters, skin sensates, skin soothing agents and skin healing agents.
[0070] The present invention also relates to a method of imparting anti-aging benefits to the skin, the method comprising applying a composition of the present invention to the desired skin surface. The method is preferably non-therapeutic / cosmetic.
[0071] The invention will now be illustrated with the aid of the following non-limiting examples.
[0072] Example
[0073] Combination of arginine with dicarboxylic acids or esters demonstrates synergistic improvement in gene expression of type 1 collagen :
[0074] Experiments were conducted to study the gene expression of type 1 collagen using the active substances listed in Table 1, alone and in combination, and the data were compiled. The method for measuring gene expression was as follows:
[0075] WS1 cells (human dermal fibroblasts) were cultured in high-glucose DMEM (HIMEDIA product catalog number AL219A) supplemented with 0.03 mM calcium chloride, 1 mM sodium pyruvate, and 10% FBS (fetal bovine serum) in an incubator at 37°C and 5% carbon dioxide. 。 Cells at 80% confluence were trypsinized and seeded in 24-well plates at a density of 50,000 cells / well. Cells were incubated at 37°C with 5% carbon dioxide for 24 hours. Following incubation, cells were treated with arginine (0.005%) and various concentrations of pimelic acid, dimethyl pimelate, suberic acid, and azelaic acid (0.0001, 0.001, and 0.005%). Treatments were performed using the individual components and corresponding combinations listed in Table 1. Cells were harvested 24 hours after treatment for RNA extraction.
[0076] RNA was extracted using the Qiagen RNA Extraction Kit (Cat. No. 74004) according to the kit instructions. After RNA extraction, cDNA was synthesized using the iscript cDNA Synthesis Kit (Biorad Cat. No. 1708890). 1 g of RNA was used for cDNA synthesis. The synthesized cDNA template was used for gene expression studies.
[0077] Collagen gene expression was quantified using real-time PCR. Reactions were performed using 2.5 ml of cDNA. The PCR reaction mixture contained 1 ml each of forward and reverse primers and 5 ml of PCR master mix (Sigma catalog number: KCQS00). Amplification was performed at 95°C for 30 seconds as a first step, followed by 40 cycles of qRT-PCR at 95°C for 5 seconds and 60°C for 20 seconds. mRNA expression levels were determined in triplicate and normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) expression levels. Relative quantification was performed using the delta delta Ct method. The primers used in this study were the COL1A1 forward primer (5'–GATTCCCTGGACCTAAAGGTGC–3'), the COL1A1 reverse primer (5'–AGCCTCTCCATCTTTGCCAGCA–3'), and the GAPDH forward primer (5'–TGACTTCAACAGCGACACCCA–3'), and the reverse primer (5'–CACCCTGTTGCTGTAGCCAAA–3'). Relative quantitative analysis of gene expression was normalized using the housekeeping gene (GAPDH) and compared with untreated controls.
[0078] The gene expression fold changes obtained from cells treated with the combination of test active substances were compared to the gene expression obtained from cells treated with the single ingredients. Table 1 presents the collagen gene expression values obtained after treatment with the test active substances alone and in combination.
[0079] Table 1
[0080]
[0081] The data in Table 1 above demonstrate that the combination of arginine and selected dicarboxylic acids or esters imparts synergistically improved gene expression of type 1 collagen, which is considered an indicator of anti-aging benefits for the skin.
[0082] The combination of lysine with dicarboxylic acids or esters did not show any significant effect on the gene expression of type 1 collagen. improve :
[0083] Experiments were conducted to study the gene expression of type 1 collagen using the amino acid lysine and dicarboxylic acids or esters shown in Table 2, alone or in combination, and the data were compiled. The method used to measure gene expression was the same as before.
[0084] Table 2
[0085] Example Active substance (wt%) Gene expression (type 1 collagen) comparison – 1.0 F 0.005 lysine 0.8 G1 0.0001 pimelic acid 1.1 G2 0.001 pimelic acid 2.4 G3 0.005 pimelic acid 3.0 H1 0.0001 dimethyl pimelate 1.2 H 0.001 dimethyl pimelate 2.4 H3 0.005 dimethyl pimelate 3.7 J1 0.0001 suberic acid 1.7 J2 0.001 suberic acid 2.8 J3 0.005 suberic acid 1.4 K1 0.0001 Azelaic acid 1.3 K2 0.001 Azelaic acid 1.6 K3 0.005 Azelaic acid 2.0 G4 0.005 lysine + 0.0001 pimelic acid 1.5 G5 0.005 lysine + 0.001 pimelic acid 1.2 G6 0.005 lysine + 0.005 pimelic acid 1.6 H4 0.005 lysine + 0.0001 dimethyl pimelate 1.3 H5 0.005 lysine + 0.001 dimethyl pimelate 1.1 H6 0.005 lysine + 0.005 dimethyl pimelate 1.6 J4 0.005 lysine + 0.0001 suberic acid 2.5 J5 0.005 lysine + 0.001 suberic acid 1.0 J6 0.005 lysine + 0.005 suberic acid 0.9 K4 0.005 lysine + 0.0001 azelaic acid 0.8 K5 0.005 lysine + 0.001 azelaic acid 1.0 K6 0.005 lysine + 0.005 azelaic acid 0.7
[0086] The data in Table 2 above indicate that the combination of lysine with dicarboxylic acids or esters does not confer any significant anti-aging benefits compared to the combination with arginine.
[0087] Additional experiments were performed as shown in Table 3 below, and type 1 collagen gene expression was assessed as previously described.
[0088] Table 3
[0089]
[0090] It should be understood that the above experiments were conducted in vitro to assess gene expression behavior. It is expected that the concentrations actually used to prepare topical compositions will vary greatly. The concentrations may be several orders of magnitude higher for the following reasons, which affect the difference between bulk concentrations and cellular level concentrations. The compositions can be formulated as emulsions or gels and a variety of additional ingredients can be added. The concentrations of the desired active substances in the oil phase and the aqueous phase are expected to vary greatly. They may also have very different physical and fluid dynamic properties, such as partition coefficients, diffusion rates, convective transport rates, rheological properties, etc. Therefore, it is expected that the concentrations used when formulating the compositions will be very different from the concentrations at the cellular level (i.e., the concentrations at the time of the experiments), typically several orders of magnitude higher.
Claims
1. A personal care composition comprising (i) arginine, and (ii) a C7 to C9 dicarboxylic acid or an ester thereof; and (iii) a cosmetically acceptable carrier; wherein the weight ratio of arginine to the dicarboxylic acid or its ester is in the range of 50:1 to 1:1; and The composition does not contain arginine and dimethyl pimelate in a weight ratio of 1:
1.
2. The composition according to claim 1, wherein the dicarboxylic acid or ester thereof is selected from one or more of pimelic acid, dimethyl pimelate, suberic acid and azelaic acid.
3. The composition of claim 2, wherein the dicarboxylic acid or ester thereof is pimelic acid.
4. The composition according to claim 1, comprising 0.1 to 5.0% by weight of arginine.
5. The composition according to claim 1, comprising 0.05 to 1.5% by weight of the dicarboxylic acid or its ester.
6. The composition according to any one of the preceding claims, wherein the weight ratio of arginine to the dicarboxylic acid or ester thereof is in the range of 25:1 to 1:
1.
7. The composition according to any one of the preceding claims, wherein the weight ratio of arginine to the dicarboxylic acid or ester thereof is in the range of 5:1 to 1:
1.
8. The composition according to any one of the preceding claims, wherein the weight ratio of arginine to the dicarboxylic acid or ester thereof is in the range of 4:1 to 1:
1.
9. The composition according to any one of the preceding claims, wherein the weight ratio of arginine to the dicarboxylic acid or ester thereof is in the range of 2:1 to 1:
1.
10. A method of imparting anti-aging benefits to the skin, said method comprising the step of applying a composition according to any one of the preceding claims to the desired skin surface.