Method suitable for high-efficiency expression of Trx1 and Trx2 recombinant proteins

By extracting RNA from Cherry Valley duck liver tissue and constructing the pET-28a recombinant plasmid, Trx1 and Trx2 recombinant proteins were expressed and purified, which solved the problem of low expression efficiency in the existing technology and obtained highly active and high-purity recombinant proteins, supporting in-depth research on the functions and regulatory mechanisms of Trx isomers.

CN120665828APending Publication Date: 2025-09-19SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510809510.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-17
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently express highly active and pure Trx1 and Trx2 recombinant proteins, which limits in-depth research on the functions and regulatory mechanisms of these two thioredoxin isoforms.

Method used

By extracting total RNA from the liver tissue of Cherry Valley ducks, Trx1 and Trx2 genes were amplified using PCR technology, and the pET-28a recombinant plasmid was constructed. The plasmid was transformed into Escherichia coli for prokaryotic expression. The induction conditions were adjusted, and the recombinant protein was purified by combining Ni2+-NTA affinity column and SephadexG-25 desalting column.

Benefits of technology

The efficient expression of highly active and pure Trx1 and Trx2 recombinant proteins was achieved, laying the foundation for studying their application in oxidative stress diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665828A_ABST
    Figure CN120665828A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to a method suitable for efficiently expressing Trx1 and Trx2 recombinant proteins. The method comprises the following steps: extracting RNA (Ribonucleic Acid) from a cherry valley duck brain tissue, successfully obtaining Trx1 and Trx2 genes through a reverse transcription amplification technology, connecting the target genes Trx1 and Trx2 genes with a pET-28a vector through a designed homologous recombination method, constructing pET-28a-Trx1 and pET-28a-Trx2 recombinant plasmids, then transforming the recombinant plasmids into competent escherichia coli for prokaryotic expression, and only adjusting induction conditions, so as to obtain the recombinant plasmids of the pET-28a-Trx1 and pET-28a-Trx2, thereby obtaining the recombinant plasmids of the pET-28a-Trx1 and pET-28a-Trx2. The recombinant protein rd-Trx1 and the recombinant protein rd-Trx2 which are high in activity and high in purification and have disulfide bond reductase activity can be obtained, and an important experimental basis is provided for deeply analyzing an antioxidant mechanism of the thioredoxin of the cherry valley duck.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method suitable for efficiently expressing Trx1 and Trx2 recombinant proteins. Background Art

[0002] Thioredoxins (Trx) are a class of small proteins widely found in organisms, with diverse biological functions. In mammalian cells, there are two major Trx isoforms: cytosolic Trx1 and mitochondrial Trx2. Trx1 is primarily localized in the cytoplasm but can translocate to the nucleus and be secreted extracellularly under specific conditions. Trx2, on the other hand, is primarily localized in the mitochondria. Both Trx proteins contain the active site -Cys-Gly-Pro-Cys-, a hallmark of the thioredoxin family, and share the typical Trx fold.

[0003] Trx plays a crucial role in oxidative stress-induced apoptosis through the ASK1-Trx-TXNIP signaling pathway. Under oxidative stress, hydrogen peroxide (H2O2) oxidizes Trx1, promoting its dissociation from apoptosis signal-regulating kinase 1 (ASK1), leading to activation of downstream signaling pathways of ASK1 and inducing apoptosis. TXNIP, an endogenous inhibitor of Trx, can undergo disulfide exchange with the active site of Trx, leading to Trx1 oxidation and the release of ASK1.

[0004] Trx1 and Trx2 perform distinct functions within cells, forming a complex redox regulatory network. This network is crucial for maintaining intracellular redox homeostasis and regulating apoptosis. Therefore, it is necessary to experimentally investigate the antioxidant mechanisms of thioredoxin using thioredoxin.

[0005] However, since Trx1 is mainly located in the cytoplasm and Trx2 is mainly located in the mitochondria, and their gene sequences are different, different genetic technologies need to be used to express Trx1 recombinant protein and Trx2 recombinant protein respectively. Since different methods need to be used to express Trx1 recombinant protein and Trx2 recombinant protein, otherwise the activity and purity of Trx1 recombinant protein and Trx2 recombinant protein are low, this limitation restricts in-depth research on the function and regulatory mechanism of Trx isomers. Summary of the Invention

[0006] The purpose of the present invention is to avoid the shortcomings of the prior art and provide a method suitable for the efficient expression of Trx1 and Trx2 recombinant proteins. This method can simultaneously and efficiently express Trx1 and Trx2 recombinant proteins, and the resulting recombinant proteins have the advantages of high activity and high purity, laying the foundation for subsequent research on the application of Trx1 and Trx2 in the in vitro treatment of oxidative stress diseases.

[0007] To achieve the above objectives, the present invention provides the following technical solutions:

[0008] A method for efficiently expressing Trx1 and Trx2 recombinant proteins is provided, comprising the following steps:

[0009] Step 1: extract total RNA from liver tissue of Cherry Valley duck and reverse transcribe to obtain cDNA;

[0010] Primers were designed based on the sequences of the thioredoxin genes Trx1 and Trx2 and the restriction enzyme cleavage sites of the expression vector. The primers included:

[0011] Trx1-F: 5′TGCCGCGCGGCAGCCATATGGTGAAGAGCGTGG 3′,

[0012] Trx1-R: 5′GCGGCCGCAAGCTTGTCGACTTAGACTAGACTTTTAATGGTCTC 3′,

[0013] Trx2-F: 5′TGCCGCGCGGCAGCCATATGGCGCAGAGGTTGGC 3′,

[0014] Trx2-R: 5′TGTCGACGGAGCTCGAATTCTCAGGCTCCGATGAGTTTCTTG 3′;

[0015] Using cDNA as template, primers Trx1-F and Trx1-R were used to amplify Trx1, and primers Trx2-F and Trx2-R were used to amplify Trx2 to obtain the target genes Trx1 and Trx2;

[0016] Step 2: Connect the target gene Trx1 to the pET-28a vector linearized by double enzyme digestion to obtain the Trx1 connection product.

[0017] The target gene Trx2 was connected to the pET-28a vector linearized by double enzyme digestion to obtain the Trx2 ligation product;

[0018] The Trx1 ligation product and the Trx2 ligation product were subjected to the following steps separately:

[0019] The ligation product was transformed into DH5α Escherichia coli competent cells for bacterial amplification. The amplified plasmid was spread on solid LB medium containing 50 mg / L kanamycin and cultured overnight at 37°C. A single colony was picked the next day to obtain the bacterial cell.

[0020] The bacteria were inoculated into liquid LB medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C and 200 rpm in a constant temperature shaker to obtain a bacterial solution; the obtained bacterial solution was subjected to bacterial solution PCR identification, and the correctly identified bacterial solution was sequenced, and the correctly sequenced bacterial solution was collected.

[0021] When the ligation product is a Trx1 ligation product, the bacterial solution contains the pET-28a-Trx1 recombinant plasmid,

[0022] When the ligation product is a Trx2 ligation product, the bacterial solution contains the pET-28a-Trx2 recombinant plasmid;

[0023] Step 3: Prokaryotic expression of Trx1 and Trx2 separately, including the following steps:

[0024] The correctly sequenced bacterial solution was inoculated into liquid LB medium containing 50 mg / L kanamycin at a ratio of 1:100.

[0025] The bacteria were cultured in a constant temperature shaker at 37°C and 200 r / min for expansion.

[0026] The recombinant plasmid was extracted from the expanded culture solution and transformed into BL21 competent cells. The transformed BL21 competent cells were spread on a plate containing kanamycin, and positive colonies that could grow on the plate were selected. The positive colonies were expanded and cultured again. When the OD value of the bacterial solution reached 0. 600nm =0.6-0.8, add IPTG for induction culture,

[0027] Among them, when the bacterial solution contains the pET-28a-Trx1 recombinant plasmid, the induction conditions are IPTG concentration 0.6mmol / L, induction time 6h, and the bacterial solution expressing the recombinant protein rd-Trx1 is obtained;

[0028] When the bacterial solution contained the pET-28a-Trx2 recombinant plasmid, the induction conditions were 0.4 mmol / L IPTG concentration and 6 h induction time, and the bacterial solution expressing the recombinant protein rd-Trx2 was obtained;

[0029] Step 4: The bacterial liquid of rd-Trx1 and the bacterial liquid of rd-Trx2 are subjected to the following purification steps respectively, wherein the purification steps include:

[0030] The bacterial solution expressing the recombinant protein was resuspended in a pre-cooled buffer containing 500 mmol / L NaCl and 20 mmol / L Tris-HCl at pH 7.8, and then disrupted. DNase I at a final concentration of 0.5 U / μL and MgCl2 at a final concentration of 1 mmol / L were added to the disrupted bacterial solution, mixed evenly, and centrifuged at 4°C for 45 min. After centrifugation, the supernatant was added with imidazole at a final concentration of 10 mmol / L and mixed evenly. Impurities were removed by filtration using a 0.45 μm filter membrane, and then Ni was used for filtration. 2 The recombinant protein was purified by an affinity column composed of β-NTA and β-NTA, and the target protein eluted with high concentration of imidazole was desalted through a Sephadex G-25 column to remove the imidazole to obtain the purified recombinant protein.

[0031] In some embodiments, in step 1, total RNA is extracted from the liver tissue of Cherry Valley duck using the Trizol method, and the sequences of the thioredoxin genes Trx1 and Trx2 and the restriction enzyme cleavage sites of the expression vector are obtained from NCBI.

[0032] In some embodiments, in step 2, the target gene is first purified using a gel recovery kit, and then the target gene Trx1 is ligated to the pET-28a vector linearized by double enzyme digestion using a seamless cloning reagent.

[0033] In some embodiments, the target gene is first purified using a gel recovery kit, and then the target gene Trx2 is ligated to the pET-28a vector linearized by double enzyme digestion using a seamless cloning reagent.

[0034] In some embodiments, in step 4, a high-pressure homogenizer is used for crushing, and the crushing times are 2 times.

[0035] The beneficial effects of the method of the present invention suitable for efficiently expressing Trx1 and Trx2 recombinant proteins are as follows:

[0036] The present invention provides a method suitable for efficiently expressing Trx1 and Trx2 recombinant proteins. The method comprises the following steps: extracting total RNA from Cherry Valley duck brain tissue, successfully obtaining Trx1 and Trx2 genes through reverse transcription amplification technology, connecting target genes Trx1 and Trx2 genes with a pET-28a vector through a designed homologous recombination method, constructing pET-28a-Trx1 and pET-28a-Trx2 recombinant plasmids, and subsequently transforming the pET-28a-Trx1 and pET-28a-Trx2 recombinant plasmids into competent Escherichia coli for prokaryotic expression. Only by adjusting induction conditions can highly active and highly purified recombinant proteins rd-Trx1 and rd-Trx2 with disulfide reductase activity be obtained. The same method can be applied to the expression of Trx1 and Trx2 recombinant proteins, thereby providing an important experimental basis for in-depth analysis of the antioxidant mechanism of Cherry Valley duck thioredoxin. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a diagram of the construction and identification of the recombinant plasmids pET-28a vector-rd-Trx1 and pET-28a vector-rd-Trx2 according to an embodiment of the present invention; markings in the diagram: A. target gene amplification and vector linearization (M. DNA Marker molecular weight standard; 1. meat duck Trx1 gene amplification; 2. meat duck Trx2 gene amplification; 3, 5. pET-28a vector; 4. NdeⅠ and SalⅠ enzyme digestion of pET-28a vector; 6. NdeⅠ and EcoRI enzyme digestion of pET-28a vector); B. PCR identification of recombinant plasmid bacterial solution (M. DNA Marker molecular weight standard; 1-5. PCR identification of bacterial solution of rd-Trx1; 6-10. PCR identification of bacterial solution of rd-Trx2).

[0038] Figure 2 This is a diagram for identifying the solubility of recombinant proteins according to an embodiment of the present invention; the following symbols are marked in the diagram: M. Protein Marker; 1. Whole bacterial solution induced by recombinant plasmid pET-28a vector-rd-Trx1; 2. Supernatant obtained by induction of fragmentation by recombinant plasmid pET-28a vector-rd-Trx1; 3. Precipitate obtained by induction of fragmentation by recombinant plasmid pET-28a vector-rd-Trx1; 4. Whole bacterial solution induced by recombinant plasmid pET-28a vector-rd-Trx2; 5. Supernatant obtained by induction of fragmentation by recombinant plasmid pET-28a vector-rd-Trx2; 6. Precipitate obtained by induction of fragmentation by recombinant plasmid pET-28a vector-rd-Trx2.

[0039] Figure 3This is an SDS-PAGE analysis diagram of the induction condition optimization of an embodiment of the present invention; marks in the figure: A. Effect of different IPTG concentrations on recombinant protein expression (M. Protein Marker; 1-5.rd-Trx1 IPTG concentrations 0.2, 0.4, 0.6, 0.8, mmol / L; 6-10.rd-Trx2 IPTG concentrations 0.2, 0.4, 0.6, 0.8, 1 mmol / L); B. Effect of different induction times on recombinant protein expression (M. Protein Marker; 1-4.rd-Trx1 induction time 2, 4, 6, 8h; 5-8.rd-Trx2 induction time 2, 4, 6, 8h).

[0040] Figure 4 This is an SDS-PAGE analysis diagram of the recombinant protein purification according to an embodiment of the present invention; the following are marked in the figure: A. rd-Trx1 protein purification (M. Protein Marker; 1. rd-Trx1 crushed whole bacterial solution; 2. rd-Trx1 flow-through; 3. rd-Trx1 eluate; 4-9. Purified rd-Trx1); B. rd-Trx2 protein purification (M. Protein Marker; 1. rd-Trx2 crushed whole bacterial solution; 2. rd-Trx2 flow-through; 3. rd-Trx2 eluate; 4-7. Purified rd-Trx2)).

[0041] Figure 5 This is a graph analyzing the reducing activities of rd-Trx1 and rd-Trx2 according to an embodiment of the present invention; in the graph, A is the activity of rd-Trx1 protein at different concentrations; and B is the activity of rd-Trx2 protein at different concentrations.

[0042] Figure 6 1 and 2 show the effects of different concentrations of rd-Trx1 on the survival rate of BV-2 cells according to the examples of the present invention.

[0043] Figure 7 1 and 2. The effects of different concentrations of rd-Trx2 on the survival rate of BV-2 cells according to the examples of the present invention are shown in FIG.

[0044] Figure 8 This is the effect of rd-Trx1 pretreatment and copper ion treatment on the CAT activity of BV-2 cells according to the examples of the present invention.

[0045] Figure 9 This is the effect of rd-Trx2 pretreatment and copper ion treatment on the CAT activity of BV-2 cells according to the examples of the present invention.

[0046] Figure 10 This is the effect of rd-Trx2 pretreatment and copper ion treatment on the SOD activity of BV-2 cells according to the examples of the present invention.

[0047] Figure 11This is the effect of rd-Trx2 pretreatment and copper ion treatment on the SOD activity of BV-2 cells according to the examples of the present invention. DETAILED DESCRIPTION

[0048] The preferred embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. Although preferred embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments described herein. Rather, these embodiments are provided to make the present invention more thorough and complete and to fully convey the scope of the present invention to those skilled in the art.

[0049] Example 1

[0050] Thioredoxins (Trx) are key components in regulating cellular redox signaling. They include antioxidant proteins such as Trx1, Trx2, Trx3, TrxR, and TXNIP. Trx proteins possess specific three-dimensional structures and active sites. Trx1 acts as a redox-activating protein in the cytoplasm, protecting proteins from oxidation, while Trx2 scavenges reactive oxygen species (ROS) in the mitochondria. The Trx system plays a role in diverse biological processes and is a crucial factor in redox regulation and antioxidant protection.

[0051] Environmental changes and feed fatty acid oxidation and other factors can cause oxidative stress in Cherry Valley ducks, affecting breeding efficiency and product quality. However, since Trx1 is mainly located in the cytoplasm and Trx2 is mainly located in the mitochondria, and the gene sequences of the two are different, different genetic technologies are needed to express Trx1 recombinant protein and Trx2 recombinant protein respectively. Due to the need to use different methods to express Trx1 recombinant protein and Trx2 recombinant protein, otherwise the activity and purity of Trx1 recombinant protein and Trx2 recombinant protein are low, this limitation restricts the in-depth study of the function and regulatory mechanism of Trx isomers. This limitation restricts the in-depth study of the function and regulatory mechanism of Trx isomers.

[0052] To this end, the present invention obtains Trx1 and Trx2 genes through PCR technology, constructs recombinant plasmids, and induces expression and purifies recombinant Trx1 and Trx2 proteins to study their antioxidant mechanisms and provide a basis for understanding the multiple functions of Trx in organisms, as follows:

[0053] This embodiment discloses a method suitable for efficiently expressing Trx1 and Trx2 recombinant proteins, comprising:

[0054] Acquisition and amplification of target genes

[0055] Total RNA was extracted from the liver tissue of Cherry Valley duck using Trizol method and cDNA was obtained by reverse transcription.

[0056] The Trizol method is a commonly used RNA extraction method based on the Trizol reagent, which can simultaneously extract total RNA (including mRNA, rRNA, and tRNA) from cells or tissues.

[0057] Primers were designed based on the thioredoxin gene sequence published in NCBI (Trx1 Gene ID: 101804092; Trx2 Gene ID 101795580) and the restriction enzyme sites of the expression vector.

[0058] The primers include:

[0059] Trx1-F: 5′TGCCGCGCGGCAGC CATATG GTGAAGAGCGTGG 3′ (the underline indicates the introduced NdeⅠ restriction site),

[0060] Trx1-R: 5′GCGGCCGCAAGCTT GTCGAC TTAGACTAGACTTTTAATGGTCTC 3′ (the underline indicates the introduced SalI restriction site),

[0061] Trx2-F: 5′TGCCGCGCGGCAGC CATATG GCGCAGAGGTTGGC 3′ (the underline indicates the introduced NdeⅠ restriction site),

[0062] Trx2-R: 5′TGTCGACGGAGCTC GAATTC TCAGGCTCCGATGAGTTTCTTG 3′ (underlined is the introduced EcoRI restriction site);

[0063] The above primers were synthesized by Sangon Company. Using cDNA as template, primers Trx1-F and Trx1-R were used to amplify Trx1, and primers Trx2-F and Trx2-R were used to amplify Trx2. The amplified products were identified by 1.2% agarose gel electrophoresis to obtain the target genes Trx1 and Trx2.

[0064] Construction of recombinant plasmids

[0065] The target gene was purified using a gel recovery kit, and the target gene Trx1 was ligated to the double-enzyme linearized pET-28a vector using a seamless cloning reagent to obtain a Trx1 ligation product. The Trx1 ligation product was transformed into DH5α Escherichia coli competent cells. After rejuvenation, solid LB culture medium containing 50 mg / L kanamycin was applied and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin and cultured overnight at 37°C and 200 rpm in a constant temperature shaker. The cultured bacterial liquid was taken for bacterial liquid PCR identification. The identified correct bacterial liquid was sent for sequencing to obtain a bacterial liquid containing the pET-28a-Trx1 recombinant plasmid;

[0066] The target gene was purified using a gel recovery kit, and the target gene Trx2 was ligated to the double-enzyme linearized pET-28a vector using a seamless cloning reagent to obtain a Trx2 ligation product. The Trx2 ligation product was transformed into DH5α Escherichia coli competent cells. After rejuvenation, solid LB culture medium containing 50 mg / L kanamycin was applied and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into liquid LB culture medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C and 200 r / min in a constant temperature shaker. The cultured bacterial liquid was taken for bacterial liquid PCR identification. The correctly identified bacterial liquid was sent for sequencing to obtain a bacterial liquid containing the pET-28a-Trx2 recombinant plasmid.

[0067] Prokaryotic expression of rd-Trx1 and rd-Trx

[0068] The bacterial solution containing the pET-28a-Trx1 recombinant plasmid identified by sequencing was inoculated into liquid LB medium containing 50 mg / L kanamycin at a ratio of 1:100, and cultured in a constant temperature shaker at 37°C and 200 r / min. The recombinant plasmid was extracted and transformed into BL21 competent cells. After plating on the plate, positive colonies were picked and cultured. When the bacterial solution OD600nm = 0.6-0.8, IPTG with a final concentration of 1 mmol / L was added and cultured for 4 hours to obtain the expression protein. rd-Trx1 recombination At the same time, the bacteria were collected by centrifugation, resuspended in buffer (500mmol / L Nacl, 20mmol / L Tris-HCl, pH=7.8) and then ultrasonically disrupted. The cells were centrifuged at 12000r / min and 4℃ for 20min, and the supernatant and precipitate were separated for SDS-PAGE electrophoresis and Coomassie brilliant blue staining for solubility identification.

[0069] The bacterial solution containing the pET-28a-Trx2 recombinant plasmid identified by sequencing was inoculated into liquid LB medium containing 50 mg / L kanamycin at a ratio of 1:100, and the culture was expanded in a constant temperature shaker at 37°C and 200 r / min. The recombinant plasmid was extracted and transformed into BL21 competent cells. After plating on the plate, positive colonies were picked and expanded. When the OD600nm of the bacterial solution was 0.6-0.8, IPTG with a final concentration of 1 mmol / L was added and the culture was continued for 4 h to obtain bacteria expressing the rd-Trx2 recombinant protein. At the same time, the bacteria were collected by centrifugation, resuspended in buffer (500 mmol / L Nacl, 20 mmol / L Tris-HCl, pH = 7.8), and ultrasonically disrupted. The supernatant was separated and subjected to SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining for solubility identification.

[0070] Among them, it was found that by adjusting the induction conditions, the expression of Trx1 recombinant protein and Trx2 recombinant protein could be significantly improved. , The optimal induction conditions for rd-Trx1 were determined to be IPTG concentration of 0.6 mmol / L and induction time of 6 h, and the optimal induction conditions for rd-Trx2 were determined to be IPTG concentration of 0.4 mmol / L and induction time of 6 h.

[0071] Purification of rd-Trx1 and rd-Trx2

[0072] purification rd-Trx1: Following optimal induction conditions for high-volume protein expression, cells expressing the rd-Trx1 recombinant protein were harvested and resuspended in pre-chilled buffer containing 500 mmol / L NaCl and 20 mmol / L Tris-HCl at a pH of 7.8. The cells were disrupted twice using a high-pressure homogenizer at low temperature and high pressure. DNase I at a final concentration of 0.5 U / μL and MgCl₂ at a final concentration of 1 mmol / L were added to the disrupted cells, mixed thoroughly, and centrifuged at 4°C for 45 minutes. After centrifugation (8500 rpm), the supernatant was added with imidazole at a final concentration of 10 mmol / L and mixed thoroughly. Impurities were removed by filtration using a 0.45 μm filter membrane, and the recombinant protein was purified using a Ni₂+-NTA affinity column. The target protein, eluted with the high-concentration imidazole, was desalted using a Sephadex G-25 column to remove the imidazole. Protein concentration was measured using an ultramicrospectrophotometer, and the desalted recombinant protein was stored at -80°C.

[0073] purification rd-Trx2: According to the optimal induction conditions, the protein was expressed in large quantities and the expression rd-Trx2 recombinant protein bodyThe cells were resuspended in a pre-cooled buffer containing 500 mmol / L NaCl and 20 mmol / LTris-HCl at a pH of 7.8. The cells were disrupted twice at low temperature and high pressure using a high-pressure homogenizer. DNase I at a final concentration of 0.5 U / μL and Mgcl2 at a final concentration of 1 mmol / L were added to the disrupted cell fluid, mixed evenly, and centrifuged at 4°C for 45 minutes. After centrifugation (8500 r / min), the supernatant was added with imidazole at a final concentration of 10 mmol / L and mixed evenly. Impurities were removed by filtration using a 0.45 μm filter membrane, and the recombinant protein was purified using a Ni2+-NTA affinity column. The target protein eluted with high-concentration imidazole was passed through a Sephadex G-25 desalting column to remove imidazole. The protein concentration was measured using an ultramicro spectrophotometer, and the desalted recombinant protein was stored at -80°C.

[0074] Effect analysis

[0075] 1. The results of amplification of the above-mentioned target gene and identification of the recombinant plasmid are as follows:

[0076] 1.2% agarose gel electrophoresis showed that the amplified gene size of Trx1 was approximately 355 bp, and the amplified gene size of Trx2 was approximately 439 bp, which was consistent with the expected size. The pET-28a vector was double-digested with restriction endonucleases NdeⅠ, SalⅠ, and EcoRⅠ to linearize it. After the recombinant plasmid was transformed into DH5α Escherichia coli competent cells and cultured, positive bacteria were selected for PCR identification and sent for testing. The sequencing results were consistent with the NCBI reference sequence, such as Figure 1 As shown, it shows that the recombinant plasmids rd-Trx1 and rd-Trx2 were successfully constructed.

[0077] 2. Solubility identification of the rd-Trx1 and rd-Trx2 obtained above was performed, and the results were as follows:

[0078] The recombinant plasmid identified as correct by sequencing was transformed into the expression bacteria BL21 (DE3) and cultured at 37°C and 200 rpm until OD 600mm When the pH value was between 0.6 and 0.8, IPTG was added and expression was induced at 37°C, 200 rpm for 4 h. The bacterial suspension was added to 5× SDS-PAGE loading buffer and denatured in a metal bath at 100°C. SDS-PAGE electrophoresis was performed to initially identify the presence of bands. Analysis by 12.5% ​​SDS-PAGE revealed that both Trx1 and Trx2 genes were expressed in the supernatant, indicating that both proteins were expressed as soluble proteins.

[0079] 3. Optimization of induction conditions

[0080] The optimal induction conditions were explored at 37°C and 200 rpm, including IPTG concentrations (0.2, 0.4, 0.6, 0.8, and 1 mmol / L) and induction times (2, 4, 6, and 8 h). The bacterial cultures before and after induction were centrifuged and ultrasonically disrupted, and the supernatants were centrifuged and subjected to SDS-PAGE electrophoresis. The results were as follows: Figure 3 As shown, the optimal induction conditions for rd-Trx1 were determined to be 0.6 mmol / L IPTG concentration and 6 h induction time, and the optimal induction conditions for rd-Trx2 were determined to be 0.4 mmol / L IPTG concentration and 6 h induction time.

[0081] IV. Recombinant Protein Purification

[0082] After purification with nickel column, the relative molecular mass of expressed rd-Trx1 was about 14kDa, and the relative molecular mass of expressed rd-Trx2 was about 16kDa. Figure 4 The concentrations of rd-Trx1 and rd-Trx2 recombinant proteins can reach about 3 mg / mL and 1 mg / mL, respectively. It can be seen that high-purity Trx1 and Trx2 recombinant proteins can be obtained.

[0083] 5. Identification of in vitro activity of recombinant proteins

[0084] Purified rd-Trx1 and rd-Trx2 were assayed for activity: the proteins were diluted with buffer to final concentrations of 0, 2.5, 5.0, and 10 μmol / L, respectively. To 100 μL of the protein solution, 10 μL of 20 mmol / L DTT (dithiothreitol) was added and mixed. After preheating at 37°C for 15 minutes, 500 μL of the bovine insulin reaction solution was added and mixed. The absorbance at OD650 nm was measured at room temperature (25°C), with readings taken every 1 minute for a total of 60 minutes.

[0085] The bovine insulin molecule consists of two polypeptide chains (chain A and chain B) connected by two disulfide bonds to form its three-dimensional structure. Under the action of the strong reducing agent DTT, rd-Trx1 and rd-Trx2 can be reduced and the disulfide bond between the insulin AB chains is broken to form free chains A and B. The absorbance of the B chain at OD650nm is stronger. The results are as follows Figure 5 shown. Figure 5 The results showed that the purified rd-Trx1 and rd-Trx2 had disulfide bond reducing activity, and their activity increased with increasing protein concentration.

[0086] VI. Verification of Antioxidant Activity in Vitro

[0087] like Figure 6-7As shown in the results, purified recombinant rd-Trx1 and rd-Trx2 at different concentrations were used to act on BV-2 mouse glioma cells, and the cell survival efficiency was detected by CCK-8 method. It was found that rd-Trx1 and rd-Trx2 had no damaging effect on the cells, and 5μM rd-Trx1 and 2.5μM rd-Trx2 had a significant growth-promoting effect on the cells, and the growth-promoting effect increased with increasing concentration.

[0088] like Figures 8-11 As shown, by using 400 μM copper ions (Cu 2+ ) induced oxidative damage model of cells, and analyzed the changes in oxidative stress levels of cells after Trx1 pretreatment or Trx2 pretreatment for 3 hours, using superoxide dismutase (SOD) and catalase (CAT) kits to determine the changes in oxidative stress levels of cells. The results showed that the activities of antioxidant enzymes SOD and CAT in cells pretreated with Trx1 and Trx2 were significantly higher than those in cells pretreated with Cu 2+ The treated group can effectively resist in vitro Cu 2+ Induced cellular oxidative damage.

[0089] In summary, the recombinant proteins of Trx1 and Trx2 obtained in this example have strong activity.

[0090] It can be seen that the present invention successfully constructed a prokaryotic expression system of Cherry Valley duck thioredoxin and obtained recombinant thioredoxin with efficient disulfide reductase activity, laying the foundation for subsequent research on its application in the in vitro treatment of oxidative stress diseases.

[0091] In addition, it should be noted that the use of terms such as "first" and "second" to limit components is only for the convenience of distinguishing the corresponding components. Unless otherwise stated, the above terms have no special meaning and therefore cannot be understood as limiting the scope of protection of this application.

[0092] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A method suitable for efficiently expressing Trx1 and Trx2 recombinant proteins, characterized in that: The following steps are involved: Step 1: extract total RNA from liver tissue of Cherry Valley duck and reverse transcribe to obtain cDNA; Primers were designed based on the sequences of the thioredoxin genes Trx1 and Trx2 and the restriction enzyme cleavage sites of the expression vector. The primers included: Trx1-F: 5′TGCCGCGCGGCAGCCATATGGTGAAGAGCGTGG 3′, Trx1-R: 5′GCGGCCGCAAGCTTGTCGACTTAGACTAGACTTTTAATGGTCTC 3′, Trx2-F: 5′TGCCGCGCGGCAGCCATATGGCGCAGAGGTTGGC 3′, Trx2-R: 5′TGTCGACGGAGCTCGAATTCTCAGGCTCCGATGAGTTTCTTG 3′; Using cDNA as template, primers Trx1-F and Trx1-R were used to amplify Trx1, and primers Trx2-F and Trx2-R were used to amplify Trx2 to obtain the target genes Trx1 and Trx2; Step 2: Connect the target gene Trx1 to the pET-28a vector linearized by double enzyme digestion to obtain the Trx1 connection product. The target gene Trx2 was connected to the pET-28a vector linearized by double enzyme digestion to obtain the Trx2 ligation product; The Trx1 ligation product and the Trx2 ligation product were subjected to the following steps separately: The ligation product was transformed into DH5α Escherichia coli competent cells for bacterial amplification. The amplified plasmid was spread on solid LB medium containing 50 mg / L kanamycin and cultured overnight at 37°C. A single colony was picked the next day to obtain the bacterial cell. The bacteria were inoculated into liquid LB medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C and 200 rpm in a constant temperature shaker to obtain a bacterial solution; the obtained bacterial solution was subjected to bacterial solution PCR identification, and the correctly identified bacterial solution was sequenced, and the correctly sequenced bacterial solution was collected. When the ligation product is a Trx1 ligation product, the bacterial solution contains the pET-28a-Trx1 recombinant plasmid, When the ligation product is a Trx2 ligation product, the bacterial solution contains the pET-28a-Trx2 recombinant plasmid; Step 3: Prokaryotic expression of Trx1 and Trx2 separately, including the following steps: The correctly sequenced bacterial solution was inoculated into liquid LB medium containing 50 mg / L kanamycin at a ratio of 1:

100. The bacteria were cultured in a constant temperature shaker at 37°C and 200 r / min for expansion. The recombinant plasmid was extracted from the expanded culture solution and transformed into BL21 competent cells. The transformed BL21 competent cells were spread on a plate containing kanamycin, and positive colonies that could grow on the plate were selected. The positive colonies were expanded and cultured again. When the OD value of the bacterial solution reached 0. 600nm =0.6-0.8, add IPTG for induction culture, Among them, when the bacterial solution contains the pET-28a-Trx1 recombinant plasmid, the induction conditions are IPTG concentration 0.6mmol / L, induction time 6h, and the bacterial solution expressing the recombinant protein rd-Trx1 is obtained; When the bacterial solution contained the pET-28a-Trx2 recombinant plasmid, the induction conditions were 0.4 mmol / L IPTG concentration and 6 h induction time, and the bacterial solution expressing the recombinant protein rd-Trx2 was obtained; Step 4: The bacterial liquid of rd-Trx1 and the bacterial liquid of rd-Trx2 are subjected to the following purification steps respectively, wherein the purification steps include: The bacterial solution expressing the recombinant protein was resuspended in a pre-cooled buffer containing 500 mmol / L NaCl and 20 mmol / L Tris-HCl at pH 7.8, and then disrupted. DNase I at a final concentration of 0.5 U / μL and MgCl2 at a final concentration of 1 mmol / L were added to the disrupted bacterial solution, mixed evenly, and centrifuged at 4°C for 45 min. After centrifugation, the supernatant was added with imidazole at a final concentration of 10 mmol / L and mixed evenly. Impurities were removed by filtration using a 0.45 μm filter membrane, and then Ni was used for filtration. 2 The recombinant protein was purified by an affinity column composed of β-NTA and β-NTA, and the target protein eluted with high concentration of imidazole was desalted through a Sephadex G-25 column to remove the imidazole to obtain the purified recombinant protein.

2. The method for efficiently expressing Trx1 and Trx2 recombinant proteins according to claim 1, characterized in that: In step 1, total RNA was extracted from the liver tissue of Cherry Valley duck using the Trizol method, and the sequences of the thioredoxin genes Trx1 and Trx2 and the restriction enzyme cleavage sites of the expression vector were obtained from NCBI.

3. The method for efficiently expressing Trx1 and Trx2 recombinant proteins according to claim 1, characterized in that: In step 2, the target gene was first purified using a gel recovery kit, and then the target gene Trx1 was connected to the pET-28a vector linearized by double enzyme digestion using a seamless cloning reagent.

4. The method for efficiently expressing Trx1 and Trx2 recombinant proteins according to claim 1, characterized in that: In step 2, the target gene was first purified using a gel recovery kit, and then the target gene Trx2 was connected to the pET-28a vector linearized by double enzyme digestion using a seamless cloning reagent.

5. The method for efficiently expressing Trx1 and Trx2 recombinant proteins according to claim 1, characterized in that: In step 4, a high-pressure homogenizer is used for crushing, and the crushing times are 2 times.

Citation Information

Patent Citations

  • Polypeptide of fungal thioredoxin, coding sequence, preparation and use

    CN101497886A

  • Preparation method of recombinant human thioredoxin

    CN102586201A

  • Methicillin-resistant staphylococcus aureus (MRSA) PBP2a transpeptidase region prokaryotic expression and purification method

    CN104404010A

  • Trachinotus ovatus thioredoxin gene

    CN104480125A

  • Solution-promoting expression tag and application thereof

    CN119286898A