Preparation method of 3-hydroxybutyrin

Abstract

The invention discloses a construction method of a 3-hydroxybutyric acid producing strain, which comprises the following steps: (1) taking escherichia coli W3110 as an original strain, and knocking out yrhD and hns genes in the escherichia coli W3110 to obtain a strain W3110-delta yrhD-delta hns; and (2) transferring recombinant plasmids for expressing TesB, atoB and AAR into the strain W3110-[delta] yrhD-[delta] hns, so as to obtain the 3-hydroxybutyric acid producing strain. The invention also discloses a preparation method of the 3-hydroxybutyrin. The 3-hydroxybutyrin is prepared from 3-hydroxybutyric acid obtained by fermentation of the production strain constructed by the invention and glycerol under catalysis of lipase. According to the method, the 3-hydroxybutyric acid is synthesized by a biological method, then the glyceride 3-hydroxybutyrate is obtained through catalysis of the lipase, and the method is safe, environmentally friendly, free of pollution, simple in process, low in cost and capable of being used for industrial large-scale production.

Description

Technical Field

[0001] The invention belongs to the technical field of biosynthesis, and in particular relates to a method for preparing 3-hydroxybutyric acid glyceride. Background Art

[0002] 3-Hydroxybutyrin has a wide range of uses in the healthcare, pharmaceutical and food sectors. 3-Hydroxybutyrin can be used in diets with specific nutritional needs, such as the ketogenic diet. The ketogenic diet is a nutritional approach consisting of a high fat content and a low carbohydrate content, designed to induce ketosis or the production of ketone bodies. This type of diet has been used to treat various diseases, such as epilepsy. In addition, 3-Hydroxybutyrin can be used to prevent and treat diseases of energy metabolism in humans or animals, especially those related to ketone body metabolism disorders. It can also be used for migraine management and traumatic brain injury, as well as in the treatment of cardiovascular diseases, neurodegenerative diseases, fat metabolism diseases and mitochondrial diseases, rheumatic diseases, gastrointestinal diseases and other diseases. 3-Hydroxybutyrin is also widely used in food supplements, functional foods, new foods, food additives, energy snacks, appetite suppressants and endurance sports supplements.

[0003] Several methods for preparing 3-hydroxybutyric acid glycerol have been disclosed. For example, WO 95 / 09144 discloses a method for producing glycerol tris-(3-hydroxybutyrate). This method involves esterifying glycerol with tert-butyl acetoacetate, followed by hydrogenation of the resulting intermediate in the presence of a Raney nickel catalyst. This reaction requires expensive Raney nickel catalyst and high-pressure hydrogen, and the residual nickel catalyst after the reaction must be separated and purified, making it unsuitable for large-scale industrial production.

[0004] Patent CN118206450A discloses a method for synthesizing 3-hydroxybutyric acid glyceride, comprising the following steps: subjecting (2,2-dimethyl-1,3-dioxan-4-yl) 3-oxobutyric acid methyl ester represented by Formula III to a reduction reaction to obtain (2,2-dimethyl-1,3-dioxan-4-yl) 3-hydroxybutyric acid methyl ester represented by Formula IV; and dehydroxylating compound IV to obtain 3-hydroxybutyric acid glyceride. However, this method is complex, time-consuming, and uneconomical.

[0005] Patent CN113329990A discloses a method for producing 3-hydroxybutyric acid glyceride. 3-hydroxybutyric acid glyceride is prepared from ethyl 3-hydroxybutyrate and glycerol in the presence of an enzyme or metal catalyst. However, ethyl 3-hydroxybutyrate is a relatively expensive starting material. Furthermore, paragraphs 0223-0231 of the patent specification report that the product yield is low and that a high number of byproducts are produced when the metal catalyst is used.

[0006] Patent CN118206450A discloses a method for preparing 3-hydroxybutyric acid monoglyceride, which involves mixing poly(3-hydroxybutyrate), glycerol, and sulfuric acid, followed by reaction and post-treatment to obtain 3-hydroxybutyric acid monoglyceride. However, this method requires sulfuric acid to participate in the reaction, which poses certain environmental and safety risks.

[0007] All of the above methods rely on chemical synthesis or preparation, which are complex processes, require expensive catalysts, and involve relatively complex separation costs. Furthermore, 3-hydroxybutyric acid is more prone to polymerization and other undesirable side reactions (such as dehydration and decomposition). Therefore, developing a biological method to prepare 3-hydroxybutyric acid glyceride is crucial and of great significance for its large-scale production. Summary of the Invention

[0008] In order to solve the above technical problems, the present invention proposes a method for preparing 3-hydroxybutyric acid glyceride by biological method. Specifically, the present invention includes the following technical solutions.

[0009] In a first aspect, the present invention provides a method for constructing a 3-hydroxybutyric acid-producing bacterium, the method comprising the following steps:

[0010] (1) Using Escherichia coli W3110 as the starting strain, the yrhD and hns genes were knocked out to obtain the strain W3110-ΔyrhD-Δhns;

[0011] (2) The recombinant plasmid expressing TesB, atoB and AAR genes was transferred into the strain W3110-ΔyrhD-Δhns to obtain the 3-hydroxybutyric acid producing bacteria; wherein the TesB was derived from Escherichia coli, the atoB was derived from Rhodococcus opacus, and the AAR was derived from Shinella zoogloeoides.

[0012] In one or more embodiments, the pEcCas / pEcgRNA system is used in step (1) to achieve knockout of the yrhD and hns genes.

[0013] In one or more embodiments, the sequence of the yrhD gene before knockout is SEQ ID NO.7, and the sequence after knockout is SEQ ID NO.8; the sequence of the hns gene before knockout is SEQ ID NO.15, and the sequence after knockout is SEQ ID NO.16.

[0014] In one or more embodiments, the recombinant plasmid vector in step (2) is pTrc99a.

[0015] In a second aspect, the present invention provides a 3-hydroxybutyric acid-producing bacterium obtained by any of the construction methods described above.

[0016] In a third aspect, the present invention provides a method for preparing 3-hydroxybutyric acid glyceride, which comprises the steps of preparing 3-hydroxybutyric acid by fermentation using the production bacteria of the present invention, and obtaining 3-hydroxybutyric acid glyceride by separating and purifying the 3-hydroxybutyric acid in the fermentation broth and reacting it with glycerol under the catalysis of lipase.

[0017] In one or more embodiments, the fermentation medium formula of the production bacteria is: glucose 18-21 g / L, ammonium sulfate 4-6 g / L, potassium dihydrogen phosphate 2-3 g / L, anhydrous disodium hydrogen phosphate 4-5 g / L, urea 3-6 g / L, MgSO4·7H2O 1-2 g / L, trace elements 1 ml / L;

[0018] Among them, the formula of trace elements is: CaCl2·2H2O 1-1.3g / L, FeCl3·6H2O 5-6g / L, ZnSO4·7H2O 0.3-0.4g / L, CuSO4·5H2O 0.4-0.5g / L, EDTA-2Na 10-11g / L.

[0019] Preferably, the fermentation medium formula of the production bacteria is: glucose 20g / L, ammonium sulfate 5g / L, potassium dihydrogen phosphate 2g / L, anhydrous disodium hydrogen phosphate 3g / L, urea 5g / L, MgSO4·7H2O 0.5g / L, trace elements 1ml / L;

[0020] Among them, the formula of trace elements is: CaCl2·2H2O 1.2g / L, FeCl3·6H2O 5.8g / L, ZnSO4·7H2O0.35g / L, CuSO4·5H2O 0.42g / L, EDTA-2Na 10.8g / L.

[0021] In one or more embodiments, during the fermentation process of the production bacteria, the dissolved oxygen constant is controlled at 15-20%; when the glucose content drops to 3.0%, feeding is performed by feeding to control the glucose content in the fermentation system to 1.5-1.8%.

[0022] In one or more embodiments, the lipase is Novozyme 435.

[0023] In one or more embodiments, the molar ratio of 3-hydroxybutyric acid to glycerol is 1:2, and the catalytic temperature is 35-50°C.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] (1) The present invention synthesizes 3-hydroxybutyric acid by biological method and then obtains 3-hydroxybutyric acid glyceride by lipase catalysis. It is safe, environmentally friendly and pollution-free, with simple process and low cost, and can be used for industrial large-scale production.

[0026] (2) The production bacteria constructed by the present invention can significantly increase the yield of 3-hydroxybutyric acid.

[0027] (3) The enzyme-catalyzed reaction of the present invention, especially the use of Novozymes lipase 435, can significantly improve the conversion rate of 3-hydroxybutyric acid to 3-hydroxybutyric acid glyceride and the purity of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a process diagram for preparing 3-hydroxybutyric acid glyceride of the present invention.

[0029] Figure 2 This is a gel electrophoresis identification diagram after yrhD gene knockout in Example 1.

[0030] Figure 3 This is a gel electrophoresis identification diagram after hns gene knockout in Example 2.

[0031] Figure 4 is a map of the recombinant plasmid in Example 3. DETAILED DESCRIPTION

[0032] The present invention provides a method for constructing a 3-hydroxybutyric acid-producing bacterium, the method comprising the following steps:

[0033] (1) Using Escherichia coli W3110 as the starting strain, the yrhD and hns genes were knocked out to obtain the strain W3110-ΔyrhD-Δhns;

[0034] (2) The recombinant plasmid expressing TesB, atoB and AAR genes was transferred into the strain W3110-ΔyrhD-Δhns to obtain the 3-hydroxybutyric acid producing bacteria; wherein the TesB was derived from Escherichia coli, the atoB was derived from Rhodococcus opacus, and the AAR was derived from Shinella zoogloeoides.

[0035] It should be understood that the gene knockout and recombinant plasmid construction described in the above steps of the present invention do not limit the specific method, and those skilled in the art can operate according to existing technologies. Preferably, the knockout of the yrhD and hns genes can be achieved by the pEcCas / pEcgRNA system. Preferably, the vector of the recombinant plasmid is pTrc99a.

[0036] Fermentation of the production bacteria constructed according to the method of the present invention can produce a high concentration of 3-hydroxybutyric acid, which can then be separated and purified to obtain a product with a purity of more than 99%. The separation and purification methods described in the present invention are not limited, and those skilled in the art can refer to any method in the prior art for processing, such as the method described in CN107083406B.

[0037] The preparation process of 3-hydroxybutyric acid glyceride of the present invention is as follows Figure 1 As shown, in the present invention, when lipase is used as a biocatalyst, the 3-hydroxybutyric acid obtained by fermentation and separation and purification of the production bacteria of the present invention can react with glycerol to form 3-hydroxybutyric acid glyceride.

[0038] In the present invention, after the catalytic reaction, the 3-hydroxybutyric acid glyceride (monoglyceride, such as Figure 1 The proportion of the product is more than 80%, and a product with higher purity can be obtained after subsequent purification and separation.

[0039] In the present invention, there is no particular limitation on lipase, and lipases from different sources can be used for the preparation of 3-hydroxybutyric acid glyceride in the present invention.

[0040] In particular, the inventors also found that when Novozymes' lipase 435 was used as a catalyst to produce 3-hydroxybutyric acid glyceride, the conversion rate of 3-hydroxybutyric acid was the highest.

[0041] It should be understood that when expressing numerical characteristics in this article, the term "approximately" or "around" means that the number represented may have an error range or floating range of ±10%, ±9%, ±8%, ±7%, ±6% or ±5%.

[0042] It should be understood that the genes, expression cassettes, plasmids, and transformants described in the present invention can be obtained through genetic engineering construction methods well known to those skilled in the art.

[0043] The present invention will be further described in detail below with reference to specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0044] Example

[0045] This article involves the addition amount, content and concentration of various substances, and the percentages mentioned therein, unless otherwise specified, refer to the percentage by mass.

[0046] Materials and methods

[0047] The main instruments and equipment used in the examples are as follows:

[0048]

[0049]

[0050] The main experimental reagents and raw materials used in the examples are as follows:

[0051]

[0052] The whole gene synthesis, primer synthesis and sequencing in the examples were commissioned to General Bio (Anhui) Co., Ltd.

[0053] The molecular biology experiments in the examples, including plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., were performed primarily with reference to the third edition of Molecular Cloning: A Laboratory Manual (J. Sambrook, D.W. Russell, USA, translated by Huang Peitang et al., Science Press, Beijing, 2002). Specific experimental conditions can be determined by simple experiments if necessary.

[0054] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. These conditions can be adjusted through simple experiments if necessary.

[0055] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. (Add 20 g / L agar powder to LB solid medium.)

[0056] In the following examples, the detection method of 3-hydroxybutyric acid is as follows:

[0057] Chromatographic column: Jinouya HPX-87H column;

[0058] Mobile phase A: 5 mM sulfuric acid; flow rate: 0.4 ml / min; column oven: 35°C; detection wavelength: 210 nm; detection time: 32 min; injection volume: 5 μl;

[0059] The preparation method of 5 mM sulfuric acid is as follows: add 141 μl of concentrated sulfuric acid (purity 95%-98%) to 500 ml of pure water, vacuum filter, and ultrasonicate for 3 minutes.

[0060] In the following examples, the detection method of 3-hydroxybutyric acid glyceride is as follows:

[0061] Column: Agilent SB-Aq, 4.6 mm × 250 mm, 5 μm

[0062] Mobile phase: 0.1% perchloric acid: acetonitrile = 95:5; flow rate: 1.0 mL / min; column temperature: 30°C; wavelength: 214 nm; injection volume: 2 μL; run time: 15 min; calibration curve range: 0.1-1 g / L.

[0063] It should be noted that, for the sake of convenience of description, in the embodiments, the strain number, plasmid number, enzyme number, and enzyme-encoding gene number may share one number, which is easily understood by those skilled in the art, that is, the same number can refer to different biological forms in different environments.

[0064] Example 1: Knockout of the yrhD gene in Escherichia coli W3110

[0065] In this example, the pEcCas9 / pEcRNA system was used to knock out the YrhD gene in W3110. The specific steps are as follows:

[0066] 1.1. Preparation of Escherichia coli (W3110-pEcCas) competent cells containing the pEcCas plasmid

[0067] 1.1.1 Amplification of low-copy plasmid pEcCas9

[0068] The pEcCas9 plasmid was extracted using the alkaline lysis method (Sangong Plasmid Extraction Kit).

[0069] Take 6 mL of DH5a / pEcCas9 small shaker activated culture solution (LB medium), collect the bacteria and perform alkaline lysis, pass through the column for adsorption, and finally repeat elution twice with 50 μL of sterile ultrapure water. The eluted plasmid concentration is 85 ng / uL.

[0070] 1.1.2. Electroporate the pEcCas9 plasmid into W3110

[0071] (1) Place pEcCas9 (85 ng / uL), W3110 electroporation competent cells (100 μL), and an electroporation cuvette (0.2 cm) on ice for pre-cooling;

[0072] (2) Pipette 2 μL of pEcCas9 plasmid and add it to 100 μL of W3110 competent cells, flick gently to mix, then transfer to a 0.2 cm electroporation cuvette, gently shake to the bottom of the cuvette, and immediately place on ice;

[0073] (3) Prepare the electroporator and set the electroporation parameters: 2.5 kV, 25 μF, 200 ohms; take the electroporation cup, wipe the outer wall, and immediately place it in the electroporator sample slot for electroporation;

[0074] (4) Immediately add 1 mL of antibiotic-free LB liquid medium, transfer to an EP tube, and shake at 37°C, 220 rpm for about 1 h;

[0075] (5) After the recovery culture is completed, centrifuge at 5000 rpm for 2 min to collect the cells. Retain approximately 100 μL of supernatant, resuspend the cells in a clean bench, and evenly spread them on LB solid medium containing 50 mg / mL Kan. Incubate at 37°C overnight and select a single clone, which is the W3110 strain containing the pEcCas plasmid.

[0076] 1.1.3 Preparation of W3110-pEcCas competent cells

[0077] (1) Inoculate a single clone into 10 mL of LB and add 50 mg / L Kan and 2 g / L L-arabinose to a final concentration. Cultivate with shaking at 37°C, 220 rpm until the OD is approximately 0.6 (turbidity is acceptable).

[0078] (2) Wash the bacteria three times with 50 mL of 10% glycerol pre-cooled at 4°C;

[0079] (3) Finally, resuspend the cells in 400 μL of 10% glycerol pre-cooled at 4°C, aliquot into 100 μL / tube, and store at -80°C. 1.2. Construction of plasmid pEcgRNA-yrhD

[0080] 1.2.1. Synthesis of target fragment sg-yrhD

[0081] (1) Amplification primers are:

[0082] yrhD_sgF:tagtctttgctcaatgtatcacac(SEQ ID NO.1)

[0083] yrhD_sgR:aaacgtgtgatacattgagcaaag(SEQ ID NO.2)

[0084] (2) The amplification system is as follows:

[0085] Component Volume (μL) yrhD_sgF 10 yrhD_sgR 10 5X Annealing Buffer 10 ddH2O 20 Total 50

[0086] (3) PCR amplification conditions are:

[0087] 95℃ 5min, 70cycle-0.5℃ / 30s, 25℃ 5min.

[0088] 1.2.2. Vector & insert ligation and transformation into DH5α

[0089] (1) The Sg-yrhD fragment obtained by PCR amplification was diluted to 10 ng / μL; the pEcgRNA vector was digested with BsaⅠ restriction endonuclease, and the band at approximately 2000 bp was recovered by agarose gel electrophoresis.

[0090] (2) The connection system is as follows:

[0091]

[0092] (3) After the above ligation system reacted at 25°C for 15 min, 15 μL of the system was transferred into DH5α, plated (spec) (200 μL), and cultured at 37°C overnight. The next day, transformants were identified and the plasmid (pEcgRNA-yrhD) was extracted for use.

[0093] 1.3. Construction of homology arm yrhD_donor

[0094] 1.3.1. Amplification primers are:

[0095] yrhD_F:tcgaaacagaaataccagccctggctaaagcgtccatgtagagtcggtaatgactccaacttattgatagtgttttatgttcag(SEQ ID NO.3)

[0096] yrhD_R:ctgaacataaaacactatcaataagttggagtcattaccgactctacatggacgctttagccagggctggtatttctgtttcga(SEQ ID NO.4)

[0097] 1.3.2. The amplification system is as follows:

[0098] Component Volume (μL) yrhD_F 10 yrhD_R 10 5X Annealing Buffer 10 ddH2O 20 Total 50

[0099] 1.3.3. PCR amplification conditions are:

[0100] 95℃ 5min, 70cycles -0.5℃ / 30s, 25℃ 5min. Rubber is recovered and used for later use.

[0101] 1.4. Transformation of pEcgRNA-yrhD and yrhD_donor into W3110-pEcCas9

[0102] (1) Add yrhD_donor (~800 ng) and pEcgRNA_yrhD (~300 ng) to the W3110-pEcCas9 competent medium, mix well, and transfer to an electroporation cuvette;

[0103] (2) 2.5 kV electric shock (BIO-RAD MicroPulser, 2.5 kV), washing with 800 μl LB medium, and shaking culture at 37 °C for 1 h;

[0104] (3) Take 200ul and apply it to Kan+Spec resistance plate. Centrifuge the remaining bacterial liquid (4000rpm) and apply it to Kan+Spec resistance plate.

[0105] 1.5. Identification of the yrhD gene knockout effect

[0106] Identification primers:

[0107] yrhD_CF:cgtaatcctgtagatattcttccagcgg(SEQ ID NO.5)

[0108] yrhD_CR:cctttgacgtggtgatatggatgacg(SEQ ID NO.6)

[0109] Pick a single colony on the Kan+Spec resistance plate for PCR verification. Verify the correct band as follows: Figure 2 As shown, sequencing was finally used to confirm that the yrhD gene was successfully knocked out.

[0110] The gene sequence of yrhD before knockout is shown in SEQ ID NO.7, and the gene sequence after knockout is shown in SEQ ID NO.8.

[0111] 1.6. Eliminating resistance

[0112] (1) The verified positive clones were inoculated into LB liquid medium (Kan + Rha) and cultured at 37°C overnight;

[0113] (2) Transfer the bacterial suspension to new LB liquid medium (Kan + Rha), culture at 37°C and 220 rpm for 8 hours, streak onto LB solid plates (Kan), and culture at 37°C overnight;

[0114] (3) Observe the plates and select a single clone that grows only on the Kan plate. Inoculate it into an LB liquid test tube to obtain a Kan-resistant strain named W3110-ΔyrhD.

[0115] (4) Take 700 μl of the bacterial solution cultured in the LB test tube and add it to the seed tube. Then add 300 μl of 80% glycerol, mix well and store in a refrigerator at -20°C.

[0116] Example 2: Knockout of the hns gene in strain W3110-ΔyrhD

[0117] In this example, the pEcCas9 / pEcRNA system was used to knock out the hns gene in W3110-ΔyrhD. The specific steps are as follows:

[0118] 2.1. Preparation of W3110-ΔyrhD competent cells. For specific methods, refer to the preparation of W3110-pEcCas competent cells in Example 1.

[0119] 2.2 Construction of plasmid pEcgRNA-hns

[0120] 2.2.1. Synthesis of target fragment sg-hns

[0121] (1) Amplification primers are:

[0122] hns_sgF:TAGTTATAGCTACGTTGACGAAAA(SEQ ID NO.9)

[0123] hns_sgR:AAACTTTTCGTCAACGTAGCTATA(SEQ ID NO.10)

[0124] (2) Amplification system and conditions are the same as those for sg-yrhD amplification in Example 1

[0125] 2.2.2. Vector & insert were ligated and transformed into DH5α. The ligation system and conditions were the same as those in Example 1.

[0126] 2.3. Construction of homology arm hns_donor

[0127] (1) Amplification primers are:

[0128] hns_F:cttgctgccgttaaatctggcaccaaagctaaacgtgctcaggatttcctgatcaagcaataatcttttgtagattgcacttgc(SEQ ID NO.11)

[0129] hns_R:gcaagtgcaatctacaaaagattattgcttgatcaggaaatcctgagcacgtttagctttggtgccagatttaacggcagcaag(SEQ ID NO.12)

[0130] (2) The amplification system and conditions were the same as those for the amplification of yrhD_donor in Example 1.

[0131] 2.4. Transformation of pEcgRNA-hns and hns_donor into W3110-ΔyrhD

[0132] Add hns_donor and pEcgRNA_hns to the W3110-ΔyrhD competent cell, mix well, and transfer to an electroporation cup for electroporation. The steps are the same as in Example 1.

[0133] 2.5. Identification of the hns gene knockout effect

[0134] Identification primers:

[0135] hns_CF:acacttgaaacgctggaagaaatgctgg(SEQ ID NO.13)

[0136] hns_CR:tatccacgaaacggcgttgagcaatcgac(SEQ ID NO.14)

[0137] Pick a single colony on the Kan+Spec resistance plate for PCR verification. Verify the correct band as follows: Figure 3 As shown, sequencing was finally used to confirm that the hns gene was successfully knocked out.

[0138] The gene sequence of hns before knockout is shown in SEQ ID NO.15, and the gene sequence after knockout is shown in SEQ ID NO.16.

[0139] 2.6. Eliminating resistance

[0140] (1) Positive clones were picked and placed in LB liquid medium (containing 50 μg / mL Kan and 10 mM rhamnose), cultured at 37°C and 220 rpm for about 6 h, 20 μl of bacterial liquid was aspirated and added to 1.5 ml of LB medium, cultured at 37°C and 220 rpm for 1.5 h, spread on a sucrose (10 g / L) plate, and cultured at 37°C overnight to eliminate pEcCas.

[0141] (2) Spot-plate the cells on Kan, Spec, and LB plates. If the cells grow only on the LB plate but not on the other two plates, the two plasmids have been eliminated. The resulting non-resistant E. coli is named W3110-ΔyrhD-Δhns and then maintained according to the steps of Example 1.

[0142] Example 3: Construction and transduction of plasmid pTrc99a-TesB-atoB-AAR

[0143] In this embodiment, the TesB gene originated from Escherichia coli (GenBank: CAD6015872.1), the atoB gene originated from Rhodococcus opacus (NCBI Reference Sequence: WP_005238754.1), and the AAR gene originated from Candidatus Accumulibacter (NCBI Reference Sequence: WP_291994767.1).

[0144] In this example, the pEASY-Basic Seamless Cloning and Assembly Kit homologous recombination enzyme was used to construct the vector, and the TesB, atoB, and AAR fragments with homology arms were ligated to the plasmid pTrc99a to obtain the recombinant plasmid pTrc99a-TesB-atoB-AAR. The plasmid map is shown in FIG. Figure 4 The specific steps are as follows:

[0145] 3.1. Amplification of the vector, TesB, atoB and AAR fragments

[0146] 3.1.1. The vector and target fragment amplification primers are:

[0147] (1) Vector amplification primers:

[0148] pTRC-F:gaattccatggtctgtttcctg(SEQ ID NO.17)

[0149] pTRC-R:ggatcctctagagtcgacctgc(SEQ ID NO.18)

[0150] The vector fragment was amplified by PCR using the pTrc99a plasmid as a template.

[0151] (2) TesB fragment amplification primers:

[0152] TesB-F: caggaaacagaccatggaattcatgagtcaggcgctaaaaaatttactg (SEQ IDNO.19)

[0153] TesB-R:gcactcatgcaagcgttaattgtgattacgcatcacc(SEQ ID NO.20)

[0154] The vector fragment was amplified by PCR using Escherichia coli MG1655 as a template.

[0155] (3) AtoB fragment amplification primers:

[0156] AtoB-F:cgtaatcacaattaacgcttgcatgagtgccggcgtgc(SEQ ID NO.21)

[0157] AtoB-R: cggaaaaccccttccttaattcaaccgttcaatcacc (SEQ ID NO.22)

[0158] The vector fragment was amplified by PCR using Rhodococcus opacus as a template.

[0159] (4) AAR fragment amplification primers:

[0160] AAR-F:gaacggttgaattaaggaaggggttttccggggccgcgc(SEQ ID NO.23)

[0161] AAR-R:caggtcgactctagaggatccTTACTGATAGTAGAGGCCACCAC (SEQ ID NO. 24) was used as a template to amplify the vector fragment by PCR.

[0162] 3.1.2. After the amplified fragments were identified by 1% agarose gel electrophoresis, the nucleic acid was recovered using the EasyPure Quick Gel Extraction Kit. The steps are detailed in the instructions. The recovered product was stored at -20°C until use.

[0163] 3.2 Plasmid Construction

[0164] (1) Homologous recombination reaction system:

[0165]

[0166] Add dd H20 to 10 μL

[0167] Homologous recombination reaction parameters: Incubate at 50°C for 30 minutes, then immediately cool on ice. Recombinant products can be stored at -20°C.

[0168] (2) Thaw the competent E. coli DH5a cells stored at -80°C in an ice bath, add 10uL of the above recombinant product, gently pipette to mix, and place in an ice bath for 10 minutes. Heat shock in a 42°C water bath for 30 seconds, then immediately place in an ice bath for 2 minutes. Do not shake the centrifuge tube during this process. Add 700uL of sterile LB liquid culture medium, mix well, and incubate at 37°C, 200rpm for 1 hour to revive the bacteria. Centrifuge and concentrate the revived bacterial solution onto a solid LB plate containing 15ug / mL chloramphenicol, invert and incubate at 37°C overnight.

[0169] (3) Pick a single colony grown on the plate and identify the colony using DNA polymerase 2xRapid Taq Master Mix:

[0170] The identification primers are:

[0171] TesB_SeqR1:CGTCACGCAGCGTTTCGACATC(SEQ ID NO.25)

[0172] TesB_SeqF1:CAGGCCTTGTATGCTGCAAAAGAGAC(SEQ ID NO.26)

[0173] AtoB_SeqR1: CATATGATAACCATGGGTGGCGCAC (SEQ ID NO.27)

[0174] AtoB_SeqF1:CCTACTTACTCGATGCAAAAGCACGC(SEQ ID NO.28)

[0175] AAR_SeqR1:CGGCAATTTGTCAAGAACTG(SEQ ID NO.29)

[0176] AAR_SeqF1:GGCCACCACAGATGTTCATC(SEQ ID NO.30)

[0177] Colony identification reaction system:

[0178]

[0179] Aliquot into 12.5 μL of each system for identification, and 1 μL of ddHO mixture containing a single colony.

[0180] The PCR reaction parameters were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 60°C for 1 sec, extension at 72°C for 1 min 30 sec, followed by a return to the annealing step for a total of 30 cycles, and a complete extension at 72°C for 5 min.

[0181] After the PCR products were identified by 1% agarose gel electrophoresis, the colonies with the correct band size were preserved, the plasmids were extracted, and sent for sequencing.

[0182] 3.3 Plasmid Transduction

[0183] The plasmid pTrc99a-TesB-atoB-AAR (its nucleotide sequence is shown in SEQ ID NO.31) with the correct sequence was introduced into the strain W3110-ΔyrhD-Δhns, and PCR identification was performed to confirm that the plasmid was transferred into the strain, obtaining the recombinant strain W3110-ΔyrhD-Δhns-pTrc99a-TesB-atoB-AAR, which was maintained in glycerol tubes.

[0184] Example 4: Fermentation and detection of recombinant strains

[0185] 4.1 Seed liquid culture

[0186] The recombinant strain prepared in Example 3 was taken from the glycerol tube and placed in a liquid LB test tube, and cultured overnight at 37° C. and 230 rpm.

[0187] The culture medium formula is: glucose 20g / L, ammonium sulfate 5g / L, potassium dihydrogen phosphate 2g / L, anhydrous disodium hydrogen phosphate 3g / L, urea 5g / L, MgSO4·7H2O 0.5g / L, trace elements 1ml / L;

[0188] Among them, the formula of trace elements is: CaCl2·2H2O 1.2g / L, FeCl3·6H2O 5.8g / L, ZnSO4·7H2O0.35g / L, CuSO4·5H2O 0.42g / L, EDTA-2Na 10.8g / L.

[0189] Pick a single clone from the plate and transfer it to an LB test tube, or take 10ul from a frozen tube and transfer it to an LB test tube, add the corresponding antibiotics, and culture overnight at 37℃ and 230r / min.

[0190] 4.2 Fermentation tank culture

[0191] The seed solution was inoculated into a 2L fermenter using the same fermentation medium as in step (1). During fermentation, the dissolved oxygen constant was controlled at 15-20% by adjusting the ventilation rate and stirring speed. Residual sugar was controlled by feeding when the initial sugar dropped to approximately 3.0%. The residual sugar was controlled at approximately 1.5-2.0% throughout the fermentation process. After 72 hours of fermentation, the 3-hydroxybutyric acid concentration was detected to be 85 g / L.

[0192] 4.3 Extraction and purification:

[0193] The fermentation broth was centrifuged, the supernatant was collected, and (R)-3-hydroxybutyric acid was extracted from the supernatant.

[0194] The fermentation broth was centrifuged at a speed of 4500 rpm, and the bacteria were discarded to obtain a supernatant; 1% diatomaceous earth was added to the supernatant, stirred and filtered to obtain a filtrate; 1% activated carbon was added to the filtrate, stirred for 30 minutes, and the filtrate was filtered through a nanofiltration membrane. The obtained filtrate was collected after passing through 732 cation exchange resin, concentrated to 1000 g / L, and transferred while hot to obtain 3-hydroxybutyric acid.

[0195] Example 5: Preparation of 3-hydroxybutyric acid glyceride

[0196] The preparation process of this embodiment is as follows Figure 1As shown, the 3-hydroxybutyric acid separated after fermentation in Example 4 was mixed with glycerol in a molar ratio of 1:2, the reaction temperature was 42° C., and 3-hydroxybutyric acid glyceride was generated under the catalysis of Novozymes lipase 435.

[0197] After 12 hours of catalytic reaction, the 3-hydroxybutyric acid glyceride in the product (such as Figure 1 The content of the reaction product, monoglyceride, is 82%, indicating that the conversion rate of the reaction is high and the reaction can be applied to the large-scale production of 3-hydroxybutyric acid glyceride. Subsequently, only separation and purification are required to obtain high-concentration pure 3-hydroxybutyric acid glyceride.

[0198] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed by the present invention should be covered by the scope of protection of the present invention.

Claims

1. A method for constructing a 3-hydroxybutyric acid producing bacterium, characterized in that: The construction method comprises the following steps: (1) Using Escherichia coli W3110 as the starting strain, the yrhD and hns genes were knocked out to obtain the strain W3110-ΔyrhD-Δhns; (2) The recombinant plasmid expressing TesB, atoB and AAR genes was transferred into the strain W3110-ΔyrhD-Δhns to obtain the 3-hydroxybutyric acid producing bacteria; wherein the TesB was derived from Escherichia coli, the atoB was derived from Rhodococcus opacus, and the AAR was derived from Shinella zoogloeoides.

2. The construction method according to claim 1, wherein In step (1), the pEcCas / pEcgRNA system was used to knock out the yrhD and hns genes.

3. The construction method according to claim 2, wherein: The sequence of the yrhD gene before knockout is SEQ ID NO.7, and the sequence after knockout is SEQ ID NO.8; the sequence of the hns gene before knockout is SEQ ID NO.15, and the sequence after knockout is SEQ ID NO.

16.

4. The construction method according to claim 1, wherein The recombinant plasmid vector in step (2) is pTrc99a.

5. A 3-hydroxybutyric acid-producing bacterium obtained by the construction method according to any one of claims 1 to 4.

6. A method for preparing 3-hydroxybutyric acid glyceride, characterized in that: The preparation method comprises the steps of preparing 3-hydroxybutyric acid by fermenting the production bacteria according to claim 5, and the step of separating and purifying the 3-hydroxybutyric acid in the fermentation broth and then reacting it with glycerol under the catalysis of lipase to obtain 3-hydroxybutyric acid glyceride.

7. The preparation method according to claim 6, wherein The fermentation medium formula of the production bacteria is: glucose 18-21g / L, ammonium sulfate 4-6g / L, potassium dihydrogen phosphate 2-3g / L, anhydrous disodium hydrogen phosphate 4-5g / L, urea 3-6g / L, MgSO4·7H2O 1-2g / L, trace elements 1ml / L; Among them, the formula of trace elements is: CaCl2·2H2O 1-1.3g / L, FeCl3·6H2O 5-6g / L, ZnSO4·7H2O0.3-0.4g / L, CuSO4·5H2O 0.4-0.5g / L, EDTA-2Na 10-11g / L.

8. The preparation method according to claim 6, wherein During the fermentation process of the production bacteria, the dissolved oxygen constant is controlled at 15-20%; when the glucose content drops to 3.0%, feeding is performed in a fed-addition form to control the glucose content in the fermentation system at 1.5-1.8%.

9. The preparation method according to claim 6, wherein The lipase is Novozyme 435.

10. The preparation method according to claim 6, wherein The molar ratio of the 3-hydroxybutyric acid to the glycerol is 1:2, and the catalytic temperature is 35-50°C.

Images