Fluorescence in-situ hybridization probe group for identifying salvia miltiorrhiza and application of fluorescence in-situ hybridization probe group
The rapid identification of Salvia miltiorrhiza chromosomes through fluorescent in situ hybridization probe sets solves the time-consuming and costly problems of existing technologies and realizes low-cost and rapid analysis of Salvia miltiorrhiza kinship.
Patent Information
- Application Number
- CN202510911311.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-02
- Publication Date
- 2025-09-19
AI Technical Summary
The existing technology for studying the relationship between Salvia miltiorrhiza from different production areas is time-consuming and costly, and is not intuitive and clear enough.
A fluorescent in situ hybridization probe set, including specific fluorescent probe sequences (such as SEQ ID No: 1 and SEQ ID No: 2), was used to prepare chromosome sections and perform in situ hybridization to analyze the genetic relationship of Salvia miltiorrhiza from different producing areas.
It has achieved rapid and low-cost identification of Salvia miltiorrhiza chromosomes, can accurately analyze the relationship between Salvia miltiorrhizas from different production areas, saves the steps of observing phenotypes and testing medicinal active ingredients, and has good application prospects.
Smart Images

Figure CN120666086A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological detection, and particularly relates to a fluorescent in situ hybridization probe group for identifying salvia miltiorrhiza and an application thereof. Background Art
[0002] Salvia miltiorrhiza (Salvia miltiorrhiza Bge.), a plant of the Lamiaceae family, is a plant with a wide range of complex pharmacological activities, including myocardial protection, anti-atherosclerotic, blood pressure-lowering, and anti-inflammatory properties. It is commonly used to treat a variety of conditions, including angina pectoris, coronary heart disease, hypertension, and inflammation. Most cultivars of Salvia miltiorrhiza are in demand, and their phenotypes, active ingredients, and genetics vary across different producing regions. Studying the genetic relationships between Salvia miltiorrhiza varieties from different producing regions is essential for the selection and breeding of new Salvia miltiorrhiza varieties.
[0003] Current research on the genetic relationships between Salvia miltiorrhiza plants from different production areas primarily focuses on phenotype and active ingredient analysis, with some studies also conducted at the molecular level. However, these methods are time-consuming, expensive, and lack intuitive clarity. Therefore, developing an efficient method to study the genetic relationships between Salvia miltiorrhiza plants from different production areas is of great significance. Summary of the Invention
[0004] In order to solve the above problems existing in the prior art, the object of the present invention is to provide a fluorescent in situ hybridization probe set for identifying Salvia miltiorrhiza and its application.
[0005] In order to achieve the above object, the present invention adopts the following technical solutions:
[0006] The present invention provides a fluorescent in situ hybridization probe set for identifying the kinship of salvia miltiorrhiza, which comprises fluorescent probes with sequences shown as SEQ ID No: 1 and SEQ ID No: 2.
[0007] The present invention also provides a method for identifying the kinship of Salvia miltiorrhiza, the method comprising the following steps:
[0008] (1) Preparation of fluorescent probes;
[0009] (2) Root tips of Salvia miltiorrhiza from different producing areas were taken and prepared into chromosome preparations;
[0010] (3) taking the fluorescent probe obtained in step (1) and the chromosome preparation obtained in step (2), performing in situ hybridization to analyze the genetic relationship between Salvia miltiorrhiza from different producing areas;
[0011] The fluorescent probes in step (1) are fluorescent probes whose sequences are shown in SEQ ID No: 1 and SEQ ID No: 2.
[0012] Furthermore, the fluorescent probes in step (1) are two fluorescent probes with sequences as shown in SEQ ID No: 1 and SEQ ID No: 2, and the fluorescent probes are prepared by amplification and addition of fluorescent labels.
[0013] Furthermore, the primers for amplifying the fluorescent probe whose sequence is shown in SEQ ID No: 1 have the sequences shown in SEQ ID No: 11 and SEQ ID No: 12, and the primers for amplifying the fluorescent probe whose sequence is shown in SEQ ID No: 2 have the sequences shown in SEQ ID No: 13 and SEQ ID No: 14.
[0014] Furthermore, the fluorescent label of the fluorescent probe in step (1) is at least one of ATTO550 and ATTO488.
[0015] Furthermore, the root tip of Salvia miltiorrhiza in step (2) is the root tip of a Salvia miltiorrhiza seedling.
[0016] Furthermore, the chromosome preparation in step (2) includes the following steps:
[0017] (1) Take the root tip of Salvia miltiorrhiza and fix it with glacial acetic acid.
[0018] (2) After washing with 75% ethanol, add lyase for enzymatic hydrolysis, add 75% ethanol to stop the reaction, centrifuge, and collect the precipitate;
[0019] (3) Add glacial acetic acid to the precipitate to make a suspension. Drop the suspension onto a glass slide and dry it in a wet box to obtain a chromosome preparation.
[0020] Furthermore, the glacial acetic acid fixation time is 10 minutes, the enzymatic hydrolysis temperature is 37° C., the enzymatic hydrolysis time is 50 minutes, and the lysing enzymes are cellulase and pectinase in a mass ratio of 2:1.
[0021] Furthermore, the in situ hybridization in step (3) includes the following steps: soaking the chromosome preparation in 2× sodium chloride-sodium citrate buffer, Carnoy's fixative, 2× sodium chloride-sodium citrate buffer, 4% formaldehyde solution, 2× sodium chloride-sodium citrate buffer, and gradient alcohol in this order, adding fluorescent probe and then denaturing and hybridizing, incubating overnight, washing with 2× sodium chloride-sodium citrate buffer, soaking in gradient alcohol, adding 4',6-diamidino-2-phenylindole and then examining under a microscope.
[0022] Furthermore, the immersion time and number of times of the 2× sodium chloride-sodium citrate buffer solution are: 2 to 3 times, 5 minutes each time; the immersion time of the Carnoy's fixative is 10 minutes; the immersion time of the 4% formaldehyde solution is 10 minutes; the gradient alcohol is 75% ethanol, 85% ethanol, and 100% ethanol in sequence; the immersion time of the gradient alcohol is: 1 minute for each gradient; the denaturation hybridization time is 90 seconds; the temperature of the 2× sodium chloride-sodium citrate buffer solution for washing the slides is 57°C, and the washing time is 20 minutes.
[0023] The present invention also provides the application of the fluorescent in situ hybridization probe set and method in identifying Danshen producing areas and analyzing the genetic relationship between Danshen from different producing areas.
[0024] Furthermore, the production area is Shandong, Shaanxi, Sichuan or Henan.
[0025] In the present invention, gradient alcohol refers to an alcohol solution in which the alcohol concentration presents a gradient change.
[0026] The present invention has achieved the following beneficial effects:
[0027] The present invention provides a method for identifying Salvia miltiorrhiza chromosomes using fluorescent in situ hybridization probes. Using specific fluorescent in situ hybridization probes, the method can rapidly identify Salvia miltiorrhiza chromosomes from the first-producing region, thereby rapidly analyzing the genetic relationships between Salvia miltiorrhiza chromosomes from different producing regions. The method of the present invention can also be used to identify Salvia miltiorrhiza from different producing regions (particularly those in Shandong, Shaanxi, Sichuan, and Henan). The method of the present invention is low-cost, fast, and convenient. Compared with other methods, it eliminates the steps of observing Salvia miltiorrhiza phenotypes and measuring medicinal active ingredients, and thus has good application prospects.
[0028] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.
[0029] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 This is the fluorescence in situ hybridization signal of the 45S rDNA probe.
[0031] Figure 2 This is the fluorescence in situ hybridization signal of the 5S rDNA probe.
[0032] Figure 3 This is the fluorescence in situ hybridization signal of the SC06 probe.
[0033] Figure 4 This is the fluorescence in situ hybridization signal of the SC20 probe.
[0034] Figure 5 This is the fluorescence in situ hybridization signal of the SC209 probe.
[0035] Figure 6 This is the fluorescence in situ hybridization signal of the SC288 probe.
[0036] Figure 7 Fluorescence in situ hybridization signals for 45S rDNA and 5S rDNA on chromosomes of Salvia miltiorrhiza from four producing areas. A: Sichuan; B: Shandong; C: Henan; D: Shaanxi. Green probe: 45S rDNA; red probe: 5S rDNA.
[0037] Figure 8 Fluorescence in situ hybridization signals of SC06 and SC20 on chromosomes of Salvia miltiorrhiza from four major producing regions. A: Sichuan; B: Shandong; C: Henan; D: Shaanxi; E: chromosome arrangement of Salvia miltiorrhiza from four producing regions. Green probe: SC06; red probe: SC20. DETAILED DESCRIPTION
[0038] The raw materials, reagents and equipment used in the specific embodiments of the present invention are all known products and can be purchased commercially. The plasmid of the sequence is prepared by the following method:
[0039] Based on the genome of Salvia miltiorrhiza, specific primers were designed for PCR amplification. After amplification, the size of the band was identified by agarose gel electrophoresis. After confirmation, the obtained sequence was recovered and preserved.
[0040] The recovered product was ligated into the pMD19-T vector, transformed into DH5α chemically competent cells, and cultured. After antibiotic selection, sequencing, cloning, and plasmid extraction were performed. The vector was then digested with BamHI and SalI, and its concentration was determined.
[0041] The following experiments, where no temperature is specified, are reactions conducted at room temperature, which is 25±5°C.
[0042] Example 1: Method for Identifying Fluorescence In Situ Hybridization Probes for Salvia miltiorrhiza Chromosomes
[0043] 1. Experimental Methods
[0044] 1) Based on the Salvia miltiorrhiza genome data, the TAREAN pipeline within the Repeat Explorer pipeline was used to assemble, analyze, and annotate repetitive sequences in the Sichuan and Shandong Salvia miltiorrhiza genomes (identifying sequences with repeat counts exceeding 0.01% of the total genome content). This analysis ultimately revealed the composition and content of repetitive sequences within the genomes. Comparative genomic analysis of the Sichuan and Shandong Salvia miltiorrhiza genomes was performed using Repeat Explorer. Sequence assembly, consistency analysis, and annotation were performed to determine the repeat count, length, and type of species-specific / enriched repetitive sequences. Repeat sequences unique to the Salvia miltiorrhiza genome were identified and named SC06, SC20, SC209, and SC288. 45rDNA and 5sDNA sequences were selected from the existing Salvia miltiorrhiza rDNA database.
[0045] The sequence of SC06 is shown in SEQ ID No: 1, the sequence of SC20 is shown in SEQ ID No: 2, the sequence of SC209 is shown in SEQ ID No: 3, and the sequence of SC288 is shown in SEQ ID No: 4; the sequence of 45rDNA is shown in SEQ ID No: 5, and the sequence of 5sDNA is shown in SEQ ID No: 6.
[0046] 2) PCR amplification was performed using primers designed for the specific repetitive sequences SC06, SC20, SC209, and SC288, rDNA sequences 45rDNA, and 5sDNA obtained in step 1). After amplification, the band size was determined by agarose gel electrophoresis. After confirmation, the resulting sequence was recovered and stored, and the recovered product was ligated into the pMD19-T plasmid. The reaction was performed using a 20 μL system consisting of: 2 μL 10× NT loading buffer, 2 μL ATTO550 or ATTO488, 2 μL NT loading mix, 2 μL plasmid, and 10 μL ddH2O at 15°C.
[0047] 90 min, 65 °C 10 min labeled as probe.
[0048] 3) Young root tips of Salvia miltiorrhiza seedlings from Sichuan, Shandong, Henan, and Shaanxi were fixed with glacial acetic acid for 10 min, washed 2–3 times with 75% ethanol, and the root tip meristem was cut and enzymatically hydrolyzed at 37°C for 50 min. The reaction was stopped with 75% ethanol and centrifuged at 6000 rpm for 1 min. The precipitate was suspended in 35 μL of glacial acetic acid. 8 μL of the suspension was dropped onto a glass slide and air-dried in a wet box to obtain chromosome preparations.
[0049] 4) Take the probe from step 2) and the chromosome from step 3) and prepare the slides. The slides were fixed with 2×SSC (2 times for 5 minutes each), Carnoy's fixative (10 minutes), 2×SSC (2 times for 5 minutes each), 4% formaldehyde solution, 2×SSC (10 minutes), soaked in gradient alcohol for 1 minute (75%, 85%, 100%), added with the probe, and hybridized in a denaturing oven (90 degrees Celsius for 90 seconds). The slides were incubated overnight, washed in 2×SSC at 57°C for 20 minutes, soaked in gradient alcohol for 1 minute (75%, 85%, 100%), and DAPI was added. The slides were observed under a microscope and photographed. The images were analyzed and processed to screen out four suitable probes: 45S rDNA, 5S rDNA, SC06, and SC20.
[0050] 5) The four screened probes were marked red and green (green probe: 45SrDNA, SC06; red probe: 5SrDNA, SC20), and fluorescence in situ hybridization was performed on the chromosomes of Salvia miltiorrhiza from the four producing areas to analyze the genetic relationship between Salvia miltiorrhiza from the four producing areas.
[0051] The 45S rDNA sequence (SEQ ID No: 5) is:
[0052] CGAACACGTGTTTAACAATGCCGGGTGCGTGGCGTGGGGGCAACCCCGTCATGTACTCGGTCCGCGCGCGTCCTCGGGCAGTGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAATCGAAGCGTCCGCCCCTCGTGCCCCGTTCGCGGTGCGCGCGGGGGGATTGGATGTCTATCAAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCCCGCGCATAGCGTGGGCTGCGGGGGCGGAAACTGGCCTCCCGTGCGCCCCGGCGCGCGGCTGGCCCAAATGCGATCCCTCGGCGACTCGTGTCGCGACAAGTGGTGGTTGAACAACTCACTTTCATGTCGTGATTCTGCGTCGTCGGTATGGGCATCTGTAAACGACCCAACGGTGTAGGCGCCACACGCGCCCAACCTTCGACCGCGACCCCAGGTCAGGCGGGATTACCCGCTGAGTTTAAGCATATCAATAA
[0053] The 5S rDNA sequence (SEQ ID No: 6) is as follows:
[0054] TACTAATGGGTGCGATCATACCAGCACTAATGCACCGGATCCCATCAGAACTCCGAAGTTAAGCGTGCTTGGGCGAGAGTAGTACTAGGATGGGTGACCCCCTGGGAAGTCCTCGTGTTGCACCCCT
[0055] The SC06 sequence (SEQ ID No: 1) is as follows:
[0056] GCGAGGGAAATTCACCACATGTTCCCCATCATGAAAGATAACCAAGGTCCCAAGAATCATGCAATTCGGACGTGTAACGAGGGAGATATTGGCAAAACGGTCCCTCGGGGGACGGCGCTACGTCCCCTCCGTTTCCCAACCTATCCTTGTCTGATTTGGTCCGTTCAAAGACCGTTCGAAATATTTTTAGGGTGGCTACGTGGGAGCATGATCAGAATTGAAATCCGTATCAGTCGATTTTTGGGCGAGTGGTTCGCCAAGGCCATTTTAACTACATTAAGTGGCTCGGAGAGCCGAAATCTCGATTTTGGCACGAAAACGGTTCG;
[0057] The SC20 sequence (SEQ ID No: 2) is as follows:
[0058] The SC209 sequence (SEQ ID No: 3) is as follows:
[0059] CTACGTTCCCTCCGTTTCCCAACCTATACTTGTCTGATTTGGTCCGTTCAAAGACCGTTGGGAATATTTTTAGGGTGGCTACGTGGGAGCATGATCAGAATTGAAATCCGTGTCGGTCGATTTTTGGGCGAGTGGTTCGCCAAGGCCATTTTAGCTACATTAAGTGGCTCGGGGAGCCGAAATCTCGATTTTGGCACGGAAGCGGTTCGGCGAGGGAATTTCACCACATGTTCACCATCATGAAAGATAACCAAGGGCCCAAGAATCATGCAATTCGGACGTGTAACGAGGGAGATATTGGCAAAACGGTCCGCGGGGGACGGTG
[0060] The SC288 sequence (SEQ ID No: 4) is as follows:
[0061] GGTTAACACATCAAATGGAATACTTGTTTTTTATCAAACACGTCTCAATTACTACGATGCTATTATATGTACTCTAACACGTACTCTTAGTATACTTAACTCTCATGCGATATATGTCCAATATGTTTGAGGGGGTAATGGAATTGAACACTATTGACTCATTTTTATTGAATATAATGCCTATTAATTGAAATTGCATACTTAATTTCACTTAATTGCATAGGAATTACTAAAACATGCCCCGTTTGTGGCCGACTGTGTACGTAGTTGTGCACTGTCATTGTGCACCGTAGAACTCTTGCTATTTTCCCGATTTGAAGGACATGGGGCATCGGAAATTTGGATTTTTAATCTCCTATGTCAAATTCAAG
[0062] The 45S rDNA primer in step 2) is as follows:
[0063] Forward primer (SEQ ID No: 7): CGTAACAAGGTTTCCGTAGGTGAA
[0064] Reverse primer (SEQ ID No: 8): TTATTGATATGCTTAAACTCAGCGGG
[0065] The 5S rDNA primer is as follows:
[0066] Upstream primer (SEQ ID No: 9): TGGGTGCGATCATACCAG
[0067] Downstream primer (SEQ ID No: 10): GGTGCAACACGAGGACTT
[0068] SC06 primers are:
[0069] Upstream primer (SEQ ID No: 11): GATAACCAAGGTCCCAAGA
[0070] Downstream primer (SEQ ID No: 12): CACGTAGCCACCCTAAAA
[0071] SC20 primers are:
[0072] Upstream primer (SEQ ID No: 13): GTTTTCCGTCAAGGGCTAT
[0073] Downstream primer (SEQ ID No: 14): TGAACGGTCCAAATCACA
[0074] The primers for SC209 are:
[0075] Upstream primer (SEQ ID No: 15): TCCCAACCTATACTTGTCTG
[0076] Downstream primer (SEQ ID No: 16): GTTTTGCCAATATCTCCC
[0077] The primers for SC288 are:
[0078] Upstream primer (SEQ ID No: 17): ACGTCTCAATTACTACGATGCT
[0079] Downstream primer (SEQ ID No: 18): AATTTCCGATGCCCATG
[0080] The lytic enzyme is configured as follows:
[0081] 400 mg cellulase + 200 mg pectinase dissolved in 5 mL 0.01 M citric acid buffer.
[0082] The preparation method of 2ⅹSSC buffer is to dissolve 17.532g of sodium chloride + 7.742g of sodium citrate in 1L of distilled water.
[0083] The preparation method of Carnoy's fixative is: mix 75% ethanol and glacial acetic acid in a ratio of 3:1 and use it immediately after preparation.
[0084] The preparation method of 4% formaldehyde solution is: 5nL 37% formaldehyde + 42mL 2×SSC.
[0085] 2. Experimental Results
[0086] The fluorescence in situ hybridization images of Salvia miltiorrhiza chromosomes with different sequences were processed and analyzed. The results showed that:
[0087] 45S rDNA( Figure 1 ) signal points are bright dot-like signals, distributed in pairs on the chromosomes, with 4 signal points located on two pairs of chromosomes. Figure 2 ) signal points are similar to those of 45S rDNA, also bright dot-like signals, distributed in pairs on the chromosomes, with four signal points located on two pairs of chromosomes. Figure 3 ) signals are bright dots, mainly distributed at the ends of chromosomes. Figure 4 ) signals are also bright dots, mainly distributed at the ends of the short arms of chromosomes and on the long arms and ends of some chromosomes. Figure 5 ) and SC288( Figure 6 ) The signal points are distributed in a point-like manner, and the signals are complex and weak.
[0088] Among the six probes, the signal points of the four probes, 45S rDNA, 5S rDNA, SC06, and SC20, are relatively bright and clear, and their distribution on the chromosomes is relatively regular, and they can be used as probes for subsequent chromosome analysis.
[0089] The results of fluorescence in situ hybridization of 45S rDNA and 5S rDNA on chromosomes of Salvia miltiorrhiza from different production areas were analyzed. Figure 7 As shown, there is no significant difference in the signal distribution of 45S rDNA (green) and 5S rDNA (red) on the chromosomes of Salvia miltiorrhiza from the four production areas. 45S rDNA is distributed at the end of the short arm of chromosome 1 and the centromere of chromosome 3, while 5S rDNA is distributed at the centromere of chromosome 5 and near the centromere of the short arm of chromosome 8.
[0090] The above results indicate that 45S rDNA and 5S rDNA cannot be used to effectively analyze the relationship between chromosomes of Salvia miltiorrhiza from different production areas.
[0091] The results of fluorescence in situ hybridization of SC06 and SC20 on chromosomes of Salvia miltiorrhiza from different production areas were analyzed. Figure 8 shown.
[0092] 1. The signal of SC06 is bright dot-shaped ( Figure 3 ), a total of 31 signal sites, distributed at both ends of the long and short arms of chromosomes. Except for the end of one of the short arms of chromosome 1, there are signals at the ends of the other chromosomes. Figure 4 ) are bright dot-like signals, with a total of 15 signal sites, 12 of which are located at the ends of the short arms of chromosomes 2, 4, 5, 6, 7, and 8, 1 at the near-centromere end of the long arm of one homologous chromosome of chromosome 4, 1 at the near-end of one chromosome of chromosome 6, and 1 at the end of the long arm of one homologous chromosome of chromosome 8. No signal spots are distributed on chromosomes 1 and 3.
[0093] 2. Analysis of fluorescence in situ hybridization signals of Salvia miltiorrhiza chromosomes from four production areas ( Figure 8 ), the SC06 probe is primarily distributed at the chromosome ends, but the number and intensity of signals vary across different regions, with the most significant difference at the short arm end of chromosome 1. In Sichuan Salvia miltiorrhiza, there was no signal at the short arm end of one homologous chromosome of chromosome 1, while in Shandong and Henan Salvia miltiorrhiza, there was no signal at the short arm end of chromosome 1. In Shaanxi Salvia miltiorrhiza, there was signal at the short arm end of chromosome 1.
[0094] The signal distribution of the SC20 probe showed greater variability, especially on chromosomes 3, 4, 6, and 8. The signal distribution patterns of Danshen from Shandong and Henan were essentially the same, but compared to Danshen from Sichuan, there was no signal on chromosome 6, whereas one homologous chromosome on chromosome 6 in Danshen from Sichuan showed a signal near the end of the long arm. In contrast, one homologous chromosome on chromosome 8 in Danshen from Sichuan showed no signal at the end, while Danshen from Shandong and Henan showed signals at the ends of the long arms of chromosome 8. The signal distribution of Danshen from Shaanxi differed most from that of the other three producing areas, with a signal at the end of the short arm of chromosome 3 that was not present in the other producing areas. Furthermore, Danshen from Shaanxi showed signals on the long arm of chromosome 4, on the proximal end of one homologous chromosome on chromosome 6, and on both ends of chromosome 8, with signal intensities significantly higher than those of the other three producing areas.
[0095] These results indicate that the signals from SC06 and SC20 show significant differences between chromosomes of Salvia miltiorrhiza from different production areas, and that SC06 and SC20 are effective for analyzing the relationships between chromosomes of Salvia miltiorrhiza from different production areas. Combined analysis of the signals from both probes revealed that Salvia miltiorrhiza from Shandong and Henan are most closely related; Salvia miltiorrhiza from Sichuan is relatively distantly related to Salvia miltiorrhiza from Shandong and Henan; and Salvia miltiorrhiza from Shaanxi is the most distantly related to the other three production areas.
[0096] In summary, the present invention provides a method for identifying Salvia miltiorrhiza chromosomes using fluorescent in situ hybridization probes. Using specific fluorescent in situ hybridization probes, this method can rapidly identify Salvia miltiorrhiza chromosomes from a primary production area and rapidly analyze the relationships between Salvia miltiorrhiza chromosomes from different production areas. This method is low-cost, fast, and convenient. Compared to other methods, it eliminates the steps of observing Salvia miltiorrhiza phenotypes and measuring active ingredients, and thus has promising application prospects.
Claims
1. A fluorescent in situ hybridization probe set for identifying the relationship of Salvia miltiorrhiza, characterized in that: It includes fluorescent probes with sequences shown as SEQ ID No: 1 and SEQ ID No:
2.
2. A method for identifying the relationship of Salvia miltiorrhiza, characterized in that: The method comprises the following steps: (1) Preparation of fluorescent probes; (2) Root tips of Salvia miltiorrhiza from different producing areas were taken and prepared into chromosome preparations; (3) taking the fluorescent probe obtained in step (1) and the chromosome preparation obtained in step (2), performing in situ hybridization to analyze the genetic relationship between Salvia miltiorrhiza from different producing areas; The fluorescent probes in step (1) are fluorescent probes whose sequences are shown in SEQ ID No: 1 and SEQ ID No:
2.
3. The method according to claim 2, characterized in that The fluorescent probe in step (1) is prepared by amplification and addition of a fluorescent label; Preferably, the primers for amplifying the fluorescent probe whose sequence is shown as SEQ ID No: 1 have the sequences shown as SEQ ID No: 11 and SEQ ID No: 12, and the primers for amplifying the fluorescent probe whose sequence is shown as SEQ ID No: 2 have the sequences shown as SEQ ID No: 13 and SEQ ID No:
14.
4. The method according to claim 2 or 3, characterized in that The fluorescent label of the fluorescent probe in step (1) is at least one of ATTO550 and ATTO488.
5. The method according to claim 2, characterized in that: The salvia miltiorrhiza root tip in step (2) is the salvia miltiorrhiza seedling root tip.
6. The method according to claim 2, characterized in that: The chromosome preparation in step (2) comprises the following steps: (1) Take the root tip of Salvia miltiorrhiza and fix it with glacial acetic acid. (2) After washing with 75% ethanol, add lyase for enzymatic hydrolysis, add 75% ethanol to stop the reaction, centrifuge, and collect the precipitate; (3) Add glacial acetic acid to the precipitate to make a suspension. Drop the suspension onto a glass slide and dry it in a wet box to obtain a chromosome preparation.
7. The method according to claim 6, characterized in that The glacial acetic acid fixation time is 10 minutes, the enzymatic hydrolysis temperature is 37° C., the enzymatic hydrolysis time is 50 minutes, and the lysing enzymes are cellulase and pectinase in a mass ratio of 2:
1.
8. The method according to claim 2, characterized in that: The in situ hybridization in step (3) comprises the following steps: soaking the chromosome preparation in 2× sodium chloride-sodium citrate buffer, Carnoy's fixative, 2× sodium chloride-sodium citrate buffer, 4% formaldehyde solution, 2× sodium chloride-sodium citrate buffer, and gradient alcohol in this order; adding a fluorescent probe and then denaturing and hybridizing; incubating overnight; washing the slides with 2× sodium chloride-sodium citrate buffer; soaking in gradient alcohol; and adding 4',6-diamidino-2-phenylindole before microscopic examination.
9. The method according to claim 8, characterized in that The immersion time and number of times of the 2× sodium chloride-sodium citrate buffer solution are: 2 to 3 times, 5 minutes each time; the immersion time of the Carnoy's fixative is 10 minutes; the immersion time of the 4% formaldehyde solution is 10 minutes; the gradient alcohol is 75% ethanol, 85% ethanol, and 100% ethanol in sequence; the immersion time of the gradient alcohol is: 1 minute for each gradient; the denaturation hybridization time is 90 seconds; the temperature of the 2× sodium chloride-sodium citrate buffer solution for washing the slides is 57°C, and the washing time is 20 minutes.
10. Use of the fluorescent in situ hybridization probe set according to claim 1 and the method according to any one of claims 2 to 9 in identifying Danshen producing areas and analyzing the relationship between Danshen from different producing areas; preferably, the producing area is Shandong, Shaanxi, Sichuan or Henan.