Application of SORBS2 in preparation of medicine for treating melanoma

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of SORBS2 in preparation of a medicine for treating melanoma. The technical problem to be solved by the invention is to provide a new choice for treating melanoma. The technical scheme of the invention is the application of SORBS2 protein in preparation of drugs for treating melanoma. The invention reveals that SORBS2 overexpression can inhibit growth and metastasis of melanoma, inhibit polarization of macrophages to M2 type and enhance anti-melanoma immune effect for the first time, and the SORBS2 overexpression can be used as a novel strategy for preparing and treating melanoma.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of SORBS2 in preparing drugs for treating melanoma. Background Art

[0002] Melanoma, considered one of the most aggressive skin cancers, primarily develops from the malignant transformation of pigment-producing melanocytes (melanocytes) located in the basal layer of the epidermis. When melanoma is detected early, the five-year survival rate can exceed 98%, but survival rates drop significantly in advanced cases. Ultraviolet radiation exposure, family history, and specific genetic traits are major risk factors for melanoma. Recent advances in immunotherapy and targeted therapies have brought new treatment options to patients with advanced melanoma. However, early detection and treatment remain key to improving cure rates.

[0003] Sorbin and SH3 domain 2 protein (SORBS2), also known as Arg / c-Abl kinase binding protein 2 (Arg-binding protein 2, ArgBP2), is a member of the sorbin homology domain (SoHo) family of adaptor proteins. It is a cytoskeletal linker protein with a molecular weight of approximately 75 kDa. In recent years, with the continuous deepening of SORBS2 research, its potential role in anti-tumor therapy, particularly in melanoma treatment, has gradually attracted attention. Whether SORBS2 can inhibit melanoma growth and how upregulating SORBS2 expression can inhibit the immune escape and metastasis of melanoma cells, thereby exerting its anti-tumor immunomodulatory effects, has not yet been verified. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a new option for treating melanoma.

[0005] The technical solution of the present invention is the use of SORBS2 protein in the preparation of a drug for treating melanoma. The amino acid sequence of the SORBS2 protein is shown in SEQ ID NO.3.

[0006] Furthermore, the drug for treating melanoma is a drug for inhibiting melanoma growth and / or a drug for inhibiting melanoma metastasis.

[0007] The present invention also provides the use of a substance for increasing the expression of SORBS2 protein in the preparation of a drug for treating melanoma. The amino acid sequence of the SORBS2 protein is shown in SEQ ID NO.3.

[0008] Specifically, the drug for treating melanoma is a drug that inhibits the growth of melanoma and / or a drug that inhibits the metastasis of melanoma.

[0009] Furthermore, the substance that increases the expression of SORBS2 protein is an expression cassette containing a gene encoding SORBS2 protein, a vector expressing a gene encoding SORBS2 protein, or a host cell containing a vector expressing a gene encoding SORBS2 protein.

[0010] The present invention also provides a drug for treating melanoma, comprising a SORBS2 protein or a substance that increases the expression of the SORBS2 protein. The amino acid sequence of the SORBS2 protein is shown in SEQ ID NO.3.

[0011] Specifically, the drug for treating melanoma is a drug that inhibits the growth of melanoma and / or a drug that inhibits the metastasis of melanoma.

[0012] Furthermore, the substance that increases the expression of SORBS2 protein is an expression cassette containing a gene encoding SORBS2 protein, a vector expressing a gene encoding SORBS2 protein, or a host cell containing a vector expressing a gene encoding SORBS2 protein.

[0013] Beneficial effects of the present invention: The present invention reveals for the first time that SORBS2 overexpression can inhibit melanoma growth and metastasis, promote melanoma cell apoptosis, inhibit macrophage polarization to M2 type, and enhance anti-melanoma immune response, which can be used as a new strategy for the preparation of melanoma treatments. The present invention also confirms that: (1) SORBS2 overexpression significantly inhibited the proliferation and migration of human melanoma A375 cells and promoted apoptosis. Flow cytometry and Western blotting verified the successful construction of the SORBS2-overexpressing A375 cell line. CCK-8, clone formation assay, Transwell migration and apoptosis assays confirmed that SORBS2 overexpression inhibited the proliferation and migration of melanoma cells and promoted apoptosis, indicating that it has anti-melanoma efficacy.

[0014] (2) SORBS2 overexpression affects melanoma-related immune responses; RNA-Seq high-throughput sequencing technology further confirmed the successful construction of the SORBS2-overexpressing A375 cell line, highlighting the immune-related role of SORBS2 in melanoma progression, which provides a new strategy for the development of melanoma immunotherapy drugs targeting SORBS2.

[0015] (3) In vivo experiments showed that SORBS2 overexpression inhibited the growth of subcutaneous melanoma and significantly reduced tumor size and weight. Flow cytometry assays showed that SORBS2 overexpression promoted the infiltration of M1 macrophages (anti-tumor immune cells) and inhibited the infiltration of M2 macrophages (pro-tumor immune cells) in melanoma-bearing mice. In vitro flow cytometry assays showed that SORBS2 overexpression promoted the infiltration of M1 macrophages (anti-tumor immune cells) and inhibited the infiltration of M2 macrophages (pro-tumor immune cells) in the melanoma immune microenvironment in melanoma-bearing mice. SORBS2 overexpression generally enhanced anti-tumor immunity, and SORBS2 has the potential to develop new strategies for treating melanoma.

[0016] (4) In vivo experiments showed that SORBS2 overexpression inhibited the rate of melanoma lung metastasis and significantly slowed down the impact of melanoma lung metastasis, providing a new strategy for the development of melanoma metastasis drugs targeting SORBS2. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Figures show the effects of SORBS2 overexpression on the proliferation, migration, and apoptosis of human melanoma A375 cells as assessed by the Cell Counting Kit-8 (CCK-8), 5,6-carboxyfluorescein diacetate, succinimidyl ester (CFSE), and colony formation assays. Figures A and B are mean fluorescence intensity histograms and statistical graphs of A375 cells stably overexpressing SORBS2 as assessed by flow cytometry. Figures C and D are Western blotting results, respectively, showing protein levels of SORBS2 in A375 cells stably overexpressing SORBS2. Figures E, F, G, and H are histograms showing the effects of overexpression of SORBS2 on the early, late, and total apoptosis of A375 cells detected by apoptosis assay. Figure I is a line graph showing the effects of overexpression of SORBS2 on the proliferation of A375 cells detected by CCK-8 assay. Figures J and K are statistical graphs showing the effects of overexpression of SORBS2 on the colony formation ability of A375 cells detected by clone formation assay. Figures L and M are statistical graphs showing the effects of overexpression of SORBS2 on the migration ability of A375 cells detected by Transwell migration assay.

[0018] Figure 2Figure 3 shows the results of RNA-Seq high-throughput sequencing technology for detecting A375 cells overexpressing SORBS2 and control A375 cells; Figure A is the principal component analysis diagram of A375 cells overexpressing SORBS2 and control A375 cells, Figure B is the volcano plot of RNA-Seq data of A375 cells overexpressing SORBS2 and control A375 cells, and Figure C is the Venn diagram of differentially expressed genes in A375 cells with or without SORBS2 overexpression treatment. Figure 3 This figure shows the results of animal experiments and flow cytometry detection of the effects of SORBS2 overexpression on melanoma growth and immunity. Figure A is a schematic diagram of an animal experiment using subcutaneous melanoma tumors, Figures B and C are macroscopic observation images and tumor weight comparison results after mouse tumor resection, Figure D is a cell graph and statistical graph of the proportion of M1 macrophages in the spleen analyzed by flow cytometry, Figure E is a cell graph and statistical graph of the proportion of M1 macrophages in tumors analyzed by flow cytometry, Figure F is a cell graph and statistical graph of the proportion of M2 macrophages in the spleen analyzed by flow cytometry, Figure G is a cell graph and statistical graph of the proportion of M2 macrophages in tumors analyzed by flow cytometry, Figure H is a cell graph and statistical graph of the proportion of macrophages polarized toward M1 pro-inflammatory macrophages in the co-cultured THP-1 cells and the SORBS2-overexpressing A375 cells group and the control group, and Figure I is a cell graph and statistical graph of the proportion of macrophages polarized toward M2 anti-inflammatory macrophages in the co-cultured THP-1 cells and the SORBS2-overexpressing A375 cells group and the control group.

[0019] Figure 4 Figures show the results of animal experiments verifying the effect of SORBS2 overexpression on melanoma metastasis. Figure A is a schematic diagram of an animal experiment using melanoma lung metastasis, Figures B and C are comparative lung tissue observations, and Figure D is a comparison of spleen size.

[0020] Figure 5 This is a heat map of differentially expressed genes in A375 cells treated with or without SORBS2 overexpression.

[0021] Figure 6 This is a diagram showing the differential gene enrichment analysis of A375 cells treated with or without SORBS2 overexpression. DETAILED DESCRIPTION

[0022] This study will investigate the inhibitory effect of SORBS2 overexpression on melanoma cell growth and its regulatory effect on immune cell function through a series of in vitro and in vivo experiments, in order to reveal its potential application value in melanoma treatment and provide a new treatment method for melanoma patients.

[0023] In order to further illustrate the technical means and effects adopted by the present invention to achieve the predetermined purpose of the invention, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments.

[0024] Example 1 Study on the effects of SORBS2 overexpression on proliferation, migration and apoptosis of human melanoma A375 cells In this example, flow cytometry and Western blotting experiments validated the construction of an A375 cell line stably overexpressing SORBS2 (Fuheng Biotechnology). CCK-8 assays, colony formation assays, Transwell migration assays, and Annexin V-FITC / propidium iodide (PI) apoptosis assays were used to examine the effects of SORBS2 overexpression on the proliferation, migration, and apoptosis of human melanoma A375 cells.

[0025] Experimental method: SORBS2 overexpression A375 cells were constructed by homologous recombination. Human melanoma A375 cells (control group) and SORBS2 overexpression A375 cells (experimental group) were respectively cultured at 1×10 5 1000 cells were seeded per well in 6-well plates for flow cytometry, Western Blotting and apoptosis experiments; 1000 cells were seeded per well in 96-well plates for CCK-8 experiments; 1000 cells were seeded per well in 6-well plates for colony formation experiments; 1×10 4 The cells were seeded into Transwell plates at a ratio of 1:1 to 1.5, and then the cells were plated into Transwell plates for Transwell migration assay.

[0026] Homologous recombination method: A375 cells overexpressing SORBS2 were constructed. RNA was first extracted from A375 cells and reverse-transcribed into cDNA using a TaKaRa random primer kit. The SORBS2 gene was then amplified using Q5 high-fidelity DNA polymerase (purchased from Nanjing Novozymes Biotech Co., Ltd.) (forward primer SEQ ID NO. 1: ATGAGTTCTGAATGTGATGGTG; rear primer SEQ ID NO. 2: TTATAGATACAAAGGTTTACATAG) and cloned into the pCHD-Flag vector (purchased from Wuhan Miaoling Biotech Co., Ltd.) by homologous recombination to generate pCDH-SORBS2-Flag. pCDH-SORBS2-Flag, pMD2.G, and pSPAX2 plasmids (purchased from Wuhan Miaoling Biotech Co., Ltd.) were co-transfected into 293T cells at a 2:1:2 ratio using a Rapid Cloning Kit (purchased from Nanjing Novozymes Biotech Co., Ltd.) for lentiviral packaging. Supernatants were collected 24 and 48 hours after transfection and stored in aliquots at -80°C. When A375 cells reached approximately 40% confluency in 6-well plates, they were infected with complete medium and lentiviral supernatant at a 1:1 ratio. Stable transfection was selected by adding puromycin approximately 48 hours later, and selection was continued for one week. Finally, the effect of SORBS2 at the protein level was assessed by Western blotting and flow cytometry.

[0027] SEQ ID NO. 3, SORBS2 protein: msvtltsvkr vqsspnllaa grdsqspdsa wrsyndgnqe tlngdatyss laakgfrsvr pnlqdkrspt qsqitvngns ggavspmsyy qrpfspsays lpaslnssiv mqhgtsldst dtypqhaqsl dgttsssipl yrsseeekrv tvikaphypg igpvdesgip tairttvdrp kdwyktmfkq ihmvhkpgly nppysaqshp aaktqtyrpl skshsdnspn afkdasspvp pphvpppvpp lrprdrsste khdwdppdrk vdtrkfrsep rsifeyepgk ssilqherpa slyqssidrs lerpmssasm asdfrkrrks epavgpprgl gdqsasrtsp grvdlpgsst tltksftsss psspsrakdr esprsysstl tdmgrsapre rrgtpekekl pakavydfka qtskelsfkk gdtvyilrki dqnwyegehh grvgiffpisi vekltppeka qparppppaq pgeigeaiak infnadtnve lslrkgdrvi llkrvdqnvy egkipgtnrq gifpvsyvev vkkntkgaed ypdppiphsy ssdrihslss nkpqrpvfth eniqgggepf kalynytprn edelelresd vidvmekcdd gwfvgtsrrt kffgtfpgny vkrl。

[0028] SEQ ID NO.4, SORBS2 protein coding sequence: atgtctgttac gctacatct gtgaagagag tgcaagttc tccaaccta tggctgcaggcgtgattc tcagtcacca gactcagctt ggagatctta caatgatggc atcaggaga cactgaacggagatgctaca tattcctc tgcagcac agac aggtcttac agataaagatcaccacc agagccagat aacagtgaat ggaactcag gaggtgccgt gagtcccatg agttactcagccgtt tccccctcg gcatattctc tcccagcctc actcactc cagcatgtctca tgcagcacggcatcggcccccca gattccac atggcaccac cagcagctctatccccctgt accgatcctc agaggaagag agagagtga cagtcatcaa agccccgcat tacccagggatcggcccgt ggatgaatcc ggaatcccacagcattag aacgacagtc gaccggccca aggactgcaggcagacgatg tcagcagtc ggtctgtaca acccaccta cagtgctcagtcacaccctg ctgcaaagac ccaacctac agaccctt ccaaaagcca ctccgacac agcccaatgcctttagga tgcgtcctcc ccagtgcctc cccacatgt tccaccgaccagagccag gtccctg agcatgactg ggatcctcca gagagaaag tggacacaag aaaatttcggtctgagccaa ggagtattt tgaatatgaa cctggcaagt catcattct tcagcatgaa agaccagccttgtatca gtcctctatagacagaagcc tggaaagacc catgagttct gcaagcatgg ccagtgacttcaggaagcgg aggagaagcg agcctgcagt gggtccacca cggggcttgg gagatcaaag tgcgagcaggactgcccag gccgagtgga cctcccagga tcaagcacca ctcttacaaa gtctttcact agctcttctctctttcccc atcaagagca aaagaccgtg agtcccctag aagttactca tccactttga ctgacatgggaagtgca ccaagggaaa gaagaggaac tccagaaaaa gagaaattgc ctgcaaaagc tgtttatgattttaaggctc agacatctaa ggagttgtca tttaagaaag gagatactgt ctacatcctc agaaaaattgatcaaaattg gtatgaggga gaacaccacg ggagagtggg catcttcccg atctcatacg tagagaaactcacacctccct gagaaagcac agcctgcaag accacctccg ccagcccagc ccggagaaat cggagaagctatagccaaat acaacttcaa cgcagacaca aatgtggagc tgtcactgag aaagggagat agagttattcttcttaaaag agttgatcaa aactggtatg aaggtaaaat cccaggaacc aacagacaag gcatcttccctgtttcctat gtggaggtcg tcaagaagaa cacaaaaggt gctgaggact accctgaccc tccaataccccacagctatt ctagtgatag gattcacagc ttgagctcaa ataagccaca gcgtcctgtg tttactcatgaaaatattca aggtgggggg gaaccgtttc aggctctgta taactatact cccaggaatg aagatgagctggagctcaga gaaagtgatg tcattgatgtcatggaaaag tgtgatgacg gctggtttgt ggggacctcaagaagaacca aattctttgg tactttcccc ggaaactacg tcaagaggct gtga.

[0029] Flow cytometry: After 72 h of culture, cells were collected and stained with SORBS2 antibody at 4°C in the dark for 30 min. After washing, cells were stained with FITC secondary antibody for 40 min and resuspended in 200 μL PBS. The mean fluorescence intensity (MFI) of the cell surface was detected by flow cytometry, and its changes were analyzed using FlowJo.

[0030] Western Blotting: The cells were treated with RIPA lysis buffer to lyse and extract total protein. The proteins were separated using SDS-PAGE and subsequently transferred to a NC membrane. Blocking was performed with 5% skim milk, followed by the addition of a SORBS2-specific antibody (primary antibody) for immunoreaction and overnight incubation at 4°C. The next day, an HRP-labeled secondary antibody was added and incubated at room temperature for 1 hour. Signal detection was performed using electrochemiluminescence solution, and development was completed using a chemiluminescence gel imaging system. All experimental data were statistically processed and analyzed using GraphPad Prism software.

[0031] Annexin V-FITC / PI apoptosis assay: After 72 hours of culture, cells were harvested and stained by incubation with 5 μL of Annexin V-FITC and 5 μL of propidium iodide (PI) at 25°C for 15 minutes in the dark. 100 μL of the stained cell suspension was used to quantify the apoptotic cell population by flow cytometry using FITC and PI fluorescence.

[0032] CCK-8 assay: After the overnight incubation period, the existing culture medium in the well plate was removed and 100 μL of complete DMEM medium was inoculated into each microwell. After 24, 48, 72, and 96 hours, 10 μL of CCK-8 solution was added to the 96-well plate and incubated for an additional 2 hours. At the end of the incubation period, the optical density (OD) of each well was measured at 450 nm using a microplate reader, and cell viability was calculated based on this value.

[0033] For colony formation assays, complete DMEM (DMEM) was added to the culture medium after cell attachment. After spheroid formation, the medium was removed, and the cells were washed with PBS and fixed with 4% fixative. Following this, the cells were washed again and stained with crystal violet. Following the staining step, the plates were washed, and the stained cells were imaged to record colony formation. The number of colonies was quantified using Image J software.

[0034] Transwell migration assay: 8 µm Transwell inserts were placed in a 24-well plate. 500 µL of complete culture medium was added to each lower chamber. Simultaneously, 400 µL of serum-free culture medium containing cells was injected into the upper chamber. After 72 hours of incubation, cells were fixed, stained, and counted to quantify the number of migrated cells.

[0035] Experimental results ( Figure 1 Flow cytometry and Western blotting experiments demonstrated increased SORBS2 protein levels in overexpressed cells, and a stable SORBS2-overexpressing A375 cell line was successfully established (Figures AD). Annexin V-FITC / PI apoptosis assays, CCK-8 assays, colony formation assays, and Transwell migration assays (Figures EM) demonstrated that SORBS2 overexpression increased apoptosis, decreased viability, colony formation, and migration in human melanoma A375 cells. This directly demonstrates that SORBS2 overexpression inhibits proliferation and migration and promotes apoptosis in human melanoma A375 cells.

[0036] Example 2 Study on the mechanism of SORBS2 overexpression regulating anti-melanoma RNA-Seq high-throughput sequencing technology detected the effect of SORBS2 overexpression on the expression of SORBS2 in human melanoma A375 cells in vitro.

[0037] Experimental method: A375 cells (SORBS2 overexpression or control) were cultured at 1×10 5 Cells were seeded at a density of 100 cells / mL in a 6-well plate and cultured for 72 hours. Three replicates were performed in each treatment and control groups. Cells were harvested, washed with 1× PBS buffer, and then mixed with 1 mL of Trizol. The cells were transferred to a sterile, enzyme-free 1.5 mL tube and stored in a -80°C freezer. The preserved samples were sent to Guangzhou Novo Biotechnology Co., Ltd. for sequencing and analysis using high-throughput RNA-Seq technology.

[0038] Experimental results ( Figure 2 、 Figure 5 and Figure 6): RNA-Seq high-throughput sequencing technology detected 33,161 expressed genes (DEGs). Compared with the experimental group, 234 genes were upregulated and 801 genes were downregulated in the control group ( Figure 2 AB). Figure 2 C. Figure 5 and Figure 6 The results showed that 533 genes were unique to SORBS2 overexpression in melanoma A375 cells, compared to 521 genes in the control group. Furthermore, a heatmap of genes increased by A375 overexpression included SORBS2. Enrichment analysis of differentially expressed genes highlighted immune-related effects. SORBS2 is a potential immune target for suppressing melanoma.

[0039] Example 3 Study on the effect of SORBS2 overexpression on melanoma growth and immunity In this example, animal experiments and flow cytometry were used to detect the growth size and weight of melanoma and the changes in the body's immune cells.

[0040] Experimental methods: Construction of subcutaneous melanoma model: 5-week-old male Balb / c-nu nude mice were adaptively fed for 10 days. Multiple dishes of human melanoma A375 cells (SORBS2 overexpression and control) were cultured in advance, and 5×10 6 A suspension of 100 μL of A375 cells was resuspended in 1× sterile PBS and placed on ice until ready for use. Mice were anesthetized and hair from the back to the legs was shaved with an electric shaver. 100 μL of the A375 cell suspension was injected subcutaneously using a syringe, resulting in visible skin bulges. Mice were randomly divided into a SORBS2 overexpression group and a control group. Mice were euthanized, and spleens and tumor tissues were removed. The tumor tissues were photographed and weighed. Splenic immune cells were isolated by grinding and lysing red blood cells. Mononuclear cells were isolated from the tumor using a mouse tumor mononuclear cell isolation kit and stained with antibodies for 30 minutes at 4°C. After rinsing with PBS, the cells were resuspended in 200 μL of PBS and analyzed by flow cytometry. FlowJo was used for analysis, and data were statistically analyzed and graphed using GraphPad Prism.

[0041] Macrophage induction, polarization, and co-culture experiments: THP-1 cells were treated with 100 ng / mL phorbol 12-myristate-13-acetate (PMA) for 48 hours to convert into M0 macrophages. Human melanoma A375 cells (SORBS2 overexpressing and control) were directly co-cultured with THP-1 cells to establish a model representing the melanoma immune microenvironment. Treatment with 20 ng / mL interleukin-4 (IL-4) and interleukin-13 (IL-13) induced M0 macrophages to adopt an M2 phenotype (promoting tumor growth).

[0042] Flow cytometry: Cells were collected and stained with antibodies in the dark for 30 min at 4°C. After washing, the cells were resuspended in 200 μL PBS. Cell markers were detected by flow cytometry and their changes were analyzed using FlowJo.

[0043] Experimental results ( Figure 3 Results from subcutaneous melanoma animal experiments (Figures AB) show that tumor volume and weight in the SORBS2 overexpression group were significantly smaller than those in the control group. Changes in the immune microenvironment play a crucial role in tumor development and progression. Flow cytometry analysis, shown in Figures DG, demonstrates an increase in the proportion of M1 macrophages (anti-tumor immune cells) in the spleen and tumors of melanoma-bearing mice in the SORBS2 overexpression group, while a decrease in the proportion of M2 macrophages (pro-tumor immune cells). In vitro flow cytometry analysis, shown in Figure HI, demonstrates that SORBS2 overexpression increases the proportion of M1 macrophages (anti-tumor immune cells) and significantly decreases the proportion of M2 macrophages (pro-tumor immune cells) in the melanoma immune microenvironment (co-cultured with induced mature THP-1 cells). This directly demonstrates that SORBS2 overexpression enhances anti-tumor immunity overall.

[0044] Example 4 Study on the effect of SORBS2 overexpression on melanoma metastasis Experimental methods: To establish a melanoma lung metastasis model: 5-week-old male Balb / c-nu nude mice were adaptively fed for 10 days. Human melanoma A375 cells (SORBS2 overexpression and control) were cultured in multiple dishes in advance, and 5×10 6 The suspension of cells was resuspended in 1× sterile PBS and placed on ice for later use; the mice were randomly divided into SORBS2 overexpression group and control group; the concentration of 5×10 6 A375 cells (SORBS2 overexpression and control) were injected into BALB / c-nu mice via the tail vein; the mice were euthanized, and the lung and spleen tissues were removed and photographed.

[0045] Experimental results ( Figure 4 Results from animal experiments examining melanoma lung metastasis (Figures A to C) show that tumors in mice overexpressing SORBS2 metastasized more slowly in the lungs than in the control group. Figure D shows that the spleens of mice were larger than those in the control group. Splenic enlargement is generally associated with increased inflammation, and cancer treatment requires increased inflammation. In summary, SORBS2 overexpression inhibits melanoma metastasis in vivo.

[0046] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can, without departing from the scope of the technical solution of the present invention, make some changes or modifications to equivalent embodiments using the technical contents disclosed above. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. Use of SORBS2 protein in the preparation of a drug for treating melanoma, characterized in that: The amino acid sequence of the SORBS2 protein is shown in SEQ ID NO.

3.

2. The application according to claim 1, characterized in that: The melanin treatment drug is a drug that inhibits the growth of melanoma and / or a drug that inhibits the metastasis of melanoma.

3. Use of a substance for increasing the expression of SORBS2 protein in the preparation of a drug for treating melanoma, characterized in that: The amino acid sequence of the SORBS2 protein is shown in SEQ ID NO.

3.

4. The application according to claim 3, characterized in that: The melanin treatment drug is a drug that inhibits the growth of melanoma and / or a drug that inhibits the metastasis of melanoma.

5. The application according to claim 4, characterized in that: The substance for increasing the expression of SORBS2 protein is an expression cassette containing a gene encoding SORBS2 protein, a vector expressing a gene encoding SORBS2 protein, or a host cell containing a vector expressing a gene encoding SORBS2 protein.

6. A drug for treating melanoma, characterized in that: The invention comprises a SORBS2 protein or a substance that increases the expression level of the SORBS2 protein, wherein the amino acid sequence of the SORBS2 protein is shown in SEQ ID NO.

3.

7. The drug according to claim 6, characterized in that: The melanin treatment drug is a drug that inhibits the growth of melanoma and / or a drug that inhibits the metastasis of melanoma.

8. The drug according to claim 6, characterized in that: The substance for increasing the expression of SORBS2 protein is an expression cassette containing a gene encoding SORBS2 protein, a vector expressing a gene encoding SORBS2 protein, or a host cell containing a vector expressing a gene encoding SORBS2 protein.

Images