Application of reagent for inhibiting NAT10 expression in preparation of medicine for treating chronic kidney disease

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for inhibiting NAT10 expression in preparation of a medicine for treating chronic kidney diseases. Research finds that the expression of renal tubular epithelial cell membrane channel protein SLC38A3 can be effectively reduced by inhibiting the expression of the NAT10, so that the epithelial-mesenchymal transformation and fibrosis of renal tubular epithelial cells are regulated and controlled, and finally, the chronic kidney disease progress of mice is effectively inhibited. The invention provides application of a reagent for inhibiting NAT10 expression in preparation of drugs for treating chronic kidney diseases, and further provides a new non-surgical treatment scheme for treatment of chronic kidney diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of a reagent for inhibiting NAT10 expression in the preparation of a drug for treating chronic kidney disease. Background Art

[0002] Chronic kidney disease (CKD) is a structural or functional abnormality of the kidneys caused by various factors and lasting for more than three months. Current CKD treatment focuses on preventing and treating the underlying disease and complications, as well as ameliorating risk factors for CKD progression, but long-term efficacy remains poor. Therefore, addressing the significant need to reduce the burden of chronic diseases, exploring and developing new treatments for CKD is of great significance for the prevention and treatment of CKD. Multiple processes, such as fibrosis and epithelial-mesenchymal transition, contribute to the development of CKD. Therefore, developing effective treatments for CKD targeting these mechanisms is an urgent clinical need.

[0003] N-acetyltransferase 10 (NAT10) is a member of the RNA cytidine acetyltransferase family and the only single-enzyme system proven to regulate ac4C modification. NAT10-mediated mRNA ac4C modification has been reported to be involved in multiple pathological and physiological processes, including tumorigenesis, cardiac remodeling, cell proliferation, and organ development.

[0004] Related studies have found that inhibiting NAT10 can limit tumor proliferation and metastasis by regulating epithelial-mesenchymal transition. Therefore, NAT10 may play an important role in regulating renal tubular epithelial-mesenchymal transition, renal fibrosis, and chronic kidney disease. Inhibiting NAT10 has potential clinical value in developing drugs to treat chronic kidney disease, thereby improving the clinical prognosis of chronic kidney disease. Summary of the Invention

[0005] Against this background, the present invention discovered through research that inhibiting NAT10 expression can effectively downregulate the expression of the renal tubular epithelial cell membrane channel protein SLC38A3, thereby regulating the epithelial-mesenchymal transition and fibrosis of renal tubular epithelial cells, and ultimately effectively inhibiting the progression of chronic kidney disease in mice. The present invention proposes the use of reagents that inhibit NAT10 expression in the preparation of drugs for the treatment of chronic kidney disease, thereby providing a new non-surgical treatment option for the treatment of chronic kidney disease.

[0006] The present invention provides use of a reagent for inhibiting NAT10 expression in preparing a medicine for treating chronic kidney disease.

[0007] Furthermore, the reagent for inhibiting NAT10 expression includes at least one of the NAT10 protein degradation targeting chimeric molecule NAT10-PROTAC, the NAT10 small molecule inhibitor Remodelin, interfering RNA that inhibits the expression of NAT10 protein encoding genes, shNAT10, microRNA, adenovirus or adeno-associated virus.

[0008] Furthermore, the reagent containing the inhibitory agent for NAT10 expression upregulates the expression of the epithelial cell marker E-cadherin and downregulates the expression of the fibrosis markers Fibronectin, α-SMA, Vimentin and COL1A1, thereby inhibiting the epithelial-mesenchymal transition and fibrosis of renal tubular epithelial cells, effectively inhibiting the progression of chronic kidney disease in mice.

[0009] Furthermore, the agent that inhibits NAT10 expression in the drug is the only active ingredient.

[0010] The present invention provides a medicine for treating chronic kidney disease, which contains an agent for inhibiting NAT10 expression.

[0011] Furthermore, the drug inhibits NAT10 expression and downregulates the expression of renal tubular epithelial cell membrane channel protein SLC38A3 to treat chronic kidney disease.

[0012] Furthermore, the dosage forms of the drug include oral solution, injection, tablet, pill, dispersant, capsule, dripping pill, granule, suspension, and emulsion.

[0013] The present invention provides a pharmaceutical composition for treating chronic kidney disease. The medicine is prepared from an agent that inhibits NAT10 expression and a conventional pharmaceutical carrier.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides the use of an agent that inhibits NAT10 expression in the preparation of a drug for treating chronic kidney disease. Research results show that inhibiting NAT10 can effectively downregulate the expression of the renal tubular epithelial cell membrane channel protein SLC38A3, thereby inhibiting the epithelial-mesenchymal transition and fibrosis process of renal tubular epithelial cells, and thus delaying or treating chronic kidney disease. In addition, after continuous administration of Remodelin for one month, no obvious liver, spleen, heart and kidney toxicity was observed, indicating that the drug has a certain safety. Finally, an agent that inhibits NAT10 expression and a method for treating chronic kidney disease by inhibiting NTA10 expression are proposed, providing a new solution for the drug treatment of chronic kidney disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1: These are analysis graphs of NAT10 expression in normal kidney and chronic kidney disease kidney tissues in the animal model of Example 1; A is a Western Blot experiment graph of the folic acid-induced chronic kidney disease animal model; B is a NAT10 immunohistochemical staining graph of the folic acid-induced chronic kidney disease animal model; C is a Western Blot experiment graph of the chronic kidney disease animal model established by unilateral ureteral obstruction;

[0017] Figure 2 Analytical diagrams of NAT10 expression after TGF-β1 stimulation of renal tubular epithelial cells in Example 2; A is a Western Blot experiment diagram of TGF-β1 treatment time; B is a Western Blot experiment diagram of TGF-β1 treatment concentration; C is NAT10 immunofluorescence staining;

[0018] Figure 3 In Example 3, knockdown of NAT10 alleviated TGF-β1-induced renal tubular epithelial cell fibrosis; Western Blot experiments showed that the increase in Fibronectin, Vimentin, and α-SMA protein levels in HK-2 cells induced by TGF-β1 treatment was significantly inhibited in the NAT10 knockdown group, while the decrease in E-cadherin expression induced by TGF-β1 was significantly improved;

[0019] Figure 4 NAT10 knockdown in vivo improves renal fibrosis in chronic kidney disease mice in Example 4; A is a Western Blot experiment; B is a pictorial diagram of picrosirius red staining and Masson's staining; C is a pictorial diagram of α-SMA immunofluorescence staining and Masson's staining;

[0020] Figure 5 NAT10-PROTAC reduces TGF-β1-induced renal tubular epithelial cell fibrosis in Example 5; qPCR experiments show that compared with the control group, the increase in COL1A1 mRNA levels in HK-2 cells induced by TGF-β1 treatment in the TGF-β1+NAT10-PROTAC group was significantly inhibited;

[0021] Figure 6 NAT10-PROTAC inhibits TGF-β1-induced NAT10 and SLC38A3 expression in renal tubular epithelial cells in Example 6; A is a qPCR experimental figure; B is a Western Blot experimental figure;

[0022] Figure 7 The NAT10 inhibitor Remodelin improves renal fibrosis in the folic acid model of chronic kidney disease in experimental example 1; A is a Western Blot experiment; B is a picroiridium red staining and Masson staining experiment;

[0023] Figure 8 This is the NAT10 inhibitor Remodelin improving renal fibrosis in the chronic kidney disease unilateral ureteral obstruction animal model mouse model in Experimental Example 2; A is a Western Blot experiment; B is a Fibronectin immunohistochemistry and picrosirius red staining experiment;

[0024] Figure 9 This is the safety assessment of the NAT10 inhibitor Remodelin in Experimental Example 3; A is a diagram of the appearance of the liver, spleen, heart, and kidneys; B is a diagram of renal function, liver function, liver weight to body weight ratio, and spleen weight to body weight ratio. DETAILED DESCRIPTION

[0025] Example 1

[0026] Analysis of NAT10 expression in normal kidney and chronic kidney disease kidney tissue in animal models

[0027] 1. Folic acid (FA) nephropathy model

[0028] Twenty-four male C57BL / 6J mice were randomly divided into four groups: 0-, 3-, 7-, and 14-day groups;

[0029] Folic acid was dissolved in 0.3 M sodium bicarbonate solution to make a 50 mg / ml solution. A single intraperitoneal injection of 250 mg / kg was used to induce a chronic kidney disease mouse model. Kidney tissues were collected from mice 3, 7, and 14 days after folic acid treatment.

[0030] The mice in the day 0 group were intraperitoneally injected with an equal volume of 0.3 M sodium bicarbonate solution, and the kidney tissues of the mice were collected 7 days after sodium bicarbonate treatment.

[0031] 2. Unilateral ureteral obstruction (UUO) model

[0032] Twenty-four male C57BL / 6J mice were randomly divided into four groups: 0-, 3-, 7-, and 14-day groups;

[0033] The 3-, 7-, and 14-day groups underwent unilateral ureteral ligation surgery after laparotomy to establish a chronic kidney disease mouse model, and the mouse kidney tissues were collected on days 3, 7, and 14 after surgery.

[0034] Mice in the day 0 group underwent laparotomy but no unilateral ureteral ligation surgery, and the kidney tissues of the mice were collected 7 days after laparotomy.

[0035] 3. Western Blot

[0036] 1) Tissue Protein Extraction: Kidney tissue from the folic acid (FA) nephropathy model and the unilateral ureteral obstruction (UUO) model was placed in EP tubes, added with 200 μL of RIPA lysis buffer, and thoroughly ground and lysed. Centrifuge at 12,000 rpm for 15 minutes, aspirate the supernatant, and determine the protein concentration.

[0037] 2) Protein denaturation: Add 5× protein loading buffer to the protein sample at a volume ratio of 4:1. Vortex to mix thoroughly and boil in a 100°C water bath for 10 minutes to denature the protein.

[0038] 3) SDS-PAGE gel preparation: Prepare separation gel according to the following ratio: ddH2O (3.3 mL), 30% acrylamide (4 mL), 1.5 M Tris-HCl (pH 8.8) (2.5 mL), 10% SDS (0.1 mL), 10% AP (0.1 mL), TEMED (5 μL);

[0039] Stacking gel was prepared according to the following ratio: ddH2O (2 mL), 30% acrylamide (0.5 mL), 1 M Tris-HCl (pH 6.8) (0.5 mL), 10% SDS (40 μL), 10% AP (30 μL), TEMED (4 μL);

[0040] 4) Electrophoresis and transfer: Vortex the protein sample and spot it sequentially according to the experimental plan, placing 2 μL of protein marker on each side of the gel. Run the electrophoresis at 100 V for 100 minutes. Cut the PVDF membrane and activate it in methanol. Cover the gel with the PVDF membrane in transfer buffer. Place the transfer cassette in the transfer tank and add transfer buffer. Adjust the current to 260 mA and transfer the membrane for 1 to 2 hours depending on the molecular weight of the target protein.

[0041] 5) Blocking and Primary Antibody Incubation: After transfer, place the PVDF membrane in milk blocking buffer at room temperature for 60 minutes. Wash the membrane three times with TBST, 5 minutes each time. Prepare the primary antibody and incubate the PVDF membrane in the primary antibody at 4°C overnight.

[0042] 6) Secondary Antibody Incubation and Exposure: Remove the PVDF membrane from the primary antibody and wash the membrane three times with TBST for 10 minutes each. Prepare the secondary antibody and place the PVDF membrane in the secondary antibody. Incubate at room temperature for 90 minutes. Wash the membrane three times with TBST for 10 minutes each. Prepare the ECL luminescent solution, mix the solution, and evenly cover the membrane. Place the membrane in the imaging system for exposure and image acquisition.

[0043] 4. Immunohistochemistry

[0044] 1) Preparation of paraffin tissue sections: Folate (FA) and unilateral ureteral obstruction (UUO) kidney specimens were fixed in 4% paraformaldehyde overnight at room temperature. The next day, the tissues were sequentially dehydrated in 70%, 80%, 95%, and 100% ethanol. The dehydrated tissues were then transparentized by immersing them in two equal portions of xylene. The transparentized tissues were then immersed in two equal portions of paraffin wax and embedded using a paraffin embedding machine. Mouse kidney tissues were cut into 3 μm thick paraffin sections using a paraffin microtome and adhered to glass slides.

[0045] 2) Dewaxing and Antigen Retrieval: Dewax the sections by sequentially immersing in xylene I and II, anhydrous ethanol I and II, 85% ethanol, and 75% ethanol (xylene I and II, anhydrous ethanol I and II refer to two equal portions of xylene and anhydrous ethanol in two containers; the same applies below). Wash the sections in ddH2O and soak them in 3% hydrogen peroxide to remove endogenous peroxidase. Wash the sections three times with ddH2O for 5 minutes each. Retrieve the sections in 1× Tris-EDTA antigen retrieval solution at 100°C for 3 minutes, 50°C for 5 minutes, and 30°C for 10 minutes. After antigen retrieval, place the sections at room temperature and allow them to cool naturally. Wash the sections three times with TBST for 5 minutes each.

[0046] 3) Blocking and primary antibody incubation: Add 5% donkey serum to the tissue, place the sections in a humidified chamber, and block for 1 hour at room temperature. Prepare the primary antibody, remove the donkey serum, and then add the primary antibody to the tissue. Incubate in a refrigerator at 4°C overnight.

[0047] 4) Secondary Antibody Incubation: Wash sections three times with TBST for 10 minutes each. Prepare secondary antibody and add it to the tissue, incubating at room temperature for 1 hour.

[0048] 5) DAB color development and hematoxylin nuclear staining: Prepare DAB working solution and drop it onto the tissue. Observe the staining effect under a microscope and place it in pure water to terminate color development. Add hematoxylin to the tissue to stain the cell nuclei. Rinse with tap water to restore the blue color.

[0049] 6) Mounting: Dehydrate the sections by sequentially soaking in 75% ethanol, 85% ethanol, and anhydrous ethanol I and II. Transparent the sections by soaking in xylene I and II. Air-dry in a fume hood. Mount the sections with a drop of neutral resin mounting medium. Observe and photograph under a microscope.

[0050] The results are as follows Figure 1As shown: In the folic acid-induced chronic kidney disease animal model, the renal NAT10 protein level showed a time-dependent and significant increase after folic acid treatment; the NAT10 protein expression in renal tubular epithelial cells in the folic acid treatment group was significantly increased; in the chronic kidney disease animal model constructed by unilateral ureteral obstruction, the renal NAT10 protein level showed a time-dependent and significant increase after unilateral ureteral obstruction surgery.

[0051] Example 2

[0052] Analysis of NAT10 expression in renal tubular epithelial cells stimulated by TGF-β1

[0053] 1. TGF-β1 stimulation of HK-2 cells (time gradient) model

[0054] 2.5x10 5 HK-2 cells (purchased from ATCC) were seeded in 6-well plates and stimulated with 5 ng / ml TGF-β1 for 0, 12, 24, and 48 hours, respectively. Cell samples were collected and the protein expression levels of NAT10 and Fibronectin at different time points were detected using the Western Blot method described in Example 1.

[0055] 2. TGF-β1 stimulation of HK-2 cells (concentration gradient) model

[0056] 2.5x10 5 HK-2 cells were seeded in 6-well plates and stimulated with TGF-β1 at concentrations of 0 ng / ml, 2.5 ng / ml, 5 ng / ml, and 10 ng / ml for 24 hours. Cell samples were collected and the protein expression levels of NAT10 and Fibronectin under different stimulation conditions were detected using the Western Blot method described in Example 1.

[0057] 3. Cell Immunofluorescence

[0058] 1) Slides were placed on the bottom of a 12-well plate and HK-2 cells were seeded. After the cells attached, the HK-2 cells were stimulated with 5 ng / ml TGF-β1 for 24 hours. The control group was not stimulated with TGF-β1.

[0059] 2) After the cell experiment is completed, wash the cell slides with PBS three times, 5 minutes each time. Add 4% paraformaldehyde and fix at room temperature for 15 minutes.

[0060] 3) Remove paraformaldehyde, wash the cell slides with PBS three times for 5 minutes each time, add PBS solution containing 0.3% Triton X-100, and permeabilize the membrane at room temperature for 20 minutes;

[0061] 4) Wash the cell slides with PBST three times for 5 minutes each time, add 10% donkey serum, and block at room temperature for 1 hour;

[0062] 5) Prepare the primary antibody, cover the cell slides with the primary antibody, and incubate overnight at 4°C.

[0063] 6) Wash the cell slides with PBST three times for 5 minutes each time. Prepare fluorescent secondary antibody in the dark, add it to each well, and incubate at room temperature for 1 hour.

[0064] 7) Wash the cell slides with PBST three times for 5 minutes each time, add anti-fluorescence quencher (containing DAPI) and mount the slides. Observe and photograph under a fluorescence microscope.

[0065] The results are as follows Figure 2 As shown: the NAT10 protein level in HK-2 cells treated with TGF-β1 showed a significant increase in a TGF-β1 treatment time-dependent manner; the NAT10 protein level in HK-2 cells treated with TGF-β1 showed a significant increase in a TGF-β1 treatment concentration-dependent manner; the NAT10 protein expression in the nucleus of HK-2 cells in the TGF-β1 treatment group was significantly increased.

[0066] Example 3

[0067] Knockdown of NAT10 alleviates TGF-β1-induced fibrosis in renal tubular epithelial cells

[0068] 1. Cell siRNA transfection

[0069] 1) Place 2.5x10 5 HK-2 cells were seeded in 6-well plates and transfected with siRNA when the cell density grew to 30% to 40%;

[0070] 2) Remove the original cell culture medium, wash the cells once with PBS, and add 1.5 mL of complete culture medium to each well;

[0071] 3) According to the Lipofectamine RNAiMAX instruction manual, add 2.5 μL of siRNA to 250 μL of Opti-MEM medium, mix thoroughly, and let it stand at room temperature for 5 minutes. At the same time, add 2.5 μL of Lipofectamine RNAiMAX transfection reagent to 250 μL of Opti-MEM medium, mix thoroughly, and let it stand at room temperature for 5 minutes.

[0072] 4) Thoroughly mix the two mixtures, incubate at room temperature for 20 minutes, and add to the 6-well plate containing fresh complete medium.

[0073] 5) Implement interventions and collect cell samples according to the experimental plan:

[0074] Specific intervention measures:

[0075] Control group: treated with NC-siRNA; the sequence of NC-siRNA is SEQ ID NO.1:

[0076] TTCTCCGAACGTGTCACGT;

[0077] Knockdown group: treated with NAT10-siRNA; the sequence of NAT10-siRNA is SEQ ID NO.2:

[0078] GGAATATGGTGGACTATCA;

[0079] Control + TGF-β1 group: treated with NC-siRNA and TGF-β1 (concentration 5 ng / ml, 24 h);

[0080] Knockdown + TGF-β1 group: treated with NAT10-siRNA and TGF-β1 (concentration 5 ng / ml, 24 h);

[0081] The protein levels of NAT10, E-cadherin, Fibronectin, Vimentin, and α-SMA were detected using the Western Blot method in Example 1;

[0082] The results are as follows Figure 3 As shown: In the NAT10 knockdown group, the increase in Fibronectin, Vimentin and α-SMA protein levels in HK-2 cells induced by TGF-β1 treatment was significantly inhibited, while the decrease in E-cadherin expression induced by TGF-β1 treatment was significantly improved.

[0083] Example 4

[0084] Knockdown of NAT10 in vivo improves renal fibrosis in mice with chronic kidney disease

[0085] 1. In vivo NAT10 knockdown model of folate nephropathy

[0086] Twenty-four male C57BL / 6J mice were injected with control lentivirus (shNC) (n=12) and NAT10 knockdown lentivirus (shNAT10) (n=12) through the kidney and divided into two groups;

[0087] The vectors of NAT10 knockdown lentivirus and control lentivirus are:

[0088] SLenti-U6-shRNA-CMV-EGFP-F2A-Puro-WPRE,

[0089] The shNAT10 sequence is SEQ ID NO. 3: GCTCTACTATGTTAACAGA;

[0090] Control group: kidney injection of control lentivirus plus intraperitoneal injection of an equal volume of 0.3 M sodium bicarbonate solution (n=6);

[0091] Knockdown group: kidney injection of NAT10 knockdown lentivirus plus intraperitoneal injection of an equal volume of 0.3 M sodium bicarbonate solution (n=6);

[0092] Control + folic acid group: renal injection of control lentivirus + intraperitoneal injection of folic acid (dose 250 mg / kg, concentration 50 mg / ml) (n=6);

[0093] Knockdown + folic acid group: kidney injection of NAT10 knockdown lentivirus + intraperitoneal injection of folic acid (dose 250 mg / kg, concentration 50 mg / ml) (n=6);

[0094] Mouse kidney tissues were collected 7 days after treatment with sodium bicarbonate solution or folic acid;

[0095] The protein levels of NAT10, Fibronectin, Vimentin and α-SMA were detected using the Western Blot method in Example 1.

[0096] 2. In vivo unilateral ureteral obstruction model with NAT10 knockdown

[0097] Twenty-four male C57BL / 6J mice were injected with control lentivirus (shNC) (n=12) and NAT10 knockdown lentivirus (shNAT10) (n=12) through the kidney and divided into two groups;

[0098] Control group: renal injection of control lentivirus plus laparotomy without unilateral ureteral ligation (n=6);

[0099] Knockdown group: kidney injection of NAT10 knockdown lentivirus plus laparotomy without unilateral ureteral ligation (n=6);

[0100] Control + unilateral ureteral obstruction group: renal injection of control lentivirus + unilateral ureteral ligation surgery (n=6);

[0101] Knockdown + unilateral ureteral obstruction group: renal injection of NAT10 knockdown lentivirus + unilateral ureteral ligation surgery (n=6);

[0102] Mouse kidney tissues were collected 7 days after laparotomy;

[0103] 3. Sirius red staining

[0104] 1) Dewaxing the tissue sections using the method described in Example 1 and washing the sections with ddH2O for 5 minutes;

[0105] 2) Stain the sections in picrosirius red stain for 8 minutes;

[0106] 3) Transparenting and mounting the tissue sections using the method described in Example 1, and observing and photographing them under a microscope;

[0107] 4. Masson staining

[0108] 1) Dewaxing the tissue sections using the method described in Example 1 and washing the sections with ddH2O for 5 minutes;

[0109] 2) Soak the sections in 2.5% potassium dichromate mordant overnight and rinse with tap water;

[0110] 3) Soak the sections in Weigert's iron hematoxylin solution for 1 minute. Rinse with tap water, differentiate with 1% hydrochloric acid ethanol for 1 minute, and rinse again with tap water.

[0111] 4) Stain the sections in Ponceau Acid Fuchsin for 6 minutes and rinse with tap water.

[0112] 5) Soak the sections in 1% phosphomolybdic acid solution for staining for 1 minute;

[0113] 6) After draining slightly, soak the sections in 2.5% aniline blue solution for 2-30 seconds;

[0114] 7) Immerse the sections in 1% glacial acetic acid I, 1% glacial acetic acid II, and 1% glacial acetic acid III for 8 seconds each for differentiation;

[0115] Among them, 1% glacial acetic acid I, 1% glacial acetic acid II and 1% glacial acetic acid III are placed in three containers respectively;

[0116] 8) Transparenting and mounting the tissue sections using the method described in Example 1, and observing and photographing them under a microscope;

[0117] 5. Tissue Immunofluorescence

[0118] 1) Dewaxing and antigen retrieval of tissue sections using the method described in Example 1;

[0119] 2) Perforating the tissue sections using the method described in Example 2;

[0120] 3) Blocking, primary antibody application, and secondary antibody application to the tissue sections using the method described in Example 1;

[0121] 4) Add anti-fluorescence quencher (including DAPI) and seal the slides. Observe and take pictures under a fluorescence microscope.

[0122] The results are as follows Figure 4 As shown: the increased levels of renal Fibronectin, Vimentin and α-SMA proteins induced by folic acid treatment were significantly inhibited in the NAT10 knockdown group; the renal interstitial fibrosis induced by folic acid treatment was significantly inhibited in the NAT10 knockdown group; the increased levels of renal α-SMA protein and renal interstitial fibrosis induced by unilateral ureteral obstruction were significantly inhibited in the NAT10 knockdown group.

[0123] Example 5

[0124] NAT10-PROTAC alleviates TGF-β1-induced fibrosis in renal tubular epithelial cells

[0125] 1. HK-2 cells were treated as follows:

[0126] Control group: no TGF-β1 and NAT10-PROTAC treatment;

[0127] NAT10-PROTAC group: treated with NAT10-PROTAC;

[0128] TGF-β1 group: treated with TGF-β1;

[0129] TGF-β1+NAT10-PROTAC group: treated with TGF-β1 and NAT10-PROTAC;

[0130] 2. RNA extraction, reverse transcription, and real-time quantitative polymerase chain reaction (qPCR)

[0131] 1) RNA extraction: Add 1 ml of RNA extraction solution to the cell culture plate and pipette repeatedly to transfer the solution to an EP tube. Then, add 200 μL of chloroform and shake vigorously to mix thoroughly. After standing, centrifuge at 12,000 rpm for 20 minutes.

[0132] Aspirate the supernatant and add an equal amount of isopropanol, gently invert to mix, let it stand, and centrifuge at 12,000 rpm for 15 minutes to precipitate RNA;

[0133] Discard the supernatant and add 1 ml of 75% ethanol to wash the precipitate. Centrifuge at 7500 rpm for 10 minutes. Discard the supernatant. Allow the RNA precipitate to air dry before adding 25 μL of sterile, enzyme-free water to fully dissolve the precipitate.

[0134] The concentration and purity of RNA were detected by ultra-micro spectrophotometer, and the subsequent reverse transcription reaction was performed;

[0135] 2) RNA Reverse Transcription: Use the Novozymes kit to prepare the reverse transcription reaction system: RNA (1 μg), sterile enzyme-free water (7 μL), 5× HiScript III qRT SuperMix (2 μL), for a total volume of 10 μL. Set the PCR cycler program: 37°C for 15 minutes, 85°C for 5 seconds, and store at 4°C.

[0136] 3) After reverse transcription, dilute the cDNA to 200 μL with sterile enzyme-free water and place in the refrigerator for later use;

[0137] 4) qPCR: A qPCR reaction system was prepared using a Novozymes kit: cDNA (4.4 μL), 2× ChamQ SYBR qPCR Master Mix (5 μL), 50× ROX Reference Dye 1 (0.2 μL), forward primer (10 μM) (0.2 μL), and reverse primer (10 μM) (0.2 μL). The reaction was performed under the following conditions: 95°C for 3 min; 40 cycles of (95°C for 10 sec; 60°C for 30 sec); 95°C-60°C-95°C for 15 sec, 1 min, and 15 sec).

[0138] Wherein, the primer sequences in the reaction system are shown in Table 1:

[0139] Table 1 Primer sequences Gene species sequence β-actin people SEQ ID NO.4: F: CTCACCATGGATGATGATATCGCSEQ ID NO.5: R: AGGAATCCTTCTGACCCATGC COL1A1 people SEQ ID NO.6: F: GAGGGCCAAGACGAAGACATCSEQ ID NO.7: R: CAGATCACGTCATCGCACAAC SLC38A3 people SEQ ID NO.8: F: CGGGAGCAGAGCGAACCSEQ ID NO.9: R: CAACAGTCAGATGTCTGGCCTC

[0140] The results are as follows Figure 5 As shown: In the TGF-β1+NAT10-PROTAC group, the increase in COL1A1 mRNA level in HK-2 cells induced by TGF-β1 treatment was significantly inhibited.

[0141] Example 6

[0142] NAT10-PROTAC inhibits TGF-β1-induced NAT10 and SLC38A3 expression in renal tubular epithelial cells

[0143] HK-2 cells were grouped and treated using the protocol of Example 5;

[0144] The mRNA level of SLC38A3 was detected using the qPCR method in Example 5;

[0145] The protein levels of NAT10 and SLC38A3 were detected using the Western Blot method in Example 1;

[0146] The results are as follows Figure 6As shown: in the TGF-β1+NAT10-PROTAC group, the increase in SLC38A3 mRNA level in HK-2 cells induced by TGF-β1 treatment was significantly inhibited; in the TGF-β1+NAT10-PROTAC group, the expression of NAT10 and SLC38A3 proteins in HK-2 cells was significantly inhibited.

[0147] Experimental Example 1

[0148] NAT10 inhibitor Remodelin improves renal fibrosis in a folic acid-induced chronic kidney disease model mouse model

[0149] Twenty-four male C57BL / 6J mice were randomly divided into four groups:

[0150] control group, Remodelin group, FA + control group, and FA + Remodelin group;

[0151] In the FA+ control group and FA+Remodelin group, folic acid was dissolved in 0.3 M sodium bicarbonate solution to make a 50 mg / ml solution, and a single intraperitoneal injection of folic acid at a dose of 250 mg / kg was given to establish a chronic kidney disease mouse model;

[0152] The mice in the other two groups were intraperitoneally injected with an equal volume of 0.3 M sodium bicarbonate solution;

[0153] On the second day after treatment with folic acid solution or sodium bicarbonate solution, mice in the Remodelin group and FA+Remodelin group were intraperitoneally injected with Remodelin solution (Remodelin was dissolved in 10% DMSO + 40% PEG300 + 5% Tween-80 + 45% normal saline, with a concentration of 2.5 mg / ml) at a dose of 20 mg / kg / d;

[0154] The other two groups of mice were intraperitoneally injected with an equal volume of control solution (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% normal saline), and the kidney tissues of the mice were collected after 6 consecutive days of administration;

[0155] The protein levels of NAT10, Fibronectin, Vimentin, and α-SMA were detected using the Western Blot method in Example 1;

[0156] The degree of renal interstitial fibrosis was detected by picrosirius red staining and Masson's staining in Example 4;

[0157] The results are as follows Figure 7As shown: In the FA+Remodelin intervention group, the increase in renal Fibronectin, Vimentin and α-SMA protein levels induced by folic acid treatment was significantly inhibited; the renal interstitial fibrosis induced by folic acid treatment was significantly inhibited in the FA+Remodelin intervention group.

[0158] Experimental Example 2

[0159] NAT10 inhibitor Remodelin improves renal fibrosis in a mouse model of chronic kidney disease with unilateral ureteral obstruction

[0160] Twenty-four male C57BL / 6J mice were randomly divided into four groups:

[0161] control group, Remodelin group, UUO + control group, and UUO + Remodelin group;

[0162] Mice in the UUO+ control group and UUO+Remodelin group underwent unilateral ureteral ligation surgery after laparotomy to establish a chronic kidney disease mouse model;

[0163] The mice in the other two groups underwent laparotomy but without unilateral ureteral ligation;

[0164] On the second day after laparotomy, mice in the Remodelin group and the UUO+Remodelin group were intraperitoneally injected with Remodelin solution at a dose of 20 mg / kg / d;

[0165] The other two groups of mice were intraperitoneally injected with an equal volume of control solution (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% normal saline), and the kidney tissues of the mice were collected after 6 consecutive days of administration;

[0166] The protein levels of Fibronectin, Vimentin, and α-SMA were detected using the Western Blot method in Example 1;

[0167] The degree of renal interstitial fibrosis was detected by picrosirius red staining in Example 4;

[0168] The protein expression of Fibronectin in the kidney was detected using the immunohistochemical method in Example 1;

[0169] The results are as follows Figure 8 As shown: In the Remodelin intervention group, the increase in renal Fibronectin, Vimentin and α-SMA protein levels induced by unilateral ureteral obstruction was significantly inhibited; In the Remodelin intervention group, the increase in renal Fibronectin protein level and renal interstitial fibrosis induced by unilateral ureteral obstruction were significantly inhibited.

[0170] Experimental Example 3

[0171] Safety evaluation of the NAT10 inhibitor Remodelin

[0172] Eighteen male C57BL / 6J mice were randomly divided into three groups:

[0173] Normal saline group, control group, and Remodelin group;

[0174] Mice in the Remodelin group were intraperitoneally injected with Remodelin solution at a dose of 20 mg / kg / d;

[0175] Mice in the control group were intraperitoneally injected with an equal volume of control solution (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline);

[0176] The normal saline group was intraperitoneally injected with an equal volume of normal saline. After one month of continuous administration, the body weight of the mice was measured, and the liver, spleen, heart, and kidney tissues of the mice were collected and photographed. The liver and spleen were weighed, and the ratios of liver weight / body weight and spleen weight / body weight were calculated.

[0177] Blood was collected from the three groups of mice and centrifuged at 2500 rpm for 10 minutes to obtain serum. Serum renal function (creatinine and urea nitrogen) and liver function-related indicators (alanine aminotransferase and aspartate aminotransferase) were tested using an automatic biochemical analyzer.

[0178] The results are as follows Figure 9 As shown, the appearance of various organs in the Remodelin-treated group was not significantly different from that in the saline-treated group or the control group. There were also no significant differences in renal function, liver function, liver weight to body weight ratio, and spleen weight to body weight ratio in the Remodelin-treated group compared with the saline-treated group or the control group, indicating that the drug has a certain safety profile.

[0179] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. Use of reagents that inhibit NAT10 expression in the preparation of drugs for the treatment of chronic kidney disease.

2. The use according to claim 1, characterized in that The reagent for inhibiting NAT10 expression includes at least one of a NAT10 protein degradation targeting chimeric molecule NAT10-PROTAC, a NAT10 small molecule inhibitor Remodelin, an interfering RNA that inhibits the expression of a NAT10 protein encoding gene, shNAT10, microRNA, adenovirus, or adeno-associated virus.

3. The use according to claim 2, characterized in that The reagent containing the inhibitory agent for NAT10 expression upregulates the expression of the epithelial cell marker E-cadherin and downregulates the expression of the fibrosis markers Fibronectin, α-SMA, Vimentin and COL1A1, thereby inhibiting the epithelial-mesenchymal transition and fibrosis of renal tubular epithelial cells, and effectively inhibiting the progression of chronic kidney disease in mice.

4. The use according to claim 1, characterized in that The agent that inhibits NAT10 expression in the drug is the only active ingredient.

5. A drug for treating chronic kidney disease, characterized in that: The drug contains an agent that inhibits NAT10 expression.

6. The drug according to claim 5, characterized in that The drug inhibits NAT10 expression and downregulates the expression of renal tubular epithelial cell membrane channel protein SLC38A3 to treat chronic kidney disease.

7. The drug according to claim 5, characterized in that The dosage forms of the drug include oral solution, injection, tablet, pill, dispersant, capsule, dripping pill, granule, suspension and emulsion.

8. A pharmaceutical composition for treating chronic kidney disease, characterized in that: The medicine is prepared from an agent for inhibiting NAT10 expression and a conventional pharmaceutical carrier.

Images