A salt-tolerant endophytic fungus and its application

By screening and identifying the salt-tolerant endophytic fungus Bipolaris sp. 2Y-2, a co-culture system was established, which solved the problem of unstable salt tolerance in poplar seedlings, significantly improved their resistance to salt stress, and provided an effective method for soil salinization remediation.

CN120682941BActive Publication Date: 2026-04-03SICHUAN HEALTH REHABILITATION VOCATIONAL COLLEGE
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-10
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

In existing technologies, plant endophytic fungi exhibit instability and variability in improving the salt tolerance of host plants, and their effect on improving soil salinization is limited, especially in ecological restoration tree species such as poplar, where there is a lack of effective salt-tolerant endophytic fungal resources.

Method used

A salt-tolerant endophytic fungus, Bipolaris sp. 2Y-2, was screened and identified. By establishing a co-culture system with poplar seedlings, the salt tolerance of the plants was enhanced by root irrigation with the fermentation broth of this strain. Specific measures included mycelial inoculation, liquid culture, dilution, and co-culture treatment.

Benefits of technology

It significantly improves the resistance of poplar seedlings to salt stress, reduces the Na+ content of plants under salt stress, increases chlorophyll and carotenoid content, enhances photosynthetic rate and stomatal conductance, regulates antioxidant enzyme activity, improves physiological indicators under salt stress, and provides an effective way to remediate soil salinization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120682941B_ABST
    Figure CN120682941B_ABST
Patent Text Reader

Abstract

This invention discloses a salt-tolerant endophytic fungus and its application, wherein the salt-tolerant endophytic fungus is *Cyclospora* 2Y-2 (… Bipolar sp.2Y-2), its classification is named Bipolar The strain sp. was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 2, 2025, with accession number GDMCC No:65710. This invention focuses on endophytic fungi in key ecological niches such as roots, stems, and leaves of salt-tolerant plants in the polluted area surrounding the Zigong Salt Mine. Through artificial isolation and identification, a salt-tolerant endophytic fungus strain was screened. Bipolar sp.2Y-2 can significantly improve the salt tolerance of plants, providing more effective ways to solve the problem of soil salinization remediation, and laying the foundation for the development and practical application of microbial agents.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, and more specifically, this invention relates to a salt-tolerant endophytic fungus and its applications. Background Technology

[0002] Soil salinization Salinization Soil salinization is a widespread abiotic stress in nature and a significant bottleneck currently hindering the development of ecological protection forest projects, coastal tidal flat greening projects, and seawater-irrigated agriculture and forestry. Soil salinization can disrupt the growth and physiological processes of surface plants due to difficulty in water absorption, leading to inhibited plant growth and even death.

[0003] Zigong, Sichuan, is known as the "Millennium Salt Capital." Its unique geological structure has nurtured abundant underground brine resources. The mining of salt mines inevitably causes some environmental problems. Xia Furui's ecological environment assessment of the Zigong salt mining area found that there are many brine leaks and waste accumulations in the areas surrounding the mine sites, which leads to soil salinization in these areas.

[0004] Currently, soil salinization is mainly addressed through measures such as water management adjustments, land leveling, application of large amounts of chemical fertilizers, rice paddy washing, and planting halophytes. In recent years, research has found that plant endophytic fungi can provide nutrients directly or indirectly through symbiosis with host plants, and enhance the host plant's stress resistance (such as salt tolerance, drought resistance, and cold resistance) by producing active substances or signal transduction. Furthermore, endophytic fungi can significantly alter the structure of soil microbial communities and improve soil quality. Therefore, utilizing plant endophytic fungal resources to construct a rational plant-microbe interaction system is an effective biological approach to solving soil salinization problems.

[0005] Plant endophytic fungi ( EndophytesEndophytic fungi (EHNF) refer to fungi that live within plant tissues at a specific stage of their life cycle without causing obvious disease symptoms. Plant EHNFs exhibit high species diversity and chemical structure diversity. In 1993, Stierle et al. obtained an EHNF capable of synthesizing the anticancer activity of paclitaxel from the bark of *Taxus breviscapus*, sparking a surge of research into plant EHNFs. Currently, among the 250,000 known plant species on Earth, there are over 1 million species of EHNFs. Studies have shown that infection by plant EHNFs can enhance the host plant's stress resistance, and their secondary metabolites possess antibacterial, insecticidal, anticytotoxic, and anticancer effects. As a novel resource, plant EHNFs have broad application prospects in agriculture, medicine, and the food industry. Maciá-Vicente et al. believe that environmental stress forces plants to have a closer relationship with EHNFs to adapt to adverse conditions. Therefore, with the increasing prominence of soil salinization, more and more scholars are focusing on research into EHNFs that interact with plants to enhance their salt tolerance. However, the ability of plant endophytic fungi to assist the host in resisting stress is influenced by factors such as host species, host genotype, and environment. Currently, isolated and cultured endophytic fungi account for only a very small portion of the total endophytic fungi. Many other endophytic fungi within plants, which cannot yet be isolated but can significantly improve the salt tolerance of host plants, remain to be discovered. Exogenous species, competing with native microbial communities, exhibit significant instability and variability in their ability to enhance plant salt tolerance. Finally, most current reports focus on the dominant populations of plant endophytic fungi, but some non-dominant species that play important roles, or those that work together with dominant strains to promote growth, also require further investigation.

[0006] Poplar trees, as an important ecological restoration tree species, have the characteristics of large biomass, long growth cycle, lush branches and leaves, and large root surface area compared with herbaceous plants. When they act on the environment, they can form a large green space and root network. Furthermore, by periodically harvesting their biomass, soil pollution can be gradually reduced and the soil environment can be improved, making them an ideal ecological restoration vegetation. Summary of the Invention

[0007] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0008] To achieve these objectives and other advantages of the present invention, a salt-tolerant endophytic fungus is provided, said salt-tolerant endophytic fungus being *Cyclospora* 2Y-2 (… Bipolaris sp. 2Y-2), its classification is named Bipolaris sp. was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 2, 2025, with accession number GDMCC No: 65710.

[0009] Preferably, the rDNA-ITS sequence of the salt-tolerant endophytic fungus is shown in SEQ ID NO: 1.

[0010] Preferably, after the salt-tolerant endophytic fungus is cultured on PDA medium at 28°C for 10 days, the colony is roughly round with slightly irregular edges, a fluffy surface texture, and a relatively dense distribution of mycelium. The central part is light brown, gradually transitioning to gray-green towards the periphery, with a certain gradient in color. The colony has a certain height and is raised.

[0011] Application of a salt-tolerant endophytic fungus as described above in improving plant salt tolerance.

[0012] An inoculant containing salt-tolerant endophytic fungi as described above.

[0013] Application of a microbial agent as described above in improving plant salt tolerance.

[0014] Preferably, the plant is a woody plant.

[0015] Preferably, the woody plant is a poplar.

[0016] Preferably, the application includes: adding the salt-tolerant endophytic fungus to saline soil, and then sowing the germinating plant seeds in the saline soil.

[0017] Preferably, the application includes: establishing a co-culture system between plant seedlings and the salt-tolerant endophytic fungus, and then transferring the co-culture system to saline soil for growth.

[0018] Preferably, the specific method for establishing a co-culture system between plant seedlings and the salt-tolerant endophytic fungi includes:

[0019] S1. Inoculate the mycelia of salt-tolerant endophytic fungi into PDB liquid medium and culture at 25-30℃ with shaking at 100-300 r / min for 3-10 days. After culture, remove the liquid medium, break the mycelia, and dilute with sterile water to a spore concentration of 1x10⁻⁶. 7 ~1x10 9 CFU / mL was used to obtain the bacterial fermentation broth;

[0020] S2. Plant seedlings are treated with root irrigation using microbial fermentation broth and inoculated with salt-tolerant endophytic fungi, so that the salt-tolerant endophytic fungi and plant seedlings are co-cultured.

[0021] Preferably, the salt-tolerant endophytic fungus is used to reduce Na+ in the roots, stems, and leaves of plant seedlings under salt stress. + content.

[0022] Preferably, the salt-tolerant endophytic fungus is used to increase the chlorophyll content and carotenoid content of plant seedlings under salt stress.

[0023] Preferably, the salt-tolerant endophytic fungus is used to improve the transpiration rate, net photosynthetic rate, and stomatal conductance of plant seedlings under salt stress.

[0024] Preferably, the salt-tolerant endophytic fungus is used to alleviate the abnormal response of antioxidant enzyme activity in plant seedlings caused by salt stress.

[0025] Preferably, the salt-tolerant endophytic fungus is used to reduce the proline content, malondialdehyde content, and superoxide dismutase activity in plant seedlings under salt stress, and to increase the catalase activity and peroxidase activity in plant seedlings under salt stress.

[0026] This invention has at least the following beneficial effects: This invention takes endophytic fungi in key ecological niches such as roots, stems, and leaves of salt-tolerant plants in the polluted area surrounding the Zigong Salt Mine as the research object, and screens out a salt-tolerant endophytic fungus through artificial isolation and identification. Bipolaris sp. 2Y-2, which can significantly improve the salt tolerance of plants, was experimentally verified to have an effect on the salt tolerance of poplar seedlings. The results show that the salt-tolerant endophytic fungus of this invention... Bipolaris sp. 2Y-2 can significantly improve the resistance of poplar seedlings to salt stress, providing more effective ways to solve the problem of soil salinization remediation, and laying the foundation for the development and practical application of microbial agents.

[0027] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0028] Figure 1 The figures show the morphology and microstructure of three endophytic fungal strains in Example 1 of this invention; in the figure, a is 1G-4, b is 2Y-2, and c is 8G-1.

[0029] Figure 2 This is the phylogenetic tree of strain 1G-4 from Example 1 of the present invention;

[0030] Figure 3 This is the phylogenetic tree of strain 2Y-2 from Example 1 of the present invention;

[0031] Figure 4 This is the phylogenetic tree of strain 8G-1 from Example 1 of the present invention;

[0032] Figure 5 This is a staining observation of the infection of poplar seedling roots by three endophytic fungi in Example 2 of the present invention; in the figure, a is 1G-4, b is 2Y-2, and c is 8G-1.

[0033] Figure 6The K and Na ion contents in the roots, stems, and leaves of poplar seedlings after treatment with different endophytic fungi under NaCl stress in Example 2 of this invention;

[0034] Figure 7 The photosynthetic pigment content of poplar seedlings after different endophytic fungal treatments under NaCl stress in Example 2 of the present invention includes: chlorophyll a, chlorophyll b, total chlorophyll and carotenoid content;

[0035] Figure 8 The photosynthetic gas exchange parameters of poplar seedlings after different endophytic fungal treatments under NaCl stress in Example 2 of the present invention include: transpiration rate, net photosynthetic rate, stomatal conductance, and intercellular carbon dioxide concentration.

[0036] Figure 9 The physiological indicators of stress resistance of poplar seedlings after treatment with different endophytic fungi under NaCl stress in Example 2 of the present invention include: proline (Pro), malondialdehyde (MDA) content, and superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) activities.

[0037] Figure 10 The image shows the leaf phenotypic changes of poplar seedlings inoculated with 2Y-2 (left) and uninoculated (right) under NaCl stress in Example 2 of this invention. Detailed Implementation

[0038] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0039] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0040] Example 1

[0041] A salt-tolerant endophytic fungus, wherein the salt-tolerant endophytic fungus is *Cyclospora* 2Y-2 ( Bipolaris sp. 2Y-2), its classification is named Bipolaris sp. was registered and deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 2, 2025, with accession number GDMCC No: 65710;

[0042] 1.1 Isolation and purification of endophytic fungal strains

[0043] Plant samples with good growth were selected from the salt mine pollution area of ​​Changshan Town, Rong County, Zigong City, and their roots, stems, and leaves were collected. After removing surface impurities, the samples were rinsed with sterile water and then disinfected with 75% ethanol. The plant tissues were cut into small pieces of about 1 cm in size using sterile scissors, soaked in 75% ethanol for 30-60 seconds, and rinsed 5 times with sterile water; then soaked in sodium hypochlorite (available chlorine content of 1%) for 8-10 minutes and rinsed 5 times with sterile water; and finally placed on PDA plates containing ampicillin (100 U / mL), 6 pieces per plate, 3 replicates, and incubated at 28℃. The surface disinfection effect was verified by the rinsing solution test method. Observe continuously for 5-7 days. When colonies grow on the surface of the culture medium, pick colonies with different shapes, colors and sizes and inoculate them onto new PDA medium (200g potato, 20g glucose, 15-20g agar, 1000ml distilled water) for culture. Repeat the subculturing multiple times until a single purified strain is obtained.

[0044] 1.2 Screening and Identification of Salt-Tolerant Endophytic Fungal Strains

[0045] Perforate the edges of pure culture fungal colonies using a sterile punch, making holes approximately 5 mm in diameter. Transfer the infected agar blocks to PDB liquid medium (200 g potato, 20 g glucose, 1000 ml distilled water) containing different concentrations of sodium chloride (2 wt%, 4 wt%, 6 wt%, 8 wt%, 12 wt%). Incubate at 28°C with constant shaking at 180 r / min for 3–7 days, observing the differences in fungal growth daily to screen for dominant salt-tolerant strains.

[0046] The microscopic features of the mycelium, spores, and conidiophores of the strains were observed under an optical microscope using the direct slide picking method. The ultrastructure of salt-tolerant endophytic fungi was observed using a scanning electron microscope. The dominant salt-tolerant strains were morphologically identified with reference to the "Handbook of Fungal Identification" (edited by Wei Jingchao).

[0047] Endophytic fungal DNA was extracted using a fungal genome extraction kit (Beijing Liuhe BGI Genomics Co., Ltd.). The ITS sequences of endophytic fungi were amplified using universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') / ITS4 (5'-TCCTCCGCTTATTGATATGC-3'). A 25 μL PCR amplification system was used, specifically: PCR Mix 21 μL, Primer F (5p) 1 μL, Primer R (5p) 1 μL, template 2 μL; the amplification program was: 96℃ for 5 min; 96℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min; stored at 4℃. The purified product was sent to Beijing Liuhe BGI Genomics Co., Ltd. for sequencing. The obtained sequences were compared with other fungal sequences in the NCBI database using BLAST sequence homology analysis. A phylogenetic tree was constructed using MEGA 7.0 neighbor-joining method.

[0048] 1.3 Results Analysis

[0049] Eighty-three endophytic fungi were isolated from collected plant root, stem, and leaf samples. After salt-tolerant culture, 31 endophytic fungal strains with certain salt tolerance were obtained. Finally, three dominant salt-tolerant fungal strains, 1G-4, 2Y-2, and 8G-1, were selected for further research. All three strains could grow normally in a 12wt% NaCl environment, demonstrating strong salt tolerance. The three isolated strains were inoculated onto PDA medium and cultured at 28℃ for 10 days. Colony morphology was observed, and scanning electron microscopy was used for microscopic morphological observation. Figure 1 In the figure, a represents 1G-4, b represents 2Y-2, and c represents 8G-1. See Table 1 for detailed morphological identification of the strains. Based on the description in the *Handbook of Fungal Identification*, strain 1G-4 was preliminarily identified as belonging to the genus *Penicillium*. Penicillium ), strain 2Y-2 was preliminarily identified as belonging to the genus *Cyclophorus* ( Bipolaris ), strain 8G-1 is a Fusarium genus ( Fusarium ).

[0050] To further clarify the taxonomic position of the three endophytic fungi, the phylogenetic tree results showed that ( Figure 2-4 ): 1G-4 strain and Penicilliumpaneum Strain JRO19040811 (NCBI accession number MN486545) clustered together with a similarity of 91%, indicating that strain 1G-4 is... Penicilliumpaneum Or it may be a very closely related variety ( Figure 2 ); strain 2Y-2 and Bipolariscynodontis Strain ICMP 6127 (NCBI accession number PQ203614) clustered together with a similarity of 99%, indicating that strain 2Y-2 is... Bipolariscynodontisor its most closely related species ( Figure 3 ); 8G-1 strain and Fusarium oxysporum Strain H1B (NCBI accession number MK209109) clustered together with 100% similarity, indicating a high degree of identity at the ITS sequence level, suggesting that strain 8G-1 is... Fusarium oxysporum or its most closely related species ( Figure 4 The phylogenetic analysis and morphological identification results are basically consistent.

[0051] The rDNA-ITS sequence of strain 2Y-2 is as follows:

[0052] TTTTTTCACCCATGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACCTTTTTCTTATGCAGTTTCCATCAGCGTCAGTAAAAACAATGTAATAACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGT ATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGCGTTTTTGTCTCCCTCTTTCTGGGAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACATTTTTTGCGCTTTGTATCAGGAGAAAAGGACGGTACTCCATCAAGACTTTTACAATTTTAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA.

[0053] Table 1. Morphological and colony structure characteristics of three endophytic fungi.

[0054] strain number Colony structure characteristics Scanning electron microscopy microstructure Test results 1G-4 The colonies are nearly round with regular edges, uniform growth, a velvety surface, and a loose texture. The mycelium is well-developed and dense, uniformly light brown in color, and has a certain thickness, growing in a raised shape. Numerous filamentous hyphae are branched, some hyphae have distinct septa, the hyphal surface is smooth, and there are no obvious appendages. Penicillium 2Y-2 The edges are slightly irregular, the colonies are roughly circular, the surface texture is velvety, the mycelium is relatively densely distributed, the center is light brown, gradually transitioning to grayish-green towards the periphery, showing a certain gradient in color, and the colonies have a certain height, appearing raised. Intertwined filamentous hyphae, some hyphae have textured surfaces and structures similar to spore chains. genus *Isomonia* 8G-1 The colonies are generally round in shape, grow relatively quickly, cover a large area, and have a velvety surface. The mycelium is well-developed and dense, and the color gradually changes from the center outwards, starting as light brown and gradually transitioning to light purple. The edges are lighter in color. The colonies have a certain height and grow in a raised manner. The filamentous hyphae intertwine and entwine to form a complex network structure, on which numerous conidia are distributed. Fusarium

[0055] Example 2

[0056] Application of salt-tolerant endophytic fungi in improving plant salt tolerance

[0057] 2.1 Establishment of Poplar Seedling Cultivation and Co-culture System

[0058] Populus tomentosa (Xinjiang) Populusalbavar.pyramidalisBge.The cuttings were collected from Shuanghe Nursery, Dongfeng Forest Farm, Kailu County, Inner Mongolia Autonomous Region. Poplar cuttings of uniform length and stem diameter were selected, and two buds were retained during cutting. The seedling pots had an outer diameter of 20 cm, an inner diameter of 10 cm, a base diameter of 14.2 cm, and a height of 17.3 cm. The potting soil substrate consisted of a 3:1:1 mixture of peat moss, perlite, and vermiculite, with 2 kg of the mixture prepared per pot. Proper watering, fertilization, and pest and disease management were implemented, and the plants were cultured for 60 days.

[0059] Using a sterile inoculation needle, endophytic fungal hyphae were picked and inoculated into PDB liquid medium (200 g potato, 20 g glucose, 1000 ml distilled water). The medium was incubated at 28°C with shaking at 180 rpm for 5 days. After incubation, the liquid medium was removed, the hyphae were broken, and the mixture was diluted with sterile water to a spore concentration of 1 x 10⁻⁶. 8 The concentration of CFU / mL was used to obtain the fermentation broth, which was then stored at 4°C for later use.

[0060] Fifty uniformly growing poplar seedlings were selected and divided into five treatment groups, with ten replicates per group. Three of the groups were inoculated with 1G-4, 2Y-2, and 8G-1 salt-tolerant endophytic fungi by root irrigation with inoculum fermentation solution, respectively. Ten days after inoculation, the roots of the new poplar seedlings were collected, and the colonization and infection of the fungi in the roots were observed by trypan blue staining, following the method of Padamsee et al. (Padamsee M, Johansen RB, Stuckey SA, et al. The arbuscular mycorrhizal fungi colonising roots and root nodules of New Zealand kauri Agathis australis[J]. Fungal Biology, 2016, 120(5): 807-817.). The staining process was as follows: First, the root samples from the inoculation test were fixed by soaking in 50% ethanol for 24 hours. After removal, the roots were washed three times with ultrapure water and then placed in a 5% KOH solution and heated in a 90℃ water bath for 2-3 hours to decolorize and soften the roots. The roots were then washed three more times with ultrapure water and transferred to 2% lactic acid for 1-2 minutes. They were then removed and soaked in 0.05% trypan blue solution (prepared by adding 0.05g trypan blue powder to a mixture of 33.3mL lactic acid, 33.3mL glycerol, and 33.3mL ultrapure water) for approximately 10 hours. They were then counterstained in 50% glycerol for 24 hours. After staining, the roots were cut into 0.5cm segments and observed under an optical microscope. Trypan blue staining was used, and 50% glycerol was used as a floater for slide preparation. The stained structures were observed under an optical microscope. After the endophytic fungi colonized the seedling roots, the seedlings were subjected to NaCl stress treatment at a concentration of 0.8% of the soil mass. Simultaneously, an untreated control (CK) and a control group (CK with only NaCl added but not inoculated with endophytic fungi) were established. (NaCl) Group. Before adding salt, the soil should be kept dry. The salt should be injected slowly to allow it to diffuse fully in the soil. The salt solution that seeps out of the tray should be poured back into the pot until all treatments reach the preset concentration. The stress treatment lasts for 21 days. Samples are taken and relevant indicators are measured. Each indicator is measured in 3 replicates.

[0061] 2.2 Determination of Ion Content

[0062] The roots, stems, and leaves of the treated seedlings were taken separately, blanched at 105℃ for 30 min, dried at 85℃ to constant weight, and ground into fine powder. 0.2 g of each dry powder was added to 10 mL of nitric acid and digested using a Touchwin 2.0 high-throughput intelligent microwave digester (Chengdu Aupuler Instruments Co., Ltd.). The sodium and potassium content was determined by NexION 300D ICP-MS (Perkin Elmer, USA). Each part was repeated 3 times.

[0063] 2.3 Measurement of photosynthetic indicators

[0064] The contents of photosynthetic pigments were determined by measuring chlorophyll a (Chlorophyll a, Chlorophyll b, Chlorophyll b) and carotenoids (Car) using a Solarbio assay kit, with three replicates for each data set. Photosynthetic gas exchange parameters were measured using a LI-6480 portable photosynthesis system (LI-COR, USA). The fifth fully expanded mature leaf from the top of a poplar seedling was selected as the measurement object, with three replicates for each treatment and three measurements per leaf. The average value was taken. Measurements were taken from 9:00 AM to 12:00 PM at a light intensity of 800 μmol·m⁻². -2 ·S -1 Each time an indicator is measured, three sets of data are recorded consecutively after the values ​​stabilize.

[0065] 2.4 Measurement of physiological indicators of stress resistance

[0066] The activities of POD, SOD, and CAT, as well as the contents of Pro and MDA, were determined using a Solarbio assay kit, with three replicates for each data set.

[0067] 2.5 Data Processing and Statistical Analysis

[0068] Experimental data were analyzed and plotted using Excel, SPSS 27.0, and Origin 2024 software.

[0069] 2.6 Results Analysis

[0070] Figure 5 To observe the structural characteristics of poplar seedling roots after infection with three endophytic fungi using trypan blue staining, in the figure, a represents 1G-4, b represents 2Y-2, and c represents 8G-1. Figure 5 It can be seen that 2Y-2 and 8G-1 can successfully enter the root cortical cells and form obvious infection structures, with hyphae differentiating into beaded swollen cells; while the colonization effect of 1G-4 hyphae is not significant, and the structure of hyphae can hardly be observed in the cortical cell tissue.

[0071] Figure 6 The values ​​represent the ion content in the roots, stems, and leaves of poplar seedlings after treatment with different endophytic fungi under NaCl stress. Figure 6 It can be seen that under 0.8% NaCl stress, Na + The content increased significantly, K + The Na+ content was significantly lower than that of the control group (CK). Inoculation with endophytic fungi 1G-4, 2Y-2, and 8G-1 can affect the ion homeostasis of plants under NaCl stress, but the regulatory mechanisms differ. The 2Y-2 group showed superior salt tolerance, with lower Na+ content in its roots, stems, and leaves. + The content was respectively compared with CK (NaCl) It decreased by 67.07%, 50.89%, and 79.87%, and the leaf K + The concentration was close to that of the blank control group (CK), suggesting that this strain may inhibit Na+. + Absorption to maintain K + Steady-state conditions are used to enhance salt tolerance. In contrast, although the 8G-1 group has Na+ in its roots... + The accumulation is relatively high, only higher than CK. (NaCl) The group was 7.7% lower, but its Na + The transfer coefficient is compared with CK. (NaCl) The group showed a 70.2% reduction, indicating that this strain may inhibit Na+ production. + It translocates to the above-ground parts to reduce foliar salt damage. The regulatory capacity of group 1G-4 is between the two, with Na in roots, stems, and leaves... + Content compared to CK (NaCl) The levels in the groups decreased by 23.1%, 21.5%, and 29.7% respectively, but the levels in roots and stems were significantly lower. + Content ratio of CK (NaCl) The group showed increases of 48.8% and 78.5%, indicating that this strain may partially inhibit Na+. + Accumulate and promote K + It can be absorbed to alleviate salt stress, but its effect is weaker than 2Y-2 and 8G-1.

[0072] Figure 7 The photosynthetic pigment content (chlorophyll a, chlorophyll b, total chlorophyll, and carotenoids) of poplar seedlings under different endophytic fungal treatments under NaCl stress was analyzed. The characteristics of photosynthetic pigment metabolism in poplar seedlings under different treatments were also analyzed. Figure 7 This indicates a significant difference in photosynthetic pigment content among the treatment groups, with the concentration gradient as follows: CK > 2Y-2 > 8G-1 > 1G-4 > CK (NaCl) 0.8% NaCl stress significantly inhibited photosynthetic pigment synthesis in seedling leaves. CK (NaCl)Compared with the control group (CK), the total chlorophyll content (Chl a+b) decreased by 26.39%, carotenoid (Car) content decreased by 37.93%, and the chlorophyll a / b ratio decreased by 14.41%. Inoculation with three endophytic fungi alleviated this downward trend and effectively reversed the pigment degradation induced by salt stress. Among them, strains 2Y-2 and 8G-1 showed significant effects, reaching the level of the CK group, with their Chl a+b contents significantly higher than those of the salt stress control group (CK). (NaCl) The chlorophyll a+b ratio increased by 40.25% and 23.89%, respectively, while the carb content increased by 50.00% and 33.33%, respectively. At the same time, the chlorophyll a / b ratio increased by 17.33% and 13.37%. Although the 1G-4 treatment group showed an increasing trend in Chl a+b and carb, it did not reach a significant level (P>0.05).

[0073] Figure 8 To measure the photosynthetic gas exchange parameters of poplar seedlings treated with different endophytic fungi under NaCl stress, transpiration rate (Tr), net photosynthetic rate (Pn), stomatal conductance (Gs), and intercellular CO2 concentration (Ci) were measured to compare the differences in photosynthetic efficiency of different endophytic fungi in alleviating salt stress. Under 0.8% NaCl stress, the effects of the three endophytic fungal inoculation treatments on the photosynthetic gas exchange parameters of poplar seedlings showed a gradient of differences. Compared with the control group, the control group showed significantly higher photosynthetic gas exchange parameters. (NaCl) The values ​​of Tr, Pn, and Gs in the 2Y-2 treatment group all decreased significantly, by 47.79%, 66.81%, and 23.73%, respectively, while Ci increased by 5.59%. The 2Y-2 treatment group showed the most significant increases in Tr, Pn, and Gs compared to the CK group. (NaCl) The levels of Ci in the 8G-1 treatment group increased by 128.81%, 332.05%, and 161.54%, respectively, and were higher than those in the CK group. The above indicators in the 8G-1 treatment group showed no significant difference from those in the CK group (P>0.05). Although the 1G-4 treatment group showed a positive change, it did not reach the baseline level of the CK group. After inoculation treatment, the upward trend of Ci was alleviated, but the degree of alleviation was not significantly different from that in the CK group.

[0074] Figure 9 Physiological indicators of stress resistance in poplar seedlings after treatment with different endophytic fungi under NaCl stress. Figure 9It was found that under 0.8% NaCl stress, inoculation with three endophytic fungi significantly affected the changes in stress resistance physiological indicators of poplar seedlings. By measuring the contents of proline (Pro) and malondialdehyde (MDA), and the activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), the role of endophytic fungi in alleviating salt stress was systematically evaluated, and their regulatory mechanisms on plant antioxidant capacity and cell membrane stability were explored.

[0075] Changes in Pro and MDA contents reflect the regulatory effects of endophytic fungi on the osmotic regulation capacity and cell membrane stability of poplar seedlings, respectively. CK (NaCl) The Pro and MDA contents in the inoculated group were significantly higher than those in the control group, with increases of 235.65% and 70.02%, respectively. This indicates that salt stress induced the accumulation of proline and increased membrane lipid peroxidation in poplar seedlings, which is a self-protective mechanism for plants to cope with adversity. After inoculation with 1G-4, 2Y-2, and 8G-1, respectively, the increase in Pro and MDA contents was alleviated. The Pro content in the inoculated group was significantly higher than that in the control group. (NaCl) The levels in the inoculated groups decreased by 16.85%, 55.25%, and 52.81%, respectively; the MDA content in the inoculated group was lower than that in the control group. (NaCl) The groups decreased by 23.05%, 22.72%, and 44.05%, respectively.

[0076] SOD, CAT, and POD are three important protective enzymes in the plant's enzymatic defense system. Changes in their activity reflect the regulatory effect of endophytic fungi on the antioxidant capacity of poplar seedlings. The three work synergistically to ensure the plant's resistance to O2. - It has the ability to clear scavenging substances and protect cells from damage, thereby improving the plant's ability to resist salt stress. Under 0.8% NaCl stress, compared with the blank control CK group, the salt stress CK group... (NaCl) The SOD activity in the control group showed a significant induction effect, with an increase of 48.36%, while CAT and POD activities decreased significantly by 37.41% and 56.55%, respectively. Endophytic fungal inoculation significantly alleviated the abnormal response of antioxidant enzyme activity induced by salt stress: the 2Y-2 strain treatment group showed the most significant regulatory effect on SOD activity, restoring it to the level of the non-stress control group; regarding the recovery of CAT activity, the 8G-1 treatment group showed the highest regulatory efficacy, with its activity significantly higher than that of the CK group. (NaCl) The group showed a 67.99% increase in POD activity; while the 2Y-2 treatment group exhibited a significant recovery of 130.66%, also reaching the level of the non-stress control group. These results indicate that different endophytic fungal strains effectively enhance the physiological adaptability of host plants to salt stress by differentially regulating the antioxidant enzyme system.

[0077] Figure 10The image shows the phenotypic changes in leaves of poplar seedlings inoculated with 2Y-2 (left) and uninoculated (right) under NaCl stress. The leaves of the 2Y-2 inoculated group were bright green and had normal morphology; while the leaves of the uninoculated group (CK) were... (NaCl) The leaves of the group showed signs of salt stress, with dry edges and localized yellowing.

[0078] In summary, endophytic fungi introduced by externally inoculating three strains of fungi can significantly alleviate the damage caused by NaCl stress to Populus tomentosa seedlings in Xinjiang through a multi-dimensional physiological regulatory strategy. Regarding ion homeostasis regulation, this can be achieved by increasing K+ levels. + / Na + Compared to other strains, it effectively maintains intracellular ion balance; at the level of photosynthetic system protection, it enhances the plant's light energy capture and conversion efficiency by regulating photosynthetic pigment content; in the oxidative stress defense system, it activates SOD and POD activity to strengthen ROS scavenging ability, while reducing MDA content to maintain cell membrane integrity and regulating Pro accumulation levels to avoid ineffective consumption of metabolic resources. Furthermore, different strains showed significant differences in their regulatory effects on poplar salt tolerance. Among them, strain 2Y-2 showed the most outstanding performance in promoting salt adaptation in Xinjiang poplar seedlings, followed by strain 8G-1, while strain 1G-4 had a relatively weak mitigating effect.

[0079] The present invention separates and screens Bipolaris sp. 2Y-2 is most effective in improving plant salt tolerance and can be used to enhance the salt tolerance of host plants, including reducing Na+ in the roots, stems, and leaves of seedlings under salt stress. + The invention increases the chlorophyll and carotenoid content of plant seedlings under salt stress, improves the transpiration rate, net photosynthetic rate, and stomatal conductance of plant seedlings under salt stress, decreases the proline content, malondialdehyde content, and superoxide dismutase activity of plant seedlings under salt stress, and increases the catalase and peroxidase activities of plant seedlings under salt stress, thus alleviating the abnormal antioxidant enzyme activity response caused by salt stress; furthermore, the invention... Bipolaris sp. 2Y-2 can be used to prepare products that improve plant salt tolerance, such as inoculants and drugs, providing more effective ways to solve the problem of soil salinization remediation, and laying the foundation for the development and practical application of microbial inoculants.

[0080] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A salt-tolerant endophytic fungus, characterized in that, The salt-tolerant endophytic fungus is *Cyclospora* 2Y-2 (… Bipolaris sp. 2Y-2), its classification is named Bipolaris sp. was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 2, 2025, with accession number GDMCC No: 65710.

2. The application of a salt-tolerant endophytic fungus as described in claim 1 in improving plant salt tolerance, characterized in that, The plant in question is a poplar.

3. The application as described in claim 2, characterized in that, A co-culture system was established between plant seedlings and the salt-tolerant endophytic fungi, and then the co-culture system was transferred to saline soil for growth.

4. The application as described in claim 3, characterized in that, Specific methods for establishing a co-culture system between plant seedlings and the aforementioned salt-tolerant endophytic fungi include: S1. Inoculate the mycelia of salt-tolerant endophytic fungi into PDB liquid medium and culture at 25-30℃ with shaking at 100-300 r / min for 3-10 days. After culture, remove the liquid medium, break the mycelia, and dilute with sterile water to a spore concentration of 1x10⁻⁶. 7 ~1x10 9 CFU / mL was used to obtain the bacterial fermentation broth; S2. Plant seedlings are treated with root irrigation using microbial fermentation broth and inoculated with salt-tolerant endophytic fungi, so that the salt-tolerant endophytic fungi and plant seedlings are co-cultured.

5. The application as described in claim 2, characterized in that, The salt-tolerant endophytic fungi are used to reduce Na+ in the roots, stems, and leaves of plant seedlings under salt stress. + content; The salt-tolerant endophytic fungi are used to increase the chlorophyll and carotenoid content of plant seedlings under salt stress.

6. The application as described in claim 2, characterized in that, The salt-tolerant endophytic fungi are used to improve the transpiration rate, net photosynthetic rate, and stomatal conductance of plant seedlings under salt stress.

7. The application as described in claim 2, characterized in that, The salt-tolerant endophytic fungus is used to alleviate the abnormal response of antioxidant enzyme activity in plant seedlings caused by salt stress.

Citation Information

Patent Citations

  • Endophytic fungus and application thereof

    CN119410497A