Recombinant corynebacterium glutamicum with hyaluronic acid hydrolase displayed on surface as well as construction method and application of recombinant corynebacterium glutamicum
By introducing fusion proteins into Corynebacterium glutamicum for surface display of hyaluronan hydrolase, the problems of long culture cycle and endotoxin interference in yeast surface display were solved, and efficient and reusable enzyme immobilization was achieved, which is suitable for the fields of cosmetics and pharmaceuticals.
Patent Information
- Application Number
- CN202510858073.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-25
- Publication Date
- 2025-09-23
AI Technical Summary
In the existing technology, the surface display of hyaluronan hydrolase is mainly carried out in yeast, which has the disadvantages of long culture cycle, endotoxin interference and phage influence, making it difficult to meet the needs of industrial production, and the enzyme activity is affected.
A fusion protein containing an anchor protein and hyaluronan hydrolase is introduced into Corynebacterium glutamicum, and the enzyme is immobilized and expressed through surface display technology. Anchor proteins such as NCgl1307, NCgl2775, NCgl0717 or NCgl1337 and their truncations are combined with rigid connecting peptides to achieve the maintenance and reuse of efficient enzyme activity.
It shortens the culture time, eliminates endotoxin interference, maintains high enzyme activity, conforms to the concept of green development, and is suitable for application in the fields of cosmetics and pharmaceuticals.
Smart Images
Figure CN120683031A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology and genetic engineering, and in particular to a recombinant Corynebacterium glutamicum displaying hyaluronan hydrolase on its surface, and a construction method and application thereof. Background Art
[0002] Hyaluronic acid (HA) is a naturally occurring high-molecular-weight polysaccharide composed of alternating D-glucuronic acid and N-acetyl-D-glucosamine. It is widely present in animal tissues, intercellular matrix, and some microorganisms. Due to its unique biophysical properties, such as excellent water retention, viscoelasticity, and biocompatibility, HA has a wide range of applications in cosmetics, medical treatment, tissue engineering, and other fields.
[0003] Hyaluronan hydrolases are a class of enzymes that catalyze the degradation of HA by hydrolyzing the glycosidic bonds within the HA molecule, breaking it down into low-molecular-weight hyaluronic acid or oligosaccharides. Hyaluronan hydrolases are widely found in animal tissues and some venoms. Hyaluronan hydrolases have been widely used in the medical and cosmetic fields: mammalian testicular hyaluronan hydrolase (BTH) is used to dissolve HA fillers to eliminate filler-related complications; recombinant human hyaluronan hydrolase (rHuPH20) preparations can be administered therapeutically via subcutaneous injection, providing patients with improved therapeutic effects.
[0004] Surface display technology fuses exogenous protein genes with cell surface protein genes, allowing the exogenous proteins to be expressed and anchored on the surface of microbial cells. It integrates expression, purification, and immobilization, eliminating the tedious steps of extracting, purifying, and immobilizing secreted proteins. Furthermore, it is easily recyclable and reusable, making it widely used in biotechnology and bioengineering, including vaccine development, protein engineering, biocatalysis, and biofuel production.
[0005] Currently, most research on the surface display of hyaluronan hydrolases is conducted using yeast as a host. Although the yeast surface display system is more conducive to the expression of hyaluronan hydrolases from eukaryotic organisms, yeast itself has the disadvantage of a long culture cycle, which takes approximately 6-7 days to culture, greatly increasing the time cost and being unfavorable for industrial production and utilization. If Gram-negative bacteria such as Escherichia coli with a short growth cycle are used as hosts, the enzymatic activity of hyaluronan hydrolases will be affected to a certain extent and will also be affected by endotoxins, which is not in line with the concept of green development. In addition, the strain is easily interfered with by bacteriophages during the culture process, which increases the instability factor in the culture process. Summary of the Invention
[0006] In response to the current problems with the surface display of hyaluronan hydrolase, the present invention provides a new method for displaying hyaluronan hydrolase on the surface of Corynebacterium glutamicum. This method can not only shorten the time cost of culturing the host strain and eliminate the interference of endotoxins, but also maintain a high enzymatic activity of hyaluronan hydrolase, which is in line with the green and safe development concept.
[0007] The specific technical solutions are as follows:
[0008] In the first aspect of the present invention, a recombinant Corynebacterium glutamicum displaying hyaluronan hydrolase on its surface is provided, wherein a gene encoding a fusion protein is introduced into the recombinant Corynebacterium glutamicum, wherein the fusion protein comprises an anchor protein and hyaluronan hydrolase, and the anchor protein is selected from: NCgl1307, NCgl2775, NCgl0717, NCgl1337 or a truncation thereof.
[0009] In some embodiments of the present invention, the hyaluronan hydrolase is a hyaluronan hydrolase derived from Penicillium funiculosum, and its coding sequence is as shown in SEQ ID NO:2 or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more homology with SEQ ID NO:2.
[0010] Specifically, the coding sequence of NCgl1307 is as shown in SEQ ID NO: 7, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more homology to SEQ ID NO: 7. In some embodiments of the present invention, the coding sequence of the truncation of NCgl1307 (NCgl1307s) is as shown in SEQ ID NO: 10, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more homology to SEQ ID NO: 10.
[0011] Specifically, the coding sequence of NCgl2775 is as shown in SEQ ID NO: 8, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more homology to SEQ ID NO: 8. In some embodiments of the present invention, the coding sequence of the truncation of NCgl2775 (NCgl2775s) is as shown in SEQ ID NO: 11, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more homology to SEQ ID NO: 11.
[0012] Specifically, the coding sequence of NCgl0717 is as shown in SEQ ID NO: 9, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or greater homology to SEQ ID NO: 9. In some embodiments of the present invention, the coding sequence of a truncated form of NCgl0717 (NCgl0717s) is as shown in SEQ ID NO: 12, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or greater homology to SEQ ID NO: 12.
[0013] Specifically, the coding sequence of NCgl1337 is as shown in SEQ ID NO: 5, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more homology to SEQ ID NO: 5. In some embodiments of the present invention, the coding sequence of the truncation of NCgl1337 (NCgl1337s) is as shown in SEQ ID NO: 13, or has 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% or more homology to SEQ ID NO: 13.
[0014] In some embodiments of the present invention, in the fusion protein, the anchor protein and the hyaluronan hydrolase are connected by a connecting peptide, for example, the N-terminus of the anchor protein is connected to the C-terminus of the hyaluronan hydrolase via a connecting peptide, or the C-terminus of the anchor protein is connected to the N-terminus of the hyaluronan hydrolase via a connecting peptide. In some preferred embodiments of the present invention, the connecting peptide is a rigid connecting peptide, which can be any suitable known rigid connecting peptide, for example (EAAAK) n , n=1-3, (XP) m, m=5-20, X can be any amino acid, such as alanine (Ala), lysine (Lys) or glutamic acid (Glu), A(EAAAK)4ALEA(EAAAK)4A, AEAAAKEAAAKA, PAPAP, PAPAPPAPAP, as described in Chen X, Zaro JL, Shen WC. Fusion protein linkers: property, design and functionality. Adv Drug Deliv Rev. 2013 Oct; 65(10): 1357-69. Specifically, the amino acid sequence of the connecting peptide is PAPAPPAPAP (SEQ ID NO: 15).
[0015] In some preferred embodiments of the present invention, in the fusion protein, the anchoring protein is NCgl1337.
[0016] In a further preferred embodiment of the present invention, in the fusion protein, the anchoring protein is a truncated form of NCgl1337 (NCgl1337s).
[0017] In a further preferred embodiment of the present invention, in the fusion protein, the anchoring protein is a truncated form of NCgl1337 (NCgl1337s), and the anchoring protein and the hyaluronan hydrolase are connected via a rigid linker peptide (such as PAPAPPAPAP).
[0018] Specifically, the recombinant strain may also express a solubility-promoting tag, such as maltose binding protein (MBP).
[0019] In the second aspect of the present invention, a recombinant vector is provided, which comprises a coding sequence of a fusion protein, wherein the fusion protein comprises an anchoring protein and a hyaluronan hydrolase, and the anchoring protein is selected from: NCgl1307, NCgl2775, NCgl0717, NCgl1337 or a truncate thereof.
[0020] Specifically, the fusion protein and its coding sequence are as described in the first aspect of the present invention.
[0021] Specifically, the recombinant vector is a plasmid, in particular a plasmid suitable for gene expression in Corynebacterium glutamicum, such as pEC-XK99e.
[0022] In the third aspect of the present invention, a method for displaying hyaluronan hydrolase on the surface of Corynebacterium glutamicum / a method for constructing the recombinant Corynebacterium glutamicum described in the first aspect is provided, which comprises the step of introducing a gene encoding a fusion protein (such as through an expression vector) into the host Corynebacterium glutamicum, wherein the fusion protein comprises an anchor protein and a hyaluronan hydrolase, and the anchor protein is selected from: NCgl1307, NCgl2775, NCgl0717, NCgl1337 or a truncation thereof.
[0023] Specifically, the method further comprises the step of constructing a gene encoding a fusion protein, for example, by fusing the anchor protein and the hyaluronan hydrolase in an expression vector (using seamless cloning technology).
[0024] Specifically, the fusion protein and its coding sequence are as described in the first aspect of the present invention.
[0025] Specifically, the expression vector is as described in the second aspect of the present invention.
[0026] Specifically, the method further comprises the step of inducing expression, such as adding an inducer (such as isopropylthiogalactoside (IPTG)) to the culture of the recombinant Corynebacterium glutamicum.
[0027] In some embodiments of the present invention, the method comprises the steps of:
[0028] (1) Constructing a recombinant vector for fusion expression of anchoring protein and hyaluronan hydrolase;
[0029] (2) transferring the recombinant vector obtained in step (1) into the host Corynebacterium glutamicum;
[0030] (3) Cultivating the recombinant Corynebacterium glutamicum obtained in step (2) and inducing the expression of the fusion protein.
[0031] Optionally, (4) collecting the bacterial cells.
[0032] More specifically, step (1) may include the following steps:
[0033] (1-1) amplifying the ankyrin gene and the hyaluronan hydrolase gene, respectively (e.g., by PCR);
[0034] (1-2) The anchoring protein gene and the hyaluronan hydrolase gene are integrated into an expression vector (eg, by seamless cloning technology) to construct a recombinant vector.
[0035] In a fourth aspect of the present invention, there is provided use of the recombinant Corynebacterium glutamicum described in the first aspect in any of the following:
[0036] 1) Preparation of whole-cell catalysts;
[0037] 2) Hydrolyzing hyaluronic acid to prepare low molecular weight hyaluronic acid and hyaluronic acid oligosaccharides.
[0038] Specifically, the low molecular weight hyaluronic acid is a hyaluronic acid with a molecular weight of ≤100 kDa (e.g., 80, 60, 50, 40, 20, 10, 8, 6, 5, 4, 3, 2, 1k, 800, 600, 500 Da), such as a hyaluronic acid with a molecular weight of ≤10 kDa, a hyaluronic acid with a molecular weight of 5-10 kDa, a hyaluronic acid with a molecular weight of 3-5 kDa, and a hyaluronic acid with a molecular weight of 800-2000 Da.
[0039] In a fifth aspect of the present invention, a whole-cell catalyst is provided, which is prepared by a method comprising the following steps: inducing expression of the recombinant Corynebacterium glutamicum described in the first aspect, collecting the bacteria, and obtaining the whole-cell catalyst.
[0040] Specifically, the inducing expression comprises: adding an inducer (such as IPTG) to the culture of the recombinant Corynebacterium glutamicum.
[0041] Specifically, the temperature for inducing expression can be 20-40°C (such as 25, 26, 28, 30, 32, 34, 35, 36, 38°C), especially 28-32°C.
[0042] Specifically, the time for inducing expression can be 12-24 hours (such as 12, 14, 16, 18, 20, 22, 24 hours), especially 16-18 hours.
[0043] Specifically, the induction of expression is performed under shaking (eg, 200 rpm).
[0044] In a sixth aspect of the present invention, a method for hydrolyzing hyaluronic acid, preparing low-molecular-weight hyaluronic acid and hyaluronic acid oligosaccharides is provided, which comprises the step of contacting the recombinant Corynebacterium glutamicum described in the first aspect or the whole-cell catalyst described in the fifth aspect with hyaluronic acid.
[0045] Specifically, the method comprises: mixing the recombinant Corynebacterium glutamicum described in the first aspect or the whole-cell catalyst described in the fifth aspect with hyaluronic acid, and performing an enzymatic hydrolysis reaction.
[0046] More specifically, the reaction system further includes a solvent, such as water or a buffer solution.
[0047] More specifically, the concentration of hyaluronic acid in the reaction system is 1-50 mg / mL (e.g., 1, 5, 6, 8, 10, 12, 14, 15, 20, 30, 40, 50 mg / mL), especially 5-20 mg / mL.
[0048] More specifically, the ratio of the recombinant Corynebacterium glutamicum or whole-cell catalyst (based on wet bacteria) to the substrate hyaluronic acid in the reaction system is 1-10 mL:1-100 mg (for example, 1 mL:1 mg, 1 mL:5 mg, 1 mL:10 mg, 1 mL:20 mg, 1 mL:40 mg, 1 mL:50 mg, 2 mL:1 mg, 2 mL:5 mg, 2 mL:10 mg, 2 mL:20 mg, 2 mL:40 mg, 2 mL:50 mg, 5 mL:1 mg, 5 mL:5 mg, 5 mL:10 mg, 5 mL:20 mg, 5 mL:40 mg, 5 mL:50 mg).
[0049] More specifically, the pH of the reaction system is 2-6 (eg, 2, 2.5, 3, 3.5, 4, 5, 6), especially 2-4.
[0050] More specifically, the temperature of the enzymatic hydrolysis reaction is 20-50°C (e.g., 25, 30, 35, 38, 40, 41, 42, 43, 44, 45, 48, 50°C), especially 40-45°C.
[0051] More specifically, the enzymatic hydrolysis reaction time is 0.5-48 hours (e.g., 1, 6, 12, 18, 24, 30, 36, 42, 48 hours), especially 12-36 hours.
[0052] Specifically, the method may further include an enzyme inactivation step, such as heating, and the inactivation temperature may be 60-100° C. (such as 70, 80, 90, 95, 100° C.).
[0053] In some embodiments of the present invention, the method comprises the steps of:
[0054] (1) preparing a solution containing hyaluronic acid and / or hyaluronate, adding the recombinant Corynebacterium glutamicum described in the first aspect or the whole-cell catalyst described in the fifth aspect, and performing an enzymatic hydrolysis reaction;
[0055] (2) inactivating the enzymatic hydrolysis solution obtained in step (1) and separating the enzymatic hydrolysis product.
[0056] The present invention provides a recombinant Corynebacterium glutamicum that displays hyaluronan hydrolase on its surface, and a method for constructing the same. Using surface display technology, the hyaluronan hydrolase gene is fused with genes for different anchoring proteins, and then introduced into Corynebacterium glutamicum for surface display, thereby obtaining a recombinant Corynebacterium glutamicum with hyaluronan hydrolysis activity on its surface. By optimizing the anchoring proteins, connecting peptides, and the like, a recombinant Corynebacterium glutamicum with ultrahigh hyaluronidase activity is obtained. This strain can achieve efficient immobilization and reuse of the hyaluronan hydrolase, while eliminating the tedious steps of enzyme purification and shortening the production cycle. The strain has excellent application prospects in the fields of cosmetics and pharmaceuticals. BRIEF DESCRIPTION OF THE DRAWINGS
[0057] Figure 1 Shown are fluorescence images of GFP protein expressed by Corynebacterium glutamicum under blue light irradiation; wherein, A is a blank control; B is a GFP protein expressed by Corynebacterium glutamicum.
[0058] Figure 2 The figure shows the SDS-PAGE image of MBP-PfHAase; wherein, M stands for maker; lane 1 represents the bacterial pellet after bacterial disruption; lane 2 represents the supernatant after bacterial disruption; lane 3 represents the flow-through of the Ni column after bacterial disruption; lane 4 represents the PBS rinse solution; lane 5 represents the 25 mM imidazole rinse solution; lane 6 represents the target protein band.
[0059] Figure 3 Shown is the TLC chart of HA degradation by MBP-PfHAase.
[0060] Figure 4 Shown are the PCR steps used in Example 4.
[0061] Figure 5Shown are flow cytometry results (display effects of different anchoring proteins on HA hydrolase with MBP tag); among them, all black curves in AJ diagram represent control group, and pink curves represent experimental group; A represents anchoring protein NCgl1337 displaying PfHAase with MBP tag (abbreviated as NCgl1337-MBP-PfHAase); B represents NCgl1337s-MBP-PfHAase; C represents PsgA-MBP-PfHAase; D represents NCgl1221-MBP-PfHAase; E represents NCgl0717-MBP-PfHAase; F represents NCgl0717s-MBP-PfHAase; G represents NCgl1307-MBP-PfHAase; H represents NCgl1307s-MBP-PfHAase; I represents NCgl2775-MBP-PfHAase; J represents NCgl2775s-MBP-PfHAase.
[0062] Figure 6 Shown are agarose gel electrophoresis images (comparison of surface-displayed enzyme activities of different anchored proteins / truncated proteins); wherein, lane 1 represents the truncated anchored protein NCgl1307 displaying PfHAase with MBP tag (abbreviated as NCgl1307s-MBP-PfHAase); lane 2 represents NCgl1307-MBP-PfHAase; lane 3 represents NCgl2775s-MBP-PfHAase; lane 4 represents NCgl2775-MBP- PfHAase; lane 5 represents NCgl0717s-MBP-PfHAase; lane 6 represents NCgl0717-MBP-PfHAase; lane 7 represents NCgl1221-MBP-PfHAase; lane 8 represents PsgA-MBP-PfHAase; lane 9 represents NCgl1337s-MBP-PfHAase; lane 10 represents NCgl1337-MBP-PfHAase; lane 11 represents blank control.
[0063] Figure 7 Shown are the predicted transmembrane domains of the anchoring proteins NCgl1307, NCgl2775, NCgl0717, and NCgl1337; wherein A is the anchoring protein NCgl1337; B is the anchoring protein NCgl1307; C is the anchoring protein NCgl2775; and D is the anchoring protein NCgl0717.
[0064] Figure 8Shown are the three-dimensional structures of the anchoring proteins NCgl1307, NCgl2775, NCgl0717, and NCgl1337; the red-marked parts represent the truncated and retained parts; A is the anchoring protein NCgl1307; B is the anchoring protein NCgl2775; C is the anchoring protein NCgl0717; and D is the anchoring protein NCgl1337.
[0065] Figure 9 Shown are flow cytometry results (display effect of NCgl1337 / NCgl1337s on HA hydrolase); in Figures A and B, all black curves represent the control group, and the pink curves represent the experimental group; A represents the truncated anchor protein NCgl1337 displaying PfHAase without the MBP tag (abbreviated as NCgl1337s-PfHAase); B represents NCgl1337-PfHAase.
[0066] Figure 10 Shown is an agarose gel electrophoresis diagram (comparison of NCgl1337 / NCgl1337s for surface-displayed enzyme activity); wherein, lane 1 is a blank control; lane 2 represents the truncated anchor protein NCgl1337 displaying PfHAase (abbreviated as NCgl1337s-PfHAase); and lane 3 represents NCgl1337-PfHAase.
[0067] Figure 11 Shown are flow cytometry results (the effect of adding rigid / flexible linker peptides on the display of HA hydrolase); among them, all black curves in Figures A and B represent the control group, and the pink curve represents the experimental group; A represents the truncated anchor protein NCgl1337 with the addition of a flexible linker peptide to display PfHAase without the MBP tag (abbreviated as NCgl1337s-flexible linker peptide-PfHAase); B represents NCgl1337s-rigid linker peptide-PfHAase.
[0068] Figure 12 Shown are agarose gel electrophoresis images (comparison of surface-displayed enzyme activity after addition of rigid / flexible linker peptides); lane 1 is a blank control; lane 2 represents NCgl1337s-flexible linker peptide-PfHAase); lane 3 represents NCgl1337s-PfHAase; lane 4 represents NCgl1337s-rigid linker peptide-PfHAase. DETAILED DESCRIPTION
[0069] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention relates.
[0070] In the present invention, the term "oligosaccharide" refers to a carbohydrate composed of 2-10 monosaccharide molecules connected by glycosidic bonds, also known as oligosaccharides; the term "polysaccharide" refers to a polymeric carbohydrate composed of more than 10 monosaccharides.
[0071] The disclosures of various publications, patents, and published patent specifications cited herein are incorporated by reference in their entirety.
[0072] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.
[0073] Example 1: Determining whether a surface-displayed vector plasmid can express proteins in Corynebacterium glutamicum
[0074] The GFP (green fluorescent protein, whose gene sequence is shown in SEQ ID NO: 1) gene was cloned into the plasmid pEC-XK99e using seamless cloning technology, and the RBS binding site AAGGAGGATATACAT was added before the GFP gene, and a His tag was added after the GFP gene. The constructed plasmid was sequenced, and the GFP-pEC-XK99e recombinant plasmid was successfully constructed.
[0075] The correctly sequenced recombinant plasmid was introduced into competent cells of Corynebacterium glutamicum ATCC13032 by electroporation (1.8 kV, 5 ms).
[0076] To 5 mL of LBB medium (10 g / L trypsin, 5 g / L yeast extract, 5 g / L sodium chloride, and 10 g / L BHI), 2.5 μL of 100 μg / mL kanamycin (Kan) was added, and the bacterial liquid of Corynebacterium glutamicum containing the GFP-pEC-XK99e recombinant plasmid was inoculated and cultured overnight at 30°C with vigorous shaking at 200 rpm.
[0077] The overnight culture was inoculated into 100 mL LBG (10 g / L trypsin, 5 g / L yeast extract, 10 g / L sodium chloride, and 5 g / L glucose) medium containing 30 μg / mL Kan and cultured at 30°C and 200 rpm until the OD 600The value reached 0.4-0.7. Then IPTG (1mM) was added to induce the expression of GFP, and cultured at 30℃, 200rpm for 16-18 hours. The bacteria were collected by centrifugation at 4℃, 6,000g for 10min. The bacteria were broken by ultrasound, and the cell debris was removed by centrifugation at 4℃, 24,000g for 30min. The supernatant was collected and protein was purified using a Ni column. The supernatant that passed through the Ni column was concentrated overnight, and the concentrate was placed in a 1.5mL centrifuge tube. The centrifuge tube was irradiated under blue excitation light to observe whether green fluorescence was emitted.
[0078] The results are as follows Figure 1 As shown, this surface-displayed vector plasmid can express proteins in Corynebacterium glutamicum.
[0079] Example 2: Determining whether the surface-displayed vector plasmid can express hyaluronan hydrolase PfHAase in Corynebacterium glutamicum and whether the expressed enzyme is active
[0080] The MBP-PfHAase (MBP-tagged hydrolase, whose nucleotide sequence is shown in SEQ ID NO: 3) gene was cloned into the plasmid pEC-XK99e using seamless cloning technology. The RBS binding site AAGGAGGATATACAT was added before the MBP-PfHAase gene, and a His tag and a myc tag were added after the MBP-PfHAase gene. The constructed plasmid was sequenced, and the MBP-PfHAase-pEC-XK99e recombinant plasmid was successfully constructed.
[0081] The correctly sequenced recombinant plasmid was introduced into competent cells of Corynebacterium glutamicum by electroporation (1.8 kV, 5 ms).
[0082] In 5 mL of LBB medium (10 g / L trypsin, 5 g / L yeast extract, 5 g / L sodium chloride and 10 g / L BHI), 2.5 μL of 100 μg / mL kanamycin (Kan) was added and the bacterial liquid of Corynebacterium glutamicum containing the MBP-PfHAase-pEC-XK99e recombinant plasmid was inoculated and cultured overnight at 30°C with vigorous shaking at 200 rpm.
[0083] The overnight culture was inoculated into 100 mL LBG (10 g / L trypsin, 5 g / L yeast extract, 10 g / L sodium chloride and 5 g / L glucose) medium containing 30 μg / mL Kan and cultured at 30°C, 200 rpm until the OD600 value reached 0.4-0.7. Then IPTG (1 mM) was added to induce the expression of MBP-PfHAase and cultured at 30°C, 200 rpm for 16-18 hours. The bacteria were collected by centrifugation at 4°C, 6,000 g for 10 minutes. The bacteria were ultrasonically disrupted and centrifuged at 4°C, 24,000 g for 30 minutes to remove cell debris. The supernatant was collected and protein purified using a Ni column. The expression of MBP-PfHAase was verified by SDS-PAGE, as shown in Figure 3. Figure 2 As shown, the protein molecular weight of MBP-PfHAase is 78.5 kDa.
[0084] The reaction was carried out using the purified enzyme: HA (molecular weight of 110,000 Daltons, from Shandong Freda Biotechnology Co., Ltd.) was used as a substrate (10 mg / mL). Purified enzyme protein (enzyme concentration of 1 mg / mL) or 10 μL of supernatant separated after bacterial cell disruption (not purified by Ni column) was added to 500 μL of aqueous solution. The reaction was carried out in a metal bath at 43°C for 15 min at pH = 3. The reaction was observed using a TLC plate. According to SDS-PAGE ( Figure 2 ) and TLC plate results ( Figure 3 ) shows that the surface-displayed vector plasmid can express the hyaluronan hydrolase PfHAase in Corynebacterium glutamicum, and the expressed enzyme is active. Because the supernatant was not concentrated using a Ni column, the enzyme content was relatively low, and no obvious oligosaccharide puncta were produced after 15 minutes of reaction. However, after 15 minutes of substrate degradation catalyzed by the enzyme protein after Ni column concentration, significant oligosaccharide puncta were produced, indicating that the enzyme is active.
[0085] Example 3: Retrieving the gene sequence of the anchor protein suitable for Corynebacterium glutamicum and obtaining the gene fragment of the anchor protein by PCR
[0086] Six proteins, PgsA (a part of γ-glutamate synthetase), NCgl1337, NCgl1221, NCgl1307, NCgl2775 and NCgl0717, were selected as anchor proteins.
[0087] Table 1. Sources and names of anchoring proteins
[0088]
[0089] The PgsA gene was synthesized using gene synthesis technology, and primers were designed and amplified using PCR technology to obtain a PgsA gene fragment (SEQ ID NO: 4). The full-genomic DNA of Corynebacterium glutamicum was extracted using the Tiangen Bacterial Genomic DNA Extraction Kit (DP302). Primers were designed and PCR was used to obtain DNA fragments of the anchoring proteins NCgl1337, NCgl1221, NCgl1307, NCgl2775, and NCgl0717. The nucleotide sequences of these fragments are shown in SEQ ID NOs: 5-9, respectively.
[0090] Table 2. Primer sequences
[0091] Primer name Primer sequences PsgA-F ATTCAAGGAGGATATACATATGAAGAAAGAACTGTCTTTCCACGAGAA PsgA-R TACCTTCTTCGATTTTCATCTTGGATTTCAGTTTGTCAGAGTGGTC NCgl1337-F ATTCAAGGAGGATATACATATGGCTCAGCGAAAACTGGC NCgl1337-R TACCTTCTTCGATTTTCATGGCGTTTACTCGATCTCGCAG NCgl1221-F ATTCAAGGAGGATATACATATGTCTGCAGCCGATGCG NCgl1221-R TACCTTCTTCGATTTTCATGCTTACTGGCGCGGAAG NCgl1307-F ATTCAAGGAGGATATACATATGAAGGATTACGCGGTGCATAC NCgl1307-R TACCTTCTTCGATTTTCATACTTGGAGGTGCGCTACTTG NCgl2775-F ATTCAAGGAGGATATACATATGAGGAAAACCATCACCGTTATCATCC NCgl2775-R TACCTTCTTCGATTTTCATGTCGATGAGGTTGGTCGCC NCgl0717-F ATTCAAGGAGGATATACATATGAAAACAGAAACTCGACGAGCC NCgl0717-R TACCTTCTTCGATTTTCATGCTCGTGGCAGTTGGTTCC
[0092] Example 4: Fusion expression of hyaluronan hydrolase gene and anchor protein gene, and detection of whether hyaluronan hydrolase is displayed on the surface by flow cytometry
[0093] The anchor protein was fused with the MBP-tagged HA hydrolase using seamless cloning technology.
[0094] PCR conditions and steps are shown in the following table and Figure 4 shown.
[0095] Table 3. PCR conditions
[0096]
[0097]
[0098] The correctly sequenced recombinant plasmid was introduced into competent cells of Corynebacterium glutamicum by electroporation (1.8 kV, 5 ms).
[0099] In 5 mL of LBB medium (10 g / L trypsin, 5 g / L yeast extract, 5 g / L sodium chloride and 10 g / L BHI), 2.5 μL of 100 μg / mL kanamycin (Kan) was added and the bacterial liquid of Corynebacterium glutamicum containing the MBP-PfHAase-pEC-XK99e recombinant plasmid was inoculated and cultured overnight at 30°C with vigorous shaking at 200 rpm.
[0100] The overnight culture was inoculated into 100 mL LBG (10 g / L trypsin, 5 g / L yeast extract, 10 g / L sodium chloride, and 5 g / L glucose) medium containing 30 μg / mL Kan and cultured at 30°C and 200 rpm until the OD 600The value reached 0.4-0.7. IPTG (1 mM) was then added to induce protein expression, and the cells were cultured at 30°C, 200 rpm for 16-18 hours. The bacteria were collected by centrifugation at 4°C, 6,000 g for 10 minutes.
[0101] Take a small amount of cells and resuspend them in 1× PBS, centrifuge at 4,000 g for 2 min, and discard the supernatant;
[0102] Add 200 μL of 1× PBS to the cells to resuspend them. Flick the cells evenly and centrifuge at 4,000 g for 2 min. Remove the supernatant and repeat this step twice.
[0103] Dilute the primary antibody at a ratio of 1:50 (using 1× PBS), add 50 μL of the diluted primary antibody (myc-tagged antibody) to the bacteria, mix the bacteria in the primary antibody solution, incubate at room temperature for 30 minutes, centrifuge at 4,000g for 2 minutes, and remove the supernatant;
[0104] Add 200 μL of 1× PBS to the cells to resuspend them. Flick the cells evenly and centrifuge at 4,000 g for 2 min. Remove the supernatant and repeat this step twice.
[0105] Dilute the secondary antibody at a ratio of 1:100 (using 1× PBS), add 50 μL of the diluted secondary antibody (primary antibody with FITC fluorescent label) to the bacteria, mix the bacteria in the secondary antibody solution, incubate at room temperature for 30 minutes, centrifuge at 4,000g for 2 minutes, and remove the supernatant;
[0106] Add 200 μL of 1× PBS to the cells to resuspend them. Flick the cells evenly and centrifuge at 4,000 g for 2 min. Remove the supernatant and repeat this step twice.
[0107] Finally, the bacteria were resuspended in 0.5 mL-1 mL of 1× PBS and subjected to flow cytometry detection.
[0108] According to the flow cytometry results ( Figure 5 ) It can be seen that the anchoring proteins NCgl1307, NCgl2775, NCgl0717 and NCgl1337 can successfully display MBP-PfHAase on the surface of Corynebacterium glutamicum, while the anchoring proteins PsgA and NCgl1221 cannot display MBP-PfHAase on the surface of Corynebacterium glutamicum.
[0109] Example 5: Screening of anchored proteins by using surface-displayed bacteria to initiate reactions and qualitatively comparing enzyme activity using agarose gel electrophoresis
[0110] 1. Washing the cells
[0111] Take 1 mL of the induced culture bacterial solution (obtained in Example 4) and place it in a 1.5 mL centrifuge tube. Centrifuge the bacterial solution (7000 rpm, 3 min), remove the supernatant, wash the bacteria with 1× PBS, centrifuge again (7000 rpm, 3 min), remove the supernatant, perform the washing step 2-3 times, and weigh the washed bacteria.
[0112] 2. Enzymatic hydrolysis reaction
[0113] 500 μL of a 10 mg / mL HA (molecular weight 1.5 million Daltons) aqueous solution with a pH of 3 was mixed evenly with the washed bacteria in a 1.5 mL centrifuge tube, and the reaction solution was placed in a metal bath at 43°C for 24 hours.
[0114] 3. Agarose gel electrophoresis
[0115] The reaction solution was centrifuged (12,000 rpm, 10 min), and 36 μL of the supernatant was mixed evenly with 4 μL of 10× DNA loading buffer.
[0116] Weigh 0.8 g of agarose powder and dissolve it in 80 mL of TAE solution. Pour it into the corresponding mold and wait for it to solidify.
[0117] Weigh 0.015 g of stain all dye and dissolve it in 75 mL of anhydrous ethanol. Incubate and dissolve at 37°C for 3-4 hours.
[0118] Take 10 μL of the treated reaction solution and spot it in the electrophoresis gel well. The voltage is 60 V and the time is 150 min. Perform agarose gel electrophoresis to detect the change in the molecular weight of hyaluronic acid.
[0119] Place the finished agarose gel in a glass dish, add 75 mL of double-distilled water into the glass dish, and then pour 75 mL of dissolved dye into the glass dish for overnight staining.
[0120] According to the agarose gel results ( Figure 6 ) It can be seen that the activity of hyaluronan hydrolase is best displayed by using the anchoring protein NCgl1337.
[0121] Example 6: Optimizing the anchor protein by predicting its signal peptide, transmembrane region, and structure, and identifying the effect and activity of the optimized anchor protein in displaying HA hydrolase
[0122] Based on flow cytometry and agarose gel electrophoresis results, it was found that the anchoring proteins NCgl1307, NCgl2775, NCgl0717, and NCgl1337 can successfully display MBP-PfHAase on the surface of Corynebacterium glutamicum. The transmembrane domains and protein structures of NCgl1307, NCgl2775, NCgl0717, and NCgl1337 were predicted using the software PyMOL and the website Bioinformatic Tools and Services ( Figure 7-8 ), determine the truncation position.
[0123] The truncated sequences were named NCgl1307s, NCgl2775s, NCgl0717s and NCgl1337s, and their nucleotide sequences are shown in SEQ ID NOs: 10-13, respectively.
[0124] Recombinant plasmids for fusion expression of NCgl1307s, NCgl2775s, NCgl0717s and NCgl1337s with MBP-PfHAase were constructed using seamless cloning technology (PCR system and process are shown in Example 4).
[0125] Table 4. Primer sequences
[0126] Primer name Primer sequences NCgl1337s-F ATTCAAGGAGGATATACATATGGCTCAGCGAAAACTGGC NCgl1337s-R GACACTAGTAGCCACACCACCAC NCgl1307s-F ATTCAAGGAGGATATACATATGAAGGATTACGCGGTGCATAC NCgl1307s-R ACTTGGAGGTGCGCTACTTG NCgl2775s-F ATTCAAGGAGGATATACATATGAGGAAAACCATCACCGTTATCATCC NCgl2775s-R AACCGGTGGTTCCGTGG NCgl0717s-F ATTCAAGGAGGATATACATATGAAAACAGAAACTCGACGAGCC NCgl0717s-R TTGGGTGGTAGACGTAGTAGTAGACG
[0127] The recombinant plasmid that was successfully sequenced was transformed into Corynebacterium glutamicum to induce protein expression.
[0128] The induced bacteria were incubated with primary and secondary antibodies and detected by flow cytometry (see Example 4 for specific operations).
[0129] The induced bacteria were used to initiate the reaction, and the enzyme activity was observed by agarose gel electrophoresis (see Example 5 for specific procedures).
[0130] like Figure 5-6 As shown, the truncated anchor protein sequences NCgl1307s, NCgl2775s, NCgl0717s, and NCgl1337s can all successfully display MBP-PfHAase on the surface of Corynebacterium glutamicum, among which NCgl1337s is the best.
[0131] The optimal anchoring protein NCgl1337s was fused with the enzyme PfHAase without MBP tag (NCgl1337s-PfHAase) and compared with NCgl1337s-MBP-PfHAase ( Figure 9-10 ), and found that NCgl1337s-PfHAase had the best enzyme activity.
[0132] Example 7: Optimizing the linker peptide sequence, designing a suitable linker peptide sequence to improve the activity of surface-displayed hyaluronan hydrolase, and detecting the display effect and activity of surface-displayed HA hydrolase using flow cytometry and agarose gel electrophoresis
[0133] A flexible linker peptide (GGGGSGGGGS, SEQ ID NO: 14) and a rigid linker peptide (PAPAPPAPAP, SEQ ID NO: 15) were added between the anchor sequence NCgl1337s and the enzyme sequence. A recombinant plasmid was constructed using seamless cloning technology (see step 4 for the PCR system and process). The successfully sequenced recombinant plasmid was transformed into Corynebacterium glutamicum to induce protein expression.
[0134] The induced bacteria were incubated with primary and secondary antibodies and detected by flow cytometry (see Example 4 for specific operations).
[0135] The induced bacteria were used to initiate the reaction, and the enzyme activity was observed by agarose gel electrophoresis (see Example 5 for specific procedures).
[0136] According to the results ( Figure 11-12 ) It can be concluded that the use of rigid linker peptides can significantly improve the activity of surface-displayed enzymes.
[0137] Example 8: Determination of relative enzyme activity of the final optimized surface-displayed HA hydrolase using the DNS method
[0138] The surface display strain with the best enzyme activity after optimization (obtained in Example 7) was selected for induction culture (for specific operations, see Example 4).
[0139] The relative enzymatic activity of surface-displayed hydrolases was determined using the DNS method. Hyaluronic acid (HA) with a molecular weight of 110,000 Daltons was dissolved in 50 mM sodium formate to a HA concentration of 10 mg / mL. The pH was adjusted to 3. 500 μL of this solution was mixed with washed bacterial cells and incubated in a 43°C metal bath for 30 minutes. After the reaction, the reaction solution was centrifuged, and the supernatant was immediately inactivated in 100°C boiling water. The reaction solution was diluted to 2 mg / mL, and a blank control was set up (equal amounts of bacterial cells were mixed with 500 μL of 50 mM sodium formate solution (pH 3), incubated in a 43°C metal bath for 30 minutes, centrifuged, and the supernatant was inactivated). Three replicates were performed for each group. The mixture was uniformly mixed at a ratio of 1:2 reaction solution: DNS, boiled in 100°C boiling water for 5 minutes, and immediately cooled. The absorbance (OD) was measured at 540 nm.
[0140] Calculate the absorbance difference y between the average value of the control group and the average value of the experimental group, and substitute y into OD 540The standard curve equation y = 2.5533x - 0.0948 was used to obtain the corresponding glucose concentration on the standard curve. The enzyme activity unit (U / mg) was then calculated as (r × 0.3 × K × 1000 × 60) / (T × m), where r is the calculated glucose concentration (mg / mL), K is the dilution factor, T is the enzymatic hydrolysis time (min), and m is the amount of enzyme added (mg).
[0141] After optimization, the enzyme activity can reach 5.84×10 4 U / g.
[0142] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
[0143] The aforementioned embodiments and methods described in the present invention may be varied based on the ability, experience, and preference of those skilled in the art.
[0144] In the present invention, merely listing the steps of the method in a certain order does not constitute any limitation on the order of the method steps.
Claims
1. A recombinant Corynebacterium glutamicum displaying hyaluronan hydrolase on its surface, wherein a gene encoding a fusion protein is introduced into the recombinant Corynebacterium glutamicum, wherein the fusion protein comprises an anchor protein and hyaluronan hydrolase, wherein the anchor protein is selected from the group consisting of NCgl1307, NCgl2775, NCgl0717, NCgl1337, or truncations thereof; Preferably, the coding sequence of the hyaluronan hydrolase is shown in SEQ ID NO: 2; Preferably, the anchoring protein is NCgl1337 or a truncate thereof.
2. The recombinant Corynebacterium glutamicum according to claim 1, wherein The coding sequence of the truncated form of NCgl1307 is shown in SEQ ID NO: 10; and / or, The coding sequence of the truncated form of NCgl2775 is shown in SEQ ID NO: 11; and / or, The coding sequence of the truncated form of NCgl0717 is shown in SEQ ID NO: 12; and / or, The coding sequence of the truncated form of NCgl1337 is shown in SEQ ID NO:
13.
3. The recombinant Corynebacterium glutamicum according to claim 1 or 2, characterized in that In the fusion protein, the anchor protein and the hyaluronan hydrolase are connected via a connecting peptide, preferably a rigid connecting peptide.
4. A recombinant vector comprising a coding sequence for a fusion protein, wherein the fusion protein comprises an anchor protein and a hyaluronan hydrolase, wherein the anchor protein is selected from the group consisting of NCgl1307, NCgl2775, NCgl0717, NCgl1337, or truncations thereof; Preferably, the coding sequence of the hyaluronan hydrolase is shown in SEQ ID NO: 2; Preferably, the anchoring protein is NCgl1337 or a truncate thereof; Preferably, the recombinant vector is a plasmid.
5. The recombinant vector according to claim 1, wherein The coding sequence of the truncated form of NCgl1307 is shown in SEQ ID NO: 10; and / or, The coding sequence of the truncated form of NCgl2775 is shown in SEQ ID NO: 11; and / or, The coding sequence of the truncated form of NCgl0717 is shown in SEQ ID NO: 12; and / or, The coding sequence of the truncated form of NCgl1337 is shown in SEQ ID NO:
13.
6. A method for displaying hyaluronan hydrolase on the surface of Corynebacterium glutamicum, comprising the step of introducing a gene encoding a fusion protein into the host Corynebacterium glutamicum, wherein the fusion protein comprises an anchor protein and hyaluronan hydrolase, wherein the anchor protein is selected from the group consisting of NCgl1307, NCgl2775, NCgl0717, NCgl1337, or truncations thereof; Preferably, the coding sequence of the hyaluronan hydrolase is shown in SEQ ID NO: 2; Preferably, the anchoring protein is NCgl1337 or a truncate thereof; Preferably, the method comprises the following steps: (1) Constructing a recombinant vector for fusion expression of anchoring protein and hyaluronan hydrolase; (2) transferring the recombinant vector obtained in step (1) into the host Corynebacterium glutamicum; (3) culturing the recombinant Corynebacterium glutamicum obtained in step (2) and inducing expression of the fusion protein; More preferably, step (1) comprises the following steps: (1-1) Amplify the ankyrin gene and hyaluronan hydrolase gene respectively; (1-2) Integrate the anchoring protein gene and the hyaluronan hydrolase gene into an expression vector to construct a recombinant vector.
7. Use of the recombinant Corynebacterium glutamicum according to any one of claims 1 to 3 in any one of the following: 1) Preparation of whole-cell catalysts; 2) Hydrolyzing hyaluronic acid to prepare low molecular weight hyaluronic acid and hyaluronic acid oligosaccharides.
8. A whole-cell catalyst, prepared by a method comprising the following steps: inducing expression of the recombinant Corynebacterium glutamicum according to any one of claims 1 to 3, collecting the bacterial cells, and obtaining the whole-cell catalyst.
9. A method for hydrolyzing hyaluronic acid, comprising the step of contacting the recombinant Corynebacterium glutamicum according to any one of claims 1 to 3 or the whole-cell catalyst according to claim 8 with hyaluronic acid; Preferably, the method comprises: The recombinant Corynebacterium glutamicum or the whole-cell catalyst is mixed with hyaluronic acid to carry out enzymatic hydrolysis reaction.
10. The method according to claim 9, wherein The pH of the reaction system is 2-6, preferably 2-4; and / or, The temperature of the enzymatic hydrolysis reaction is 20-50°C, preferably 40-45°C.