A promoter p1 for expression of exogenous genes in akkermansia muciniphila, a recombinant vector and recombinant bacteria thereof and application

By screening for high expression promoter P1 and designing the pCONJ4s-Lux recombinant plasmid, the problem of difficult genetic manipulation of Akkermansia myxophila was solved, achieving stable expression of exogenous genes and non-invasive visual monitoring in vivo. An AKK luminescent strain was constructed, enabling real-time monitoring of the AKK colonization process.

CN120683114BActive Publication Date: 2026-02-24LINYI UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511189676.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-25
Publication Date
2026-02-24
Estimated Expiration
2045-08-25

AI Technical Summary

Technical Problem

Genetic manipulation of Akkermansia myxophilus is difficult, exogenous genes are hard to express stably, and current technologies cannot achieve real-time monitoring and accurate detection of its colonization in vivo.

Method used

The highly expressed promoter P1 was screened out, and the pCONJ4s-Lux recombinant plasmid was designed. The luminescent system was integrated into the genome of Akkermansia muciniphila using double crossover recombination technology to construct the AKK luminescent strain Akkermansia muciniphila SDLYAKK8-Lux, enabling non-invasive visual monitoring in live animals.

Benefits of technology

Stable expression and continuous in vivo visualization of exogenous genes of Akkermansia myxophila were successfully achieved, solving the problem of difficult genetic manipulation and realizing real-time, non-invasive monitoring of the colonization process of Akkermansia myxophila.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683114B_ABST
    Figure CN120683114B_ABST
Patent Text Reader

Abstract

The application discloses a promoter P1 for exogenous gene expression of Akkermansia muciniphila, a recombinant carrier, a recombinant bacterium thereof and application. It belongs to the technical field of genetic engineering. The application first screens a strong promoter which can be used for exogenous gene expression of Akkermansia muciniphila, and the strong promoter has super strong expression amount. Meanwhile, a recombinant plasmid is constructed, in which a report system of Lux CDABE is inserted into Akkermansia muciniphila, and on the basis, a method is established, in which the report system of Lux CDABE is recombined into the genome of Akkermansia muciniphila by using double exchange, and an Akkermansia muciniphila SDLYAKK8-Lux strain capable of emitting light is successfully constructed. It is found that the light emission intensity of the strain is strongly related to the quantity of the strain, and the blank of the construction method of the live body fluorescence imaging of the AKK strain is filled.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically to a promoter P1 for the expression of exogenous genes in Akkermansia myxophilus, a recombinant vector, the recombinant bacteria thereof, and their applications. Background Technology

[0002] Akkermansia muciniphila (AKK) is a Gram-negative bacterium native to the human gut and an anaerobic bacterium. This bacterium uses mucin as its sole source of carbon, nitrogen, and energy, and can release free sulfate through mucin hydrolysis, and ferment to produce acetic acid and propionic acid. AKK is widely colonized in the human gut, accounting for approximately 0.5% to 5% of the total human microbiota. Studies have shown that AKK has demonstrated considerable potential in improving metabolic diseases (such as obesity and diabetes), limiting inflammation, anti-aging, and adjuvant cancer immunotherapy, and is hailed as a potential star bacterium among second-generation probiotics.

[0003] Currently, most methods for detecting the colonization of Akkermansia myxophilus in vivo rely on high-throughput sequencing of mouse feces or intestinal contents collected after dissection. These methods suffer from significant time lag and cannot reflect the actual replication and colonization of AKK bacteria in vivo in real time.

[0004] The Lux CDABE system is a bacterial bioluminescent reporter system. Unlike luciferase-based bioluminescent reporter systems and fluorescence reporter systems, the Lux CDABE reporter system has the advantages of not requiring the addition of substrates, strong luminescent signal, and high signal-to-noise ratio. It can reflect the bacterial growth level in real time and is currently widely used in many bacterial in vivo imaging applications.

[0005] Akkermansia myxophilus, with its slow growth rate, difficult genetic manipulation, and the inability to stably express exogenous genes in vivo, has hindered the technological development of AKK bacteria at the genetic level, resulting in a lack of research on exogenous gene expression in AKK bacteria. There are also few reports on the construction methods of exogenous gene promoters and in vivo fluorescence imaging techniques for AKK bacteria, as well as related research.

[0006] Therefore, how to develop corresponding promoters and exogenous gene editing systems for *Ackermania*, and how to develop corresponding in vivo imaging technologies, are technical problems that urgently need to be solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention provides a promoter P1 for the expression of exogenous genes in Akkermansia muciniphila, a recombinant vector, the recombinant strain, and its application. Addressing the difficulties in genetic manipulation and stable expression of exogenous genes in Akkermansia muciniphila, the invention successfully screened out the highly expressed promoter P1 and innovatively designed the pCONJ4s-Lux recombinant plasmid. Through double-crossover recombination technology, the luminescent system was precisely integrated into the genome, overcoming the challenge of stable expression of exogenous genes in this bacterium. The luminescent strain Akkermansia muciniphila SDLYAKK8-Lux was successfully constructed, achieving for the first time a non-invasive, continuous, and visualized monitoring of the colonization process of Akkermansia muciniphila in living animals.

[0008] The primary objective of this application is to provide: a promoter P1 for the expression of exogenous genes in Akkermansia myxophila, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0009] Or, as shown in SEQ ID NO.2, a nucleotide sequence that retains promoter activity after substitution, deletion, and / or addition of one or more bases.

[0010] Another object of this application is to provide: a recombinant vector comprising the aforementioned promoter P1 sequence; and further comprising upstream and downstream homologous arm sequences homologous to the recipient bacteria or recipient cells, a Lux CDABE expression cassette sequence, and an resistance selection sequence.

[0011] In one embodiment, the recombinant vector is pCONJ4s-Lux, whose nucleotide sequence is shown in SEQ ID NO.13.

[0012] Another object of this application is to provide a recombinant bacterium containing the aforementioned promoter or the aforementioned recombinant vector.

[0013] In one embodiment, the recombinant bacterium is Akkermansia muciniphila SDLYAKK8-Lux, deposited at the China Center for Type Culture Collection (CCTCC) on July 2, 2025, with accession number CCTCC NO: M 20251508.

[0014] Another object of this application is to provide a method for constructing the recombinant bacteria, comprising the following steps:

[0015] (1) Screening for strong promoters of Ackermansia muciniphila, the sequence of which is shown in SEQ ID NO.2;

[0016] (2) Design primers for upstream and downstream homologous arms, P1 promoter, Lux CDABE expression cassette and resistance selection expression cassette, and amplify the corresponding fragments for later use;

[0017] (3) Using pCONJ4s as the backbone plasmid, after single enzyme digestion, homologous recombination was performed with the amplified fragment in step (2) to obtain the homologous recombination vector;

[0018] (4) Recombinant bacteria were obtained by double exchange method.

[0019] Another object of this application is to provide a live imaging system comprising the recombinant bacteria.

[0020] Another object of this application is to provide: the application of the promoter P1, wherein the application is in any of the following directions:

[0021] (1) Application in the genetic engineering of Akkermansia myxophilus;

[0022] (2) Application in constructing recombinant plasmids for introducing the Lux CDABEDE bacterial bioluminescent reporter system into Akkermansia myxophila;

[0023] (3) Application in constructing recombinant bacteria containing the Lux CDABEDE bacterial bioluminescent reporter system;

[0024] (4) Application in constructing a live-cell imaging system containing the Lux CDABEDE bacterial bioluminescence reporter system;

[0025] (5) Application in reflecting the proliferation and colonization of Akkermansia mycotoxin in real time based on in vivo imaging technology.

[0026] Another object of this application is to provide: the application of the recombinant vector or the recombinant bacteria, wherein the application is in any of the following directions:

[0027] (1) Application in constructing a live imaging system containing the Lux CDABEDE bacterial bioluminescence reporter system;

[0028] (2) Application in reflecting the proliferation and colonization of Akkermansia mycotoxin in real time based on in vivo imaging technology.

[0029] Another object of this application is to provide: the application of the described in vivo imaging system in reflecting the proliferation and colonization of Akkermansia myxophilus in real time based on in vivo imaging technology.

[0030] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects:

[0031] 1) This invention provides a promoter P1 for the expression of exogenous genes in Akkermansia myxophilus, a recombinant vector, the recombinant bacteria, and its applications. Addressing the problems of difficult genetic manipulation and stable expression of exogenous genes in Akkermansia myxophilus, this invention successfully screened a high-expression promoter P1 for the first time. It has a super-strong expression level and achieves super-high activity despite being only 238bp in length. It is easier to use for gene engineering vector construction than traditional long promoters (>500bp), and combines high efficiency and convenience.

[0032] 2) In addition, this application innovatively designed the pCONJ4s-Lux recombinant plasmid, and precisely integrated the luminescent system into the genome of AKK bacteria through double crossover recombination technology, overcoming the problem of the instability of foreign genes in this bacterium, and successfully constructed the AKK luminescent strain Akkermansia muciniphila SDLYAKK8-Lux, realizing for the first time non-invasive and continuous visualization monitoring of the colonization process of AKK bacteria in living animals.

[0033] 3) In the process of constructing the recombinant luminescent strain, this application selected an AKK β-lactamase gene as the insertion site. The destruction of this gene does not affect the growth of AKK bacteria. Moreover, this application uses a traceless insertion method, and in the end only the promoter + Lux will be preserved, without any other genes remaining. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0035] Figure 1 The plasmid is pCONJ4s-Lux, a recombinant plasmid of Akkermansia myxophila.

[0036] Figure 2 For example: SM10λpir competent cells of donor bacteria containing recombinant plasmid pCONJ4s-Lux, as observed by in vivo imaging.

[0037] Figure 3 This refers to the aerobic conjugation process between donor and recipient bacteria.

[0038] Figure 4 The strain is Akkermansia muciniphila SDLYAKK8-Lux, as observed by a live imaging system.

[0039] Figure 5For example: In vitro growth curves of Akkermansia muciniphila SDLYAKK8-Lux strain and wild-type strain SDLYAKK8.

[0040] Figure 6 The relationship between the luminescence intensity of Akkermansia muciniphila SDLYAKK8-Lux strain and the number of strains.

[0041] Figure 7 For: the colonization of Akkermansia muciniphila SDLYAKK8-Lux strain in mice at different time points.

[0042] Figure 8 The Akkermansia muciniphila SDLYAKK8-Lux strain primarily colonizes the mouse colon. Detailed Implementation

[0043] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0044] The materials used in the embodiments of this application are as follows:

[0045] The plasmid pBBR1MCS4-LuxCDABE containing the Lux CDABE luminescent expression cassette was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0046] The backbone plasmid pCONJ4s was preserved in our laboratory and its construction method was disclosed in Liu G, Beaton SE, Grieve AG, Evans R, Rogers M, Strisovsky K, Armstrong FA, Freeman M, Exley RM, Tang CM. Bacterial rhomboid proteases mediate quality control of orphan membrane proteins. EMBO J. 2020 May 18;39(10):e102922. doi: 10.15252 / embj.2019102922.Epub 2020 Apr 27. PMID: 32337752; PMCID: PMC7232013.

[0047] Akkermansia myxophilus strain SDLYAKK8: This strain has been disclosed in the paper "Analysis of the whole genome and biological characteristics of Akkermansia myxophilus isolates". GenbanK accession number: CP115935. It is currently held by the applicant and may be made available to the public to meet the requirements of adequacy of patent disclosure.

[0048] In addition, the starting strain used in this application can be any Ackermania strain other than Ackermania SDLYAKK8, as long as the selected strain's genome sequence contains the sequence shown in SEQ ID NO.1.

[0049] Ttattcttttccggcggcaggtctccactccatgcacagccagcgggccatggaggcaatcacccggtcacaagcggattcagaatcctttgaatccctgataaacacggaaaccgccattttccggccgttgggaagaacaatgatgccgacgtcattgcgggcggtaacgccaccccccggcagcgtgaatccggatcccgtcttatgcgccaccacgtaatcccgcggcagctgccctttcaaacgttcagggcctgtagagcaccccgccatgataccccaaagaaaattctgtgtaccccttgccagaattttaccttcgtcaaacgcccggagcagggagttcatggccgacggacggcttgagttgacatattgcaaatcatgattccggtgtatttcttcttccgtaaaacggacattaatgccgtcaattccccattccttcaaatccttctgcacggcctgcggccctccaataaggccaaacaggaggtcgcaggtgttgttgtcgctttcctggacagtcactctcagcagttccttcagagagaaatcgccgccttgcgggaaacgctcccggagggggctccaggtatctttcaccagttgttccggacgtatgcggatgatctgttccagattcatggcgccctggtccacccgcttcaagacagacaaggccagcacgaatttgacgacgctctgcatgggataggccgcctcatcccccaccatgacggtttcccccgtatccagcatttccgcagccatgcccacacgggccttcagggaatgggccagttcgcgtacggcggaggaatccgctgcggaaacggctggcggagaagacgtggccccctgagaaaaaacgcaaaagaacat, SEQ ID NO.1.

[0050] Plasmid PBAD33: Purchased from Shanghai Zeye Biotechnology Co., Ltd.

[0051] SM10λpir competent cells: purchased from Shanghai Yaji Biotechnology Co., Ltd.

[0052] Example 1

[0053] Screening for strong promoters for the expression of exogenous genes in Akkermansia mycotoxin-loving bacteria

[0054] After Akkermansia SDLYAKK8 was cultured in liquid medium to the logarithmic growth phase, it was centrifuged at 12000 rpm for 10 minutes at 4°C, the supernatant was discarded, and the precipitate was flash-frozen in liquid nitrogen and sent to Shanghai Paisennong Biotechnology Co., Ltd. for transcriptome analysis. The promoter of the gene with the highest mRNA expression level was screened as the target promoter. The nucleotide sequence of the P1 promoter was determined as follows:

[0055] P1 promoter nucleotide sequence:

[0056] GTTCCCTACCGTGCCTCAAGAAGGCGCCCCATGCAAGCCGGCGCTCCGTACGTGCCCCCGGACTGTCAAACTTACCCCGGAGGCCAAAAGCGCGTCCTCATCAAAAAAACCGCCCTAAAAAGAATCCTCTCCGCGTATTTTTTTGAACAAAAATCACTCCCTGCCGCTCTATCTGTCGTAGAACGGCAGCTCTTCTGCCGCTGCATTACCAACACCACACAACCTCACATATCATTAT, SEQ ID NO. 2.

[0057] Table 1 Strong promoters of Akermansia myxophila

[0058]

[0059] Example 2

[0060] Constructing a recombinant plasmid of *Akermansia* expressing the Lux CDABE protein of a luminescent system

[0061] (1) Single enzyme digestion of backbone plasmid

[0062] S17-1λpir competent cells containing the pCONJ4s plasmid, stored at -80℃, were streaked and seeded into LB agar plates containing AMP resistance. After overnight incubation, single colonies were picked and cultured overnight in LB liquid medium containing AMP resistance. 5 mL of the bacterial culture was then used to extract the plasmid according to the Novizan plasmid mini-extraction kit instructions. The plasmid was digested with the NEB-approved PmeI rapid digestion enzyme according to the kit's instructions. After gel electrophoresis, the digested products were recovered using the Novizan gel electrophoresis recovery kit. The products were then stored at -20℃ for later use.

[0063] (2) Amplification and recovery of homologous arms, resistance expression cassettes, and luminescent expression cassettes

[0064] The upstream homologous arm (Up-arm) primer, P1 promoter primer, Lux CDABE expression cassette primer, downstream homologous arm primer (Down-arm), and chloramphenicol expression cassette primer were designed. The specific primer sequences are shown in Table 2.

[0065] Table 2 Primer sequences used for constructing recombinant plasmids

[0066] The templates used for the upstream homologous arm, promoter, and downstream homologous arm were the genomic DNA of strain SDLYAKK8. The template used for the chloramphenicol expression cassette was plasmid PBAD33 (purchased from Shanghai Zeye Biotechnology Co., Ltd.). The template used for the Lux CDABE expression cassette was plasmid pBBR1MCS4-LuxCDABE (purchased from Wuhan Miaoling Biotechnology Co., Ltd.).

[0067] The corresponding products were amplified using Novizan high-fidelity enzyme, and the corresponding amplification system is shown in Table 3. PCR reaction was performed under the following conditions: 98℃ for 5 min pre-denaturation; 95℃ for 30 s denaturation; 58℃ for 30 s annealing; 72℃ for 2 min extension; after 30 cycles, a final extension at 72℃ for 7 min, 4℃ for 10 min.

[0068] Table 3 PCR amplification reaction system

[0069]

[0070] The PCR products were then subjected to agarose gel electrophoresis, followed by fragment purification using a gel extraction kit, and concentration was measured. The purified pCONJ4s single enzyme digestion product, upstream homologous arm, promoter, Lux CDABE expression cassette primers, downstream homologous arm, and chloramphenicol expression cassette product were homologously recombinated according to the instructions of the Novozymes fragment homologous recombination kit, resulting in the Ackermansia muciniphila recombinant plasmid pCONJ4s-Lux (…), which can be used to construct the Lux CDABE protein expression system. Figure 1

[0071] Example 3

[0072] The Akkermansia muciniphila SDLYAKK8-Lux luminescent strain was obtained using a double exchange method.

[0073] (1) Preparation of donor bacteria:

[0074] The recombinant plasmid pCONJ4s-Lux from Example 2 was transformed into donor bacterial SM10λpir competent cells, stored at -80℃ for later use, and the fluorescent bacteria were observed using an in vivo imaging system. Figure 2 ).

[0075] (2) Culture of recipient bacteria:

[0076] Akkermansia SDLYAKK8 strain was used as the recipient bacterium. The recipient bacterium was revived from a -80°C freezer and cultured to the logarithmic phase for later use.

[0077] (3) Conjugation of donor and recipient bacteria

[0078] Take 2 mL of donor bacteria and 1 mL of recipient bacteria respectively. Centrifuge the donor bacteria at 3000 rpm for 3 minutes, resuspend in PBS, and repeat centrifugation twice. Discard the supernatant. Centrifuge the recipient bacteria at 5000 rpm for 5 minutes at 4°C, resuspend in PBS, and repeat centrifugation once. Add 200 μL of PBS to resuspend the recipient bacteria, mix well, and place on a recipient bacteria plate. Incubate at 37°C for aerobic conjugation for 8-12 hours. Figure 3 ).

[0079] (4) AKK luminescent strain obtained by double cross-exchange of recombinant plasmids

[0080] After scraping off the conjugate, it was resuspended in 2 mL of PBS and then evenly spread onto agar plates containing chloramphenicol-resistant (6 ng / µL) recipient bacteria. The plates were then anaerobically cultured for 96 hours. Once single colonies grew, they were observed using a live imaging system. For fluorescent strains, single colonies were selected and expanded, then evenly spread onto recipient bacteria plates containing 8% sucrose. Anaerobic culture was continued, and once single colonies grew, they were observed using a live imaging system. The observed luminescent strain was the recombinant strain Akkermansia muciniphila SDLYAKK8-Lux containing the Lux CDABE luminescence system, which had completed the double crossover. Figure 4 The applicant has deposited the strain at the China Center for Type Culture Collection (CCTCC), on July 2, 2025, with accession number CCTCC NO: M20251508, and the deposit address is Wuhan University, Wuhan, China.

[0081] Example 4

[0082] Growth characteristics and luminescence intensity of Akkermansia muciniphila SDLYAKK8-Lux in relation to strain concentration

[0083] (1) Comparison of growth ability between Akkermansia muciniphila SDLYAKK8-Lux strain and wild-type strain SDLYAKK8

[0084] First, to determine whether there was a difference in growth ability between the Akkermansia muciniphila SDLYAKK8-Lux strain and the wild-type strain SDLYAKK8, activated Akkermansia muciniphila SDLYAKK8-Lux strain and wild-type strain SDLYAKK8 were inoculated into liquid culture medium at a 1:30 inoculation ratio, with three replicates for each strain. The OD values ​​of the bacterial culture were aseptically measured every 4 hours. 600 The measurements were taken for a total of 36 hours, and then the growth curve of the strain in liquid culture medium was plotted. The experimental results are as follows: Figure 5 As shown.

[0085] Results analysis: The results showed that the constructed Akkermansia muciniphila SDLYAKK8-Lux strain did not differ from the wild-type strain SDLYAKK8 in terms of in vitro growth ability.

[0086] (2) Relationship between luminescence intensity and strain number of Akkermansia muciniphila SDLYAKK8-Lux strain

[0087] The Akkermansia muciniphila SDLYAKK8-Lux strain, cultured to the logarithmic growth phase, was serially diluted. Following this, images were taken using a small animal in vivo imaging system (IVIS Lumina Series III), and the luminescence intensity at dilutions of 2, 4, 8, 16, and 32 was measured. The bacterial suspensions at each dilution were then titrated and counted. Finally, the relationship between bacterial count and luminescence intensity was calculated, and correlation analysis was performed. The experimental results are as follows: Figure 6 As shown.

[0088] Results analysis: The results show that the formula for bacterial count and luminescence intensity is:

[0089] Bacterial CFU = 145845 × ROI + 9 × 10 8 Correlation coefficient R 2 =0.9711, indicating a strong correlation between the two.

[0090] Example 5

[0091] Colonization status and colonization sites of Akkermansia muciniphila SDLYAKK8-Lux strain in mice

[0092] The ability of Akkermansia muciniphila SDLYAKK8-Lux strain to colonize mice was determined by gavage. Eight-week-old SPF BALB / c mice were acclimatized for one week and then administered a quadruple antibiotic regimen (vancomycin + metronidazole + neomycin sulfate + ampicillin) by gavage for one week. This was followed by three days of quadruple antibiotic administration via drinking water, with the water changed to clean water two days prior to gavage. The mice were fasted for four hours before gavage. Subsequently, 200 μL of Akkermansia muciniphila SDLYAKK8-Lux strain cultured to the logarithmic growth phase (at a concentration of 10) was administered by gavage. 9 Immediately after gavage administration of CFU / mL, mice were photographed using a small animal in vivo imaging system (IVIS Lumina Series III). They were then fed normally, with photographs taken every 24 hours to observe the colonization of Akkermansia muciniphila SDLYAKK8-Lux in mice for 11 consecutive days. The experimental results are as follows: Figure 7 and Figure 8 As shown.

[0093] Results analysis: The results indicate that the colonization of *Akermansia myxophilus* in mice can be observed in real time using an in vivo imaging system. Figure 7 Dissection of mice revealed that Akkermansia muciniphila SDLYAKK8-Lux primarily colonized the mouse colon. Figure 8 ).

[0094] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0095] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A promoter P1 for the expression of exogenous genes in Akkermansia myxophila, characterized in that, The nucleotide sequence of the promoter P1 is shown in SEQ ID NO.

2.

2. A recombinant vector, characterized in that, The recombinant vector includes the promoter P1 sequence as described in claim 1; it also includes upstream and downstream homologous arm sequences homologous to the recipient bacteria or recipient cells, the Lux CDABE expression cassette sequence, and an resistance selection sequence.

3. The recombinant vector according to claim 2, characterized in that, The recombinant vector is pCONJ4s-Lux, and its nucleotide sequence is shown in SEQ ID NO.

13.

4. A recombinant bacterium, characterized in that, The recombinant bacteria comprises the promoter of claim 1 or the recombinant vector of any one of claims 2-3.

5. The recombinant bacteria according to claim 4, characterized in that, The recombinant bacteria is Akkermansia myxophilus (… Akkermansia muciniphila ) SDLYAKK8-Lux It is deposited at the China Center for Type Culture Collection, date of deposit: July 2, 2025, accession number: CCTCC NO: M 20251508.

6. The method for constructing the recombinant bacteria according to claim 4, characterized in that, Includes the following steps: (1) Screening for strong promoters of Ackermansia muciniphila, the sequence of which is shown in SEQ ID NO.2; (2) Design primers for upstream and downstream homologous arms, P1 promoter, Lux CDABE expression cassette and resistance selection expression cassette, and amplify the corresponding fragments for later use; (3) Using pCONJ4s as the backbone plasmid, after single enzyme digestion, homologous recombination was performed with the amplified fragment in step (2) to obtain the homologous recombination vector. The sequence of the homologous recombination vector is shown in SEQ ID NO.

13. (4) Recombinant bacteria were obtained by double exchange method.

7. A live imaging system, characterized in that, Includes the recombinant bacteria described in any one of claims 4-5.

8. The application of the promoter P1 according to claim 1, characterized in that, The application is in any of the following directions: (1) Application in the genetic engineering of Akkermansia myxophilus; (2) Application in constructing recombinant plasmids for introducing the Lux CDABE bacterial bioluminescent reporter system into Akkermansia myxophila; (3) Application in constructing recombinant bacteria containing the Lux CDABE bacterial bioluminescent reporter system; (4) Application in constructing a live imaging system containing the Lux CDABE bacterial bioluminescence reporter system.

9. The application of the recombinant vector of any one of claims 2-3 or the recombinant bacteria of any one of claims 4-5 in constructing a live imaging system containing the LuxCDABE bacterial bioluminescent reporter system.

Citation Information

Patent Citations

  • Fluorescent strain E. coli C600 and construction method and application thereof

    CN110066820A

  • Construction and application of serratia marcescens with fluorescence tracing function

    CN112852700A