Construction method and application of NDST3 knock-down plasmid

Abstract

The invention discloses a construction method and application of an NDST3 knock-down plasmid, and belongs to the technical field of biomedicine. Comprising the following steps: S1, querying a serial number of NDST3, and screening out a target sequence; s2, annealing the forward oligonucleotide and the reverse oligonucleotide to form a double-stranded DNA fragment with a cohesive end, filling a sequence, exposing the cohesive end, and connecting the fragment with a plasmid vector subjected to the same double enzyme digestion linearization to construct a recombinant plasmid; s3, adding the forward oligonucleotide and the reverse oligonucleotide into 10xNEB buffer 2, then adding ddH2O, diluting to 20 mu M, putting into a PCR (Polymerase Chain Reaction) instrument, keeping at high temperature, and slowly cooling to room temperature to obtain ligos with the concentration of 6pmol; s4, carrying out plasmid enzyme digestion treatment, and setting a no-load plasmid group; and S5, adopting Takara-DNA (Deoxyribose Nucleic Acid) Ligalization kit ver.2.1 to connect the oligo and the oligo, and adopting a PCR (Polymerase Chain Reaction) instrument to connect the plasmid, the oligo and 8 [mu] l of solution I at 16 DEG C for 30 minutes. The invention provides transfection plasmids for subsequent WB experiments, and verifies that the expression of the NDST3 is reduced when the shNDST3 plasmids are instantly transferred into human and mouse cells.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and particularly relates to a construction method and application of an NDST3 knockdown plasmid. Background Art

[0002] In the field of life sciences, exploring the mechanisms linking gene function and disease has always been a crucial topic. Heparan sulfate (HS), a crucial component of the extracellular matrix and cell surface, is biosynthesized by enzymes that play a key role in the physiological and pathological processes of organisms. NDST3 (N-deacetylase and N-sulfotransferase-3) encodes one such enzyme. The bifunctional enzyme it expresses is capable of both deacetylation and sulfotransferase modifications, playing an indispensable role in regulating cell signaling, embryonic development, and tissue homeostasis.

[0003] In recent years, with the continuous advancement of neuroscience and genetics research, researchers have focused their attention on the potential link between NDST3 and psychiatric disorders. Current studies have shown a correlation between NDST3 and psychiatric disorders. Genome-wide association studies (GWAS), leveraging their ability to mine large-scale population genetic data, have identified NDST3 as a genetic risk factor for bipolar depression, providing new insights into the pathogenesis of psychiatric disorders.

[0004] However, GWAS studies can only reveal statistical associations between gene loci and diseases at the level of population genetics, and thus have numerous limitations. For one thing, this method cannot clearly define the specific functions of gene variants, making it difficult to determine whether these risk loci directly affect disease development or are in linkage disequilibrium with other functional loci. For another, GWAS studies lack in-depth exploration of biological mechanisms, failing to explain the specific molecular mechanisms and cellular pathways by which the NDST3 gene influences psychiatric disorders such as bipolar depression. Currently, there is no experimental evidence demonstrating a direct causal relationship between NDST3 and related diseases, and it is difficult to verify the regulatory role of gene variants in the development of disease. This lacks solid experimental support for the conclusion that NDST3 is associated with psychiatric disorders. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a method for constructing and applying an NDST3 knockdown plasmid to solve the above problems.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a method for constructing an NDST3 knockdown plasmid, comprising the following steps:

[0008] S1, query the sequence number of NDST3, and the selected target sequence is GGGAATGACCGACTGGGATTA;

[0009] S2. A double-stranded DNA fragment with sticky ends is formed by annealing the forward oligonucleotide and the reverse oligonucleotide. The stuffer sequence in the middle is removed by the corresponding double enzyme digestion reaction to expose the sticky ends. This fragment is then ligated with a plasmid vector linearized by the same double enzyme digestion reaction to construct a recombinant plasmid.

[0010] S3. Add 5 μL of forward oligonucleotide and 5 μL of reverse oligonucleotide to 5 μL of 10x NEB buffer 2, then add 35 μL of ddH2O to dilute to 20 μM. Place in a PCR instrument and maintain at 95°C for 5 minutes, then cool to 70°C for 10 minutes, and then slowly cool to room temperature to obtain an oligos concentration of 6 pmol.

[0011] S4. Use the double enzyme digestion system and single enzyme digestion system of Sangon to perform plasmid digestion, and set up an empty plasmid group;

[0012] S5. Use Takara-DNA Ligation kit ver.2.1 to connect oligos and plasmids. Add 7ul of plasmid (315ng), 1ul of oligos, and 8ul of solution I and use a PCR instrument to connect at 16°C for 30min.

[0013] Furthermore, in step S2, the forward oligonucleotide is

[0014] 5'CCGGGGGAATGACCGACTGGGATTACTCGAGTAATCCCAGTCGGTCATTCCCTTTTTG3';

[0015] The reverse oligonucleotide is

[0016] 5'AATTCAAAAAGGGAATGACCGACTGGGATTACTCGAGTAATCCCAGTCGGTCATTCCC 3'.

[0017] Furthermore, the double enzyme digestion system contains 15ul of Nuclease-free water, 2ul of 10xSpeedyOne Buffer, 2ul of pLKO.1 TRC, and 1ul of SpeedyCut Agel enzyme;

[0018] The single enzyme digestion system contains 16ul of Nuclease-free water, 2ul of 10xSpeedyOne Buffer, 1ul of pLKO.1 TRC, and 1ul of SpeedyCut EcoR I.

[0019] Furthermore, the NDST3 constructed by the method for constructing an NDST3 knockdown plasmid is used for NDST3 gene-related mental illnesses.

[0020] The beneficial effects of the present invention are:

[0021] 1. The present invention provides a transfection plasmid for subsequent WB experiments, verifying that the expression of NDST3 is reduced when the shNDST3 plasmid is transiently transferred into human and mouse cells, providing a new mechanistic idea for subsequent disease research.

[0022] Other advantages, objectives and features of the present invention will be described in the following description and will be apparent to those skilled in the art to some extent, or those skilled in the art can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to make the purpose, technical solutions and beneficial effects of the invention clearer, the present invention is described with the following drawings:

[0024] Figure 1 This is a diagram showing successful enzyme digestion in the double enzyme digestion group experiment verified by DNA gel electrophoresis of the present invention;

[0025] Figure 2 For the present invention Figure 2 This is the bacterial solution sequencing result display diagram;

[0026] Figure 3 This is an enlarged view of the target sequence and reverse complementary sequence of the bacterial solution sequencing of the present invention;

[0027] Figure 4 This is the WB verification result diagram of the present invention. DETAILED DESCRIPTION

[0028] like Figure 1-3 As shown, the present invention provides a construction method and application of an NDST3 knockdown plasmid.

[0029] Example 1

[0030] S1. Query the sequence number of NDST3 on the official website and the 21bp sequence selected is GGGAATGACCGACTGGGATTA;

[0031] S2. A double-stranded DNA fragment with sticky ends is formed by annealing a forward oligonucleotide and a reverse oligonucleotide. Both ends of the fragment contain recognition sites for specific restriction endonucleases, and a stuffer sequence is in the middle. The stuffer sequence in the middle is then removed using a corresponding double enzyme digestion reaction to expose the sticky ends. This fragment is then ligated with a plasmid vector linearized by the same double enzyme digestion reaction to construct a recombinant plasmid. The recombinant plasmid can transcribe shRNA under the drive of a promoter, and after cellular processing, it can knock down the expression of the target gene through the RNA interference mechanism;

[0032] The forward oligonucleotide:

[0033] 5'CCGGGGGAATGACCGACTGGGATTACTCGAGTAATCCCAGTCGGTCATTCCCTTTTTG 3'

[0034] The reverse oligonucleotide:

[0035] 5'AATTCAAAAAGGGAATGACCGACTGGGATTACTCGAGTAATCCCAGTCGGTCATTCCC 3';

[0036] S3. Add 5 μL of forward oligonucleotide and 5 μL of reverse oligonucleotide to 5 μL of 10x NEB buffer 2, then add 35 μL of ddH2O to dilute to 20 μM. Place in a PCR instrument and maintain at 95°C for 5 minutes, then cool to 70°C for 10 minutes, and then slowly cool to room temperature to obtain an oligos concentration of 6 pmol.

[0037] S4. Plasmid digestion was performed using the double enzyme digestion system and the single enzyme digestion system of Sangon. An empty plasmid group was set up. The double enzyme digestion system consisted of 15ul of Nuclease-free water, 2ul of 10xSpeedyOne Buffer, 2ul of empty plasmid (pLKO.1TRC), and 1ul of SpeedyCut Agel enzyme. The single enzyme digestion system consisted of 16ul of Nuclease-free water, 2ul of 10xSpeedyOne Buffer, and 1ul of empty plasmid (pLKO.1TRC) and 1ul of SpeedyCut EcoR I.

[0038] The DNA fragments digested by the double enzyme digestion system and the single enzyme digestion system were placed on a 0.8% agarose gel for electrophoresis, and 7 kb fragments were cut out at 7 kb and 1.9 kb, respectively, and placed in a sterile microcentrifuge tube for gel recovery to obtain 45 ng / ul.

[0039] S5. Using Takara-DNA Ligation kit ver. 2.1, 7 μl of plasmid (315 ng), 1 μl of oligos, and 8 μl of solution I were ligated using a PCR instrument at 16°C for 30 min.

[0040] S6. Perform bacterial liquid sequencing.

[0041] like Figure 1 As shown, the DNA fragments digested twice were placed in 0.8% agarose gel for electrophoresis, and two bands were clearly visible.

[0042] like Figure 2 As shown in the figure, after the plasmid shNDST3 was extracted from the bacterial solution using the Thermo Fisher kit and transfected into HT22 cells and HEK293 cells, the knockdown results showed that the expression level of NDST3 protein in HT22 cells (48h after transfection) was significantly decreased; the expression level of NDST3 protein in HEK293 cells (72h after transfection) was significantly decreased.

[0043] Two sets of western blot experiments (WB experiments) were performed to verify the knockdown effect of our shNDST3, such as Figure 3 As shown, in the HT22 cells on the left (mouse hippocampal neuron group), the expression level of NDST3 protein of shNDST3 was significantly reduced compared with the control group, proving the knockdown effect of shNDST3 plasmid on mouse cells; in the HEK293 cells on the right (human embryonic kidney cells), the expression level of NDST3 protein of shNDST3 was significantly reduced compared with the control group, proving the knockdown effect of shNDST3 plasmid on human cells. The above structures all indicate that our shNDST3 has a knockdown effect on both human and mouse cells.

[0044] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A method for constructing an NDST3 knockdown plasmid, characterized by: The following steps are included: S1, query the sequence number of NDST3, and the selected target sequence is GGGAATGACCGACTGGGATTA; S2. A double-stranded DNA fragment with sticky ends is formed by annealing the forward oligonucleotide and the reverse oligonucleotide. The stuffer sequence in the middle is removed by the corresponding double enzyme digestion reaction to expose the sticky ends. This fragment is then ligated with a plasmid vector linearized by the same double enzyme digestion reaction to construct a recombinant plasmid. S3. Add 5 μL of forward oligonucleotide and 5 μL of reverse oligonucleotide to 5 μL of 10x NEB buffer 2, then add 35 μL of ddH2O to dilute to 20 μM. Place in a PCR instrument and maintain at 95°C for 5 minutes, then cool to 70°C for 10 minutes, and then slowly cool to room temperature to obtain an oligos concentration of 6 pmol. S4. Use the double enzyme digestion system and single enzyme digestion system of Sangon to perform plasmid digestion, and set up an empty plasmid group; S5. Use Takara-DNA Ligation kit ver.2.1 to connect oligos and plasmids. 7ul plasmid (315ng), 1ul oligos, and 8ul solution I were ligated using a PCR instrument at 16°C for 30min.

2. The method for constructing an NDST3 knockdown plasmid according to claim 1, characterized in that: In step S2, the forward oligonucleotide is 5'CCGGGGGAATGACCGACTGGGATTACTCGAGTAATCCCAGTCGGTCATTCCCTTTTTG3'; The reverse oligonucleotide was 5'AATTCAAAAAGGGAATGACCGACTGGGATTACTCGAGTAATCCCAGTCGGTCATTCCC 3'.

3. The method for constructing an NDST3 knockdown plasmid according to claim 2, wherein: In step S4, the double enzyme digestion system contains 15ul of Nuclease-free water, 2ul of 10xSpeedyOne Buffer, 2ul of pLKO.1TRC, and 1ul of SpeedyCutAgel enzyme; The single enzyme digestion system contains 16ul of Nuclease-free water, 2ul of 10xSpeedyOne Buffer, 1ul of pLKO.1TRC, and 1ul of SpeedyCut EcoR I.

4. The NDST3 constructed by the method for constructing an NDST3 knockdown plasmid according to claim 1 is used for treating NDST3 gene-related mental illnesses.

Images