Cysticercosis cellulosae nano vaccine as well as preparation and application thereof

Abstract

The invention discloses a cysticercosis cellulosae nano vaccine and preparation and application thereof, designed and synthesized target gene segments comprise taenia solium TsF and TSOL18, and the TsF can be self-assembled into 24-polymer ferritin nano particles in escherichia coli, so that the immune protection effect of the TsF can be exerted, and the immune protection effect of the TsF can be improved; more importantly, the TSOL18 antigen is displayed on the surface of the ferritin nanoparticle, so that the surface area of an antigen molecule and the phagocytic ability of antigen phagocytes such as host macrophages are greatly improved, and the presentation efficiency of antigen presentation cells on the antigen is greatly improved, thereby enhancing the immune protection effect of the TSOL18 antigen.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the preparation and application of a nano vaccine for cysticercosis. Background Art

[0002] Cysticercosis in pigs is a major zoonotic parasitic disease caused by the larvae of the hooked tapeworm Taenia solium (Taenia solium). Adult worms inhabit the human small intestine, while larvae inhabit the muscle, brain, eyes, and other tissues of intermediate hosts, including humans and pigs, causing cysticercosis in various locations. In particular, neurocysticercosis (NCC) in the human brain can lead to epilepsy and even death. Cysticercosis not only causes significant economic losses to the pig industry but also poses a serious threat to human health. Currently, the globally accepted approach to preventing and controlling the disease is a combination of vaccination for pigs and deworming for humans. Therefore, vaccines play a crucial role in the comprehensive prevention and control of cysticercosis. Currently, the TSOL18 recombinant subunit vaccine, based on the oncocyst stage of Taenia solium, has been clinically evaluated in several African countries, demonstrating excellent immune protection. It has also been commercially produced in India. However, this vaccine does not yet provide complete protection in pigs, and its effectiveness needs to be further improved. Therefore, further improving the protective efficacy of the TSOL18 recombinant antigen will be a key focus of cysticercosis vaccine research and effective disease prevention and control.

[0003] In recent years, nanovaccines, with their unique physical, chemical, and biological properties, have demonstrated tremendous potential in improving vaccine efficacy, safety, antigen utilization, and antigen stability, and their application in vaccine development has become increasingly widespread. Nanoantigens formed through natural self-assembly possess enhanced stability, can rapidly activate antigen-presenting cells, promote antigen uptake and cross-presentation, and thus enhance the immune efficacy of antigens. Because natural ferritin is composed of 24 monomers, nanovaccines based on Helicobacter pylori ferritin have been extensively studied in medicine and veterinary medicine, significantly enhancing the immune protection of vaccine antigens. While numerous studies have demonstrated that TSOL18 is the optimal candidate antigen for a Taenia solium vaccine, even this vaccine antigen does not achieve 100% protection. Therefore, the development of nanovaccines based on TSOL18 to further enhance the immune protection of TSOL18 vaccines is highly desirable. Furthermore, literature has reported that ferritin from Taenia saginata exhibits immune protection. Therefore, if the cloned pork tapeworm ferritin (TsF) is fused with the TSOL18 gene for expression, thereby displaying the TSOL18 antigen on the surface of TsF particles and developing a TSOL18-based pork cysticercosis ferritin nanovaccine, it is expected to further improve the immune protection effect of the TSOL18 vaccine. Summary of the Invention

[0004] The present invention aims to provide a method for preparing a nanovaccine that can significantly enhance the immune efficacy of the TSOL18 antigen. Furthermore, the present invention provides an evaluation of the immunopotency enhancement effect of the nanovaccine on mice.

[0005] The technical solutions for achieving the purpose of the present invention are as follows:

[0006] 1. The gene sequence of Taenia solium Ferritin (TsF) (522bp) was obtained by RT-PCR amplification.

[0007] 2. Synthesize a gene fragment containing a 6×His tag, TSOL18, a linker (GGGGS), and TsF, and perform codon optimization. The synthesized target gene fragment connects the TSOL18 gene of Taenia solium to the N-terminus of cysticercosis ferritin via a linker (GGGGS), and incorporates restriction sites at both ends of the gene fragment.

[0008] 3. The synthesized target gene fragment and TSOL18 gene were digested separately, inserted into the pET-30 vector, and recombinant expression vectors (pET-TSOL18 and pET-TSOL18-TsF) were constructed, and induced to express in Escherichia coli.

[0009] 4. The recombinant antigen was purified by nickel (Ni) affinity chromatography, and Western blot analysis and electron microscopy of the nanoparticles were performed. The results showed that TSOL18-TsF self-assembled into nanoparticles with a diameter of 11.9±2.1nm.

[0010] 5. Balb / c mice were immunized with 10 μg of purified TSOL18-TsF nanoparticle antigen and TSOL18 antigen, respectively. The results showed that both the humoral immunity level and the cellular immunity level of the TSOL18-TsF nanoparticle antigen immunization group were significantly higher than those of the TSOL18 antigen group, indicating that the immune protection effect of the TSOL18 antigen was significantly enhanced after being fused with TsF to express into a nanovaccine.

[0011] The target gene fragments designed and synthesized in the present invention include TsF and TSOL18 of Taenia solium. Among them, TsF can self-assemble into 24-mer ferritin nanoparticles in Escherichia coli, which can not only exert the immune protection effect of TsF itself, but more importantly, the TSOL18 antigen is displayed on the surface of the ferritin nanoparticles, which can not only greatly increase the surface area of ​​TSOL18 antigen and the phagocytic ability of antigen-phagocytic cells such as host macrophages, but also significantly improve the presentation efficiency of antigens by antigen-presenting cells, thereby significantly enhancing the immune protection effect of TSOL18 antigen. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The expression and purification of target protein;

[0013] Figure 2 is the electron microscopy observation of TSOL18-TsF nanoparticles;

[0014] Figure 3 This is the particle size analysis diagram of TSOL18-TsF nanoparticles.

[0015] Figure 4 is the particle size distribution range of TSOL18-TsF nanoparticles.

[0016] Figure 5 This is a diagram of the steps for immunizing mice.

[0017] Figure 6 It is the IgG, IgG1, and IgG2a antibody levels of immunized mice.

[0018] Figure 7 This is a graph showing the test results of serum cytokine levels in immunized mice.

[0019] Figure 8 This is an analysis of the ratio of CD4+T / CD8+T in the spleen of immunized mice. DETAILED DESCRIPTION

[0020] Example 1

[0021] 1. Cloning and sequence analysis of the TsF gene

[0022] Total RNA from Taenia solium was extracted and the TsF sequence was amplified by RT-PCR using the designed primers. Sequencing results showed that the obtained sequence was the Taenia solium ferritin (TsF) sequence. The sequencing results of TsF are as follows:

[0023] ATGAATATGATCCGTCAAAATTTCCACGATGAATGCGAAGCTGGCATCAATCGTCAA

[0024] ATCAACATGGAGCTCTACGCCAGCTACCTCTACCTAGCTATGTCTCAACACTTTGAC

[0025] CGGGAAGACGTCGCCCTTCCAGGCTTCAAGAAATTTTTTGCTAAAGCCTCGGAAGAG

[0026] GAGCGTGAACACGCGATAAAGCTCATGTGTTATCAAGTAAACGTGGTGGCCGCAT

[0027] TGTTTATCAAGACATTGCCAAACCCCAGAAAAGTGAATGGGCAACCGGTCTGGAAG

[0028] CCATGGAAACGGCGCTCAAAATCGAGCGAGAGGTCAATGAGTCCCTCCTTGCTTTGT

[0029] GTGATGTCGCTGTCAAACACAGCGACAACCATTTCTCTGATTTCTTGGAAAATGAAT

[0030] ACTTGGGAGAACAAGTAGATGCTATTAAGCAGCTGGCAGACTATGTGACAAACCTC

[0031] CGTCGATGCGGACCCGGACTGGGAGAGTATCTATTTGACAAGGAAACCCTTAACGG

[0032] TGGTGAGGGCTAA

[0033] 2. Design and synthesis of target genes

[0034] TSOL18 was selected as the primary vaccine antigen because it is the best known vaccine antigen for cysticercosis and its expression in Escherichia coli can provide excellent immune protection. Furthermore, since ferritin from Taenia solium has been shown to be immunoprotective, the TSOL18 antigen gene was linked to the N-terminus of T. solium ferritin (TsF). This allowed the TSOL18 antigen to be displayed on the surface of ferritin nanoparticles, creating a TSOL18-based ferritin nanovaccine, further enhancing the immune protection of the TSOL18 vaccine.

[0035] In view of the above objectives, the following target gene fragments were designed and synthesized:

[0036] CATATG (Restriction site)ATGCATCATCACCACCATCAC(H is tag)

[0037] AGCGGCGACCGCACGTTTGGCGATGACATTTTCGTCCCGTATCTCCGTTGCTTCGCG

[0038] TTGAGCGCAACTGAGATTGGTGTTTTCTGGGATGCGGGAGAAATGGTTGGTCACGGT

[0039] GTGGAAGAAATCAAAGTCAAAGTCGAAAAAGCGATCCATCCGTACAAAATCTGGAA

[0040] CGCGACCGTTTCGGCGAACAACGGTAAAGTTATCATCCGTGATCTGAAAGCGAAAA

[0041] CCATCTACCGTGTTGATGTTGATGGCTACCGTAACGAAATCATGGTTTTCGGCAGCC

[0042] AACGTTTCGCGACCACCCTGCCGAAAAAACAGATCAAACACAAAAAAGTTCGTCGTTCG (TSOL18 sequence) GGTGGTGGCGGCAGC (flexible linker) GATATCATCAAACTGCTGAACGAACAAGTGAACAAAGAAATGAACAGCTCCAAC CTGTACATGAGCATGAGCTCCTGGTGCTACACCCACAGCCTGGATGGCGCGGGCCTGTTCCTGTTCGATCACGCGGCGGAAGAATACGAACACGCGAAAAAAACTGATCATCTTCCTGAACGAAAACAACGTTCCGGTTCAGCTGACCTCTATCAGCGCGCCGGAACACAAATTCGAAGGCCTGACCCAGATCTTCCAGAAAGCGTACGAACACGAACAGCAC ATCTCTGAATCTATCAACAACATCGTCGATCACGCGATCAAATCCAAAGACCACGCGACCTTCAACTTCTTGCAGTGGTACGTTGCGGAACAGCACGAAGAAGAAGTTCTTTTCAAAGATATCCTGGACAAGATCGAGCTTATCGGCAACGAAAACCACGGCCTGTACCTGGCGGATCAGTACGTTAAAGGTATCGCGAAAAGCCGTAAAAGCTAA (TsF sequence) CTCGAG (Enzyme cutting site)

[0043] The information in brackets is the description of the previous fragment.

[0044] 3. Construction of recombinant expression vector

[0045] The designed and synthesized target gene sequence, TSOL18 gene sequence, and prokaryotic expression vector pET-30a were digested with enzymes, and the target fragments were recovered and ligated overnight with T4 DNA ligase. The ligation products were transformed into DH5a competent cells, and recombinant-positive strains were identified by PCR and enzyme digestion. The recombinant plasmids pET-TSOL18 and pET-TSOL18-TsF were then extracted, respectively.

[0046] 4. Expression and purification of target sequences

[0047] The recombinant plasmids pET-TSOL18-TsF and pET-TSOL18 were transformed into BL21 competent cells, induced by IPTG, and the supernatant and precipitate of the bacterial lysate were collected for SDS-PAGE electrophoresis. After confirming the expression of the target protein, Ni-agarose magnetic beads were used for affinity purification.

[0048] Example 2

[0049] Electron microscopy observation and particle size analysis of TSOL18-TsF nanoparticles

[0050] Observation by electron microscopy ( Figure 2 ) and particle size analysis ( Figure 3 , 4) all showed that TSOL18-TsF self-assembled into nanoparticles with a particle size of 11.9±2nm in Escherichia coli, which was consistent with the expected results.

[0051] Example 3

[0052] Evaluation of the immune effect of nanovaccines

[0053] Six healthy BALB / c mice aged 6 to 8 weeks were selected and immunized three times with 10 μg of TSOL18 and an equal molar amount of TSOL18-F antigen at two-week intervals. Blood samples were collected at 0, 2, 4, 6, and 8 weeks to analyze the humoral immunity levels of the immunized mice. The results showed that after the second immunization, the IgG, IgG1, and IgG2a levels of the TSOL18-TF protein immunization group were significantly higher than those of the TSOL18 group, and reached the maximum after the third immunization (e.g., Figure 6 This indicates that the antibody (humoral immunity) level stimulated by TSOL18-TF nanoparticle antigen was significantly higher than that in the TSOL18 antigen group.

[0054] The results of ELISA showed that the IFN-r / IL-4 levels of the TSOL18-TsF protein group were significantly higher than those of the TSOL18 group after the second immunization, and the difference was most significant after the third immunization. Further flow cytometry showed that the CD4 + T / CD8 + The ratio of T cells was much higher than that of TSOL18 group. The CD4 + T / CD8 + The changes in the ratio of T cells were similar. The above results all indicate that TSOL18-TsF nanoantigen induced mice to produce stronger cellular immunity levels.

Claims

1. A method for preparing nanoparticle antigens for cysticercosis, characterized in that: The following steps are involved: a. The gene sequence of Taenia solium ferritin was obtained by RT-PCR amplification; b. Synthesize a gene fragment including a 6×His tag, TSOL18, a linker molecule (GGGGS), and TsF, and simultaneously perform codon optimization; the synthesized target gene fragment connects the TSOL18 gene of Taenia solium to the N-terminus of cysticercosis ferritin via a linker (GGGGS), and enzyme cleavage sites are added at both ends of the gene fragment; c. The synthesized target gene fragment and TSOL18 gene were digested separately, inserted into the pET-30 vector, and recombinant expression vectors (pET-TSOL18 and pET-TSOL18-TsF) were constructed. The recombinant expression vectors were then induced in Escherichia coli. d. Expression and purification of target sequence.

2. The method for preparing the nanoparticle antigen for cysticercosis according to claim 1, characterized in that: The step a is specifically as follows: extracting total RNA of Taenia solium, using designed primers to amplify the TsF sequence by RT-PCR, and the obtained sequence is the Taenia solium ferritin (TsF) sequence, and the nucleotide sequence is SEQ ID NO.

1.

3. The method for preparing the nanoparticle antigen for cysticercosis according to claim 1, characterized in that: The nucleotide sequence of the target gene fragment in step b is SEQ ID NO.

2.

4. The method for preparing the cysticercosis nanoparticle antigen according to claim 1, characterized in that: The step c specifically comprises: enzymatically digesting the designed and synthesized target gene sequence, the TSOL18 gene sequence, and the prokaryotic expression vector pET-30a, recovering the target fragments, and ligating them overnight under the action of T4 DNA ligase; transforming the ligation products into DH5a competent cells, identifying the recombinant positive strains by PCR and enzymatic digestion, and then extracting the recombinant plasmids pET-TSOL18 and pET-TSOL18-TsF, respectively.

5. The method for preparing the nanoparticle antigen for cysticercosis according to claim 1, characterized in that: The step d is specifically as follows: the recombinant plasmids pET-TSOL18-TsF and pET-TSOL18 are respectively transformed into BL21 competent cells, the expression is induced with IPTG, the supernatant and precipitate of the bacterial lysate are respectively collected for SDS-PAGE electrophoresis, and after confirming the expression of the target protein, affinity purification is performed using Ni-agarose magnetic beads.

6. A nanoparticle antigen for cysticercosis, characterized by: Prepared by the preparation method described in any one of claims 1 to 5.

7. A nano vaccine for cysticercosis, characterized in that: The antigen in the vaccine is the nanoparticle antigen according to claim 6.

8. A use of the nano vaccine for cysticercosis according to claim 7, characterized in that: Improve the immune protection level of TSOL18 vaccine.

Images