Application of CLCA2 or carrier overexpressing CLCA2 in preparation of medicine for treating triple negative breast cancer

By using CLCA2 as a drug target and using vectors or lentiviruses that overexpress CLCA2 to inhibit the PI3K/AKT signaling axis, the problem of triple-negative breast cancer resistance to carboplatin chemotherapy was solved, achieving effective treatment of triple-negative breast cancer.

CN120683182APending Publication Date: 2025-09-23THE FIRST AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV (GUANGZHOU RESPIRATORY CENT)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510643030.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-19
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing technologies lack effective targeted strategies to address triple-negative breast cancer's resistance to carboplatin chemotherapy, resulting in poor treatment outcomes.

Method used

Using CLCA2 as a drug target, through vectors or lentiviruses overexpressing CLCA2, the PI3K/AKT signaling axis is inhibited, the apoptosis of triple-negative breast cancer cells is promoted, and the sensitivity of carboplatin is enhanced.

Benefits of technology

Significantly inhibit the progression of triple-negative breast cancer, enhance the sensitivity of carboplatin to triple-negative breast cancer, and provide a new treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005408782190000011
    Figure HDA0005408782190000011
  • Figure HDA0005408782190000021
    Figure HDA0005408782190000021
  • Figure HDA0005408782190000031
    Figure HDA0005408782190000031
Patent Text Reader

Abstract

The invention provides an application of CLCA2 or a carrier for overexpressing the CLCA2 or a lentivirus for overexpressing the CLCA2 in preparation of a medicine for treating triple negative breast cancer. The invention firstly points out that the CLCA2 is a regulatory factor for promoting the apoptosis of triple negative breast cancer cells, and compared with a wild mouse, the mouse overexpressing the CLCA2 shows that the tumor progression of the triple negative breast cancer is obviously inhibited. It is proposed for the first time that the drug target CLCA2 can regulate and control cell apoptosis of the triple-negative breast cancer, the sensitivity of platinum chemotherapeutic drugs (carboplatin) of the triple-negative breast cancer is enhanced by inhibiting a PI3K-AKT signal channel, and a new regulatory factor is provided for improvement of a cell apoptosis signal channel.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the use of CLCA2 or a vector overexpressing CLCA2 or a lentivirus overexpressing CLCA2 in preparing a drug for treating triple-negative breast cancer. Background Art

[0002] Triple-negative breast cancer (TNBC) is a solid tumor that is negative for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (Her-2). It is characterized by poor differentiation, high invasiveness, susceptibility to local and distant metastasis, poor prognosis, and high recurrence rate. Due to the lack of specifically approved targeted therapies, the treatment of triple-negative breast cancer relies on chemotherapy. Carboplatin, as one of the conventional chemotherapy drugs, can cross-link with DNA to form carboplatin-DNA adducts, inducing DNA double-strand breaks and exerting cytotoxic effects, thereby promoting tumor cell apoptosis and achieving the purpose of killing tumor cells. Although many TNBCs are initially sensitive to platinum-based chemotherapy, they tend to develop resistance to carboplatin over time.

[0003] The CLCA2 gene (Calcium-Activated Chloride Channel, Family Member 2) encodes a calcium-activated chloride channel protein and is primarily expressed in epithelial cells. This gene regulates chloride and water permeability in cells and is involved in numerous physiological processes, including cell signaling, mucus secretion, and cell proliferation. Recent studies have shown that CLCA2 is frequently downregulated in breast cancer and is a candidate tumor suppressor gene that negatively regulates breast cancer cell migration and invasion. CLCA2 deficiency promotes epithelial-mesenchymal transition (EMT) in breast cells and is associated with a higher risk of breast cancer. In recent years, a growing number of reports have demonstrated that EMT plays a crucial role in mediating drug resistance, suggesting that CLCA2 may be involved in carboplatin resistance.

[0004] Given the lack of direct targeting strategies for carboplatin resistance and the drawbacks of existing indirect targeting strategies, there is an urgent need to explore new strategies and targets for treating carboplatin-resistant breast cancer. This study reveals a novel drug target, CLCA2, that mediates apoptosis, thereby inhibiting the progression of triple-negative breast cancer and enhancing carboplatin sensitivity. Summary of the Invention

[0005] The present invention aims to provide the use of CLCA2, a CLCA2-overexpressing vector, or a CLCA2-overexpressing lentivirus in the preparation of a drug for the treatment of triple-negative breast cancer. As a drug target, CLCA2 inhibits the PI3K / AKT signaling axis, mediating apoptosis, thereby inhibiting the progression of triple-negative breast cancer and enhancing sensitivity to platinum-based chemotherapy drugs. This invention provides a new scientific perspective and target for ameliorating platinum-based chemotherapy resistance in triple-negative breast cancer.

[0006] To achieve the above objectives, the technical solution adopted is: use of CLCA2 or a vector overexpressing CLCA2 in the preparation of a drug for treating triple-negative breast cancer.

[0007] The present invention provides the use of CLCA2 or a vector overexpressing CLCA2 in the preparation of a drug for enhancing the sensitivity of triple-negative breast cancer to platinum-based chemotherapy drugs.

[0008] Preferably, the platinum chemotherapy drug is carboplatin.

[0009] The present invention provides the use of CLCA2 or a vector overexpressing CLCA2 in preparing a drug for inhibiting the progression of triple-negative breast cancer.

[0010] The present invention provides the use of CLCA2 or a vector overexpressing CLCA2 in preparing a drug for promoting apoptosis of breast cancer cells.

[0011] Preferably, the CLCA2-overexpressing vector is a CLCA2-overexpressing lentivirus.

[0012] Preferably, the lentivirus overexpressing CLCA2 comprises a target core plasmid overexpressing CLCA2 and a packaging plasmid, and the sequence of the target core plasmid overexpressing CLCA2 is shown in SEQ ID NO: 3; more preferably, the packaging plasmid comprises packaging plasmids PxpaX2 and PMD2G.

[0013] Preferably, the CLCA2-overexpressing lentivirus is obtained by co-transfecting a target core plasmid and a packaging plasmid overexpressing CLCA2 into cells for lentiviral packaging, and the sequence of the target core plasmid overexpressing CLCA2 is shown in SEQ ID NO: 3; more preferably, the packaging plasmid includes packaging plasmids PxpaX2 and PMD2G, and the cells are HEK293T cells.

[0014] The present invention provides a lentiviral vector for overexpressing CLCA2, comprising a target core plasmid for overexpressing CLCA2 and a packaging plasmid. The sequence of the target core plasmid for overexpressing CLCA2 is shown in SEQ ID NO: 3; preferably, the packaging plasmid comprises packaging plasmids PxpaX2 and PMD2G.

[0015] The present invention provides a lentivirus that overexpresses CLCA2. The lentivirus is obtained by transfecting the above-mentioned lentiviral vector into cells for lentiviral packaging; preferably, the cells are HEK293T cells.

[0016] Beneficial effects:

[0017] This study is the first to use CLCA2 as a drug target to improve carboplatin resistance in triple-negative breast cancer. It is also the first to clearly demonstrate that overexpression of CLCA2 inhibits the PI3K / AKT signaling pathway, thereby inhibiting the progression of triple-negative breast cancer and enhancing its sensitivity to carboplatin.

[0018] This invention points out for the first time that CLCA2 is a regulatory factor that promotes apoptosis of triple-negative breast cancer cells. Compared with wild-type mice, mice overexpressing CLCA2 showed significantly inhibited tumor progression of triple-negative breast cancer and significantly enhanced the drug sensitivity of triple-negative breast cancer to platinum-based chemotherapy drugs (such as carboplatin). It is also the first time to propose that CLCA2, as a drug target, can regulate the apoptosis of triple-negative breast cancer cells and enhance the sensitivity of triple-negative breast cancer to platinum-based chemotherapy drugs by inhibiting the PI3K-AKT signaling pathway. This also provides a new regulatory factor for the improvement of the cell apoptosis signaling pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The protein expression of CLCA2 in triple-negative breast cancer cell lines.

[0020] Figure 2 Overexpression of CLCA2 enhances the apoptotic effect of carboplatin on TNBC cells. CLCA2 can enhance the apoptotic effect of carboplatin on TNBC cells.

[0021] Figure 3 This is a graph showing the inhibition of p-PI3K and p-AKT protein expression in TNBC cells by overexpression of CLCA2.

[0022] Figure 4 Schematic diagram of the construction of a mouse subcutaneous xenograft tumor (CDX) model of TNBC in the CLCA2 overexpression group.

[0023] Figure 5 Figure 3 is a diagram of a TNBC mouse model in which overexpression of CLCA2 synergizes with carboplatin to inhibit the progression of triple-negative breast cancer. A is a diagram of tumor tissues in two groups of TNBC mouse models, and B is a line graph of the tumor growth curves in two groups of TNBC mouse models.

[0024] Figure 6 Figure 2 shows CLCA2 overexpression suppressing p-PI3K and p-AKT protein expression in CDX model tumor tissues. CLCA2 inhibits the PI3K / AKT signaling pathway in the CDX model. DETAILED DESCRIPTION

[0025] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0026] The present invention involves subcutaneous injection of tumor cells into mice, which form tumors one week later. Compared with wild-type mice, tumor growth in mice overexpressing CLCA2 is significantly inhibited. Overexpressing CLCA2 at the cellular level can increase the degree of necroptosis in triple-negative breast cancer cells. CLCA2 mediates the occurrence of cell apoptosis through the PI3K / AKT signaling axis, inhibiting the progression of triple-negative breast cancer. After treatment with a lentivirus overexpressing CLCA2, the sensitivity of triple-negative breast cancer to carboplatin is also significantly enhanced. Therefore, CLCA2 is a key target for the treatment of triple-negative breast cancer. Overexpressing CLCA2 lentivirus can upregulate the expression of CLCA2 in triple-negative breast cancer cells, providing a new target and strategy for the treatment of breast cancer.

[0027] The present invention uses lentiviral transfection technology to construct breast cancer cell lines that overexpress CLCA2 and knock down CLCA2. The specific process is as follows:

[0028] HEK293T cells were cultured to the logarithmic growth phase, seeded in 6-well plates, and transfected when the cell density reached 50%. The transfection reagent was prepared in two solutions. Solution A consisted of 125 μl Opti-MEM medium diluted with 5 μl Lipofectamine TM 3000 reagent, followed by 10 μl P3000 TM Reagent, flick to mix, and let it stand at room temperature for 5-10 minutes. Solution B contains the oeRNA or shRNA target core plasmid and the packaging plasmids PxpaX2 and PMD2G, which are configured in a ratio of 10:7:3. After pipetting evenly, let it stand for 5 minutes. After the two solutions are thoroughly mixed, let it stand at room temperature for 15 minutes. Fresh culture medium is added dropwise to the cell culture medium in the 6-well plate and gently shaken to mix evenly. After 8 hours, the supernatant is removed and replaced with fresh culture medium. After 24 hours, the cell culture medium is collected, centrifuged at 3000 rpm for 5 minutes, and filtered with a 0.45 μm filter membrane to remove dead cells. The collected liquid is the CLCA2 overexpression lentiviral solution or the CLCA2 knockdown lentiviral solution.

[0029] CLCA2 Gene ID: 9635

[0030] The CDS sequence (SEQ ID NO:1) is: gt aatattcaga tgaatgctcc aaggaaatca gtaggcagaaatgaggagga gcgaaagtgg ggctttagcc gagtcagctc aggaggctcc ttttcagtgc tgggagttccagctggcccc caccctgatg tgtttccacc atgcaaaatt attgacctgg aagctgtaaa agtagaagaggaattgaccc tatcttggac agcacctgga gaagactttg atcagggcca gg。

[0031] The core plasmid sequence of the shRNA target (i.e., the plasmid sequence for knocking down CLCA2) (SEQ ID NO:2):

[0032]

[0033] oeRNA target core plasmid sequence (i.e., plasmid sequence for overexpressing CLCA2) (SEQ ID NO: 3):

[0034]

[0035] Healthy breast cancer cells (MDA-MB-231 cells and BT-549 cells) were seeded into 6-well plates and infected when the cell density reached 50%. The cells were washed 1-2 times with PBS, then replaced with 2 ml of antibiotic-free medium, and the overexpression CLCA2 lentiviral solution or the knockdown CLCA2 lentiviral solution was gradually added dropwise (200 μl of lentiviral solution was added to each well). After 24 hours, fresh antibiotic-free medium was replaced. 48 hours after the target cells were infected with the lentivirus, they were screened for resistance using puromycin. The screening criteria were complete cell death in the control group, more than half of the cells in the experimental group had a survival rate, and no significant slowing of the growth rate. After adding puromycin, the culture medium containing puromycin was replaced every 48 hours until the control cells were completely eliminated. Subsequently, the expression level of the target gene was analyzed by real-time fluorescence quantitative PCR and immunoblotting experiments, and the overexpression effect of oeRNA or shRNA on the RNA and protein levels of CLCA2 was detected. The oe-CLCA2 and sh-CLCA2 breast cancer cells with the best effect were selected for subsequent experiments. The selected cells were subcultured and maintained at a low concentration of puromycin to maintain gene expression. Breast cancer cell lines overexpressing CLCA2 and breast cancer cell lines knocking down CLCA2 were successfully constructed and used in subsequent experiments or frozen and stored at -80°C.

[0036] Example 1

[0037] Remove the MDA-MB-231 and BT-549 cells to be revived from liquid nitrogen and quickly place them in a water bath. Once thawed, remove the cryovials from the water bath, aspirate the liquid, and add it to the prepared culture medium. Centrifuge at 1000 rpm for 4 minutes, discard the supernatant, and add the cell pellet to DMEM complete culture medium supplemented with 10% fetal bovine serum, 100 U / mL penicillin, and 0.1 mg / mL streptomycin. Incubate the cells in a cell culture incubator at 37°C and 5% CO2. After the cells have been thawed, harvest them for subsequent Western blotting.

[0038] After treatment, discard the old culture medium of MDA-MB-231 cells and BT-549 cells, wash them 2-3 times with pre-cooled PBS, scrape the cells in the culture flask with a cell scraper, centrifuge at 3000rpm for 5min, collect the cell pellet, add RIPA lysis buffer, resuspend the cell pellet, and lyse on ice for 1 hour. During this period, pipette once every 15min to ensure sufficient lysis, centrifuge at 12000rpm for 10min, and retain the supernatant, which is the total cell protein. According to the manufacturer's instructions, use the BCA method to determine the protein concentration, add 5x protein loading buffer, boil in a 100℃ metal bath for 10min, denature the protein, cool, and perform polyacrylamide gel electrophoresis, PVDF transfer, antibody incubation and development. The specific process is as follows:

[0039] Gel Preparation: Wash and dry the glass plates. Align the two glass plates and place them in a gel preparation fixture. Prepare a separation gel of appropriate concentration based on the relative molecular weights of the target protein and internal reference protein. Pour the gel between the glass plates and press with water. Once the separation gel solidifies, discard the top layer of gel, add 5% stacking gel, and insert a cleaned comb. Sample Loading: After the stacking gel solidifies, secure it to the gel holder and add 1x electrophoresis buffer to the center of the holder. Remove the comb and add the prepared protein sample and protein marker. Fill the blank wells with 1x protein loading buffer. Electrophoresis: Initial voltage is 80V. After the protein marker band runs away, adjust the voltage to 120V. Stop electrophoresis when the target protein reaches the corresponding position. Transfer: Soak the PVDF membrane in methanol for 5 minutes to activate it. Create a sandwich transfer structure by placing two layers of thick filter paper, one layer of thin filter paper, gel, the activated PVDF membrane, one layer of thin filter paper, and two layers of thick filter paper in the order from negative to positive. Ensure that no bubbles are trapped. Transfer the membrane in an ice-water bath at a constant current of 300 mA. The specific transfer time is determined according to the manufacturer's instructions. Proteins are transferred to the PVDF membrane. Blocking: Block the PVDF membrane with 5% nonfat milk blocking solution on a horizontal shaker for 1 hour at room temperature. Primary antibody incubation: After milk blocking, wash the membrane three times with TBST buffer (10 minutes each time), then add the corresponding primary antibody and incubate overnight at 4°C. Secondary antibody incubation: Wash the membrane three times with TBST buffer (10 minutes each time). Add the secondary antibody and incubate at room temperature for 90 minutes. Development and exposure: Wash the membrane three times with TBST buffer (10 minutes each time). Prepare ECL developer according to the manufacturer's instructions, apply evenly to the PVDF membrane, and expose in a chemiluminescence analyzer.

[0040] The CLCA2 overexpression lentivirus and CLCA2 knockdown lentivirus were transfected into MDA-MB-231 cells and BT-549 cells. WB results showed that the CLCA2 overexpression lentivirus was successfully transfected and the protein expression level of CLCA2 was significantly increased ( Figure 1 ).

[0041] Flow cytometry was used to detect the markers of necroptosis, Annexin V, and the PI pathway. The results showed that overexpression of CLCA2 in breast cancer cells significantly increased the number of early and late apoptotic cells. At the same time, when breast cancer cells were treated with carboplatin, overexpression of CLCA2 further enhanced the killing effect of carboplatin on triple-negative breast cancer cells. Figure 2 ).

[0042] To clarify the signaling pathway regulated by CLCA2, CLCA2-overexpressing lentivirus and CLCA2-knockdown lentivirus were used to transfect MDA-MB-231 cells and BT-549 cells, and the expression of CLCA2 and PI3K / AKT signaling pathway was detected. Figure 3 As shown in the figure, CLCA2 can downregulate the protein expression levels of P-PI3K and P-AKT.

[0043] Based on the above research findings, Figure 4 As shown, wild-type MDA-MB-231 tumor cells and constructed MDA-MB-231 cell lines overexpressing CLCA2 were subcutaneously injected into mice. Tumors formed after 1 week, and the tumor size and body weight of the mice were measured every 3 days. 3 The two groups of mice were killed by carbon dioxide method, the mouse tumors were removed and tumor images were collected, and part of the tumor tissue was cut after rinsing with PBS, fixed with 4% paraformaldehyde for 24 hours, dehydrated, and embedded in paraffin before sectioning. The expression of proteins related to CLCA2 and PI3K / AKT signaling pathways were detected using paraffin sections combined with IHC staining.

[0044] Figure 5 The results showed that CLCA2 inhibited the progression of triple-negative breast cancer in the CDX model. Overexpression of CLCA2 inhibited the expression of P-AKT and P-PI3K in breast cancer tissues, resulting in a significant inhibition of tumor growth in mice ( Figure 6 ).

[0045] In summary, overexpression of CLCA2 can effectively promote breast cancer cell apoptosis, inhibit the PI3K / AKT signaling pathway, inhibit the progression of breast cancer, and enhance the sensitivity of breast cancer to carboplatin, providing a more precise and scientific treatment strategy for breast cancer.

[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Use of CLCA2, a vector overexpressing CLCA2, or a lentivirus overexpressing CLCA2 in the preparation of a drug for the treatment of triple-negative breast cancer.

2. Use of CLCA2, a vector overexpressing CLCA2, or a lentivirus overexpressing CLCA2 in the preparation of a drug for enhancing the sensitivity of triple-negative breast cancer to platinum-based chemotherapy drugs.

3. The use according to claim 2, characterized in that The platinum chemotherapy drug is carboplatin.

4. Use of CLCA2, a vector overexpressing CLCA2, or a lentivirus overexpressing CLCA2 in the preparation of a drug for inhibiting the progression of triple-negative breast cancer.

5. Use of CLCA2, a vector overexpressing CLCA2, or a lentivirus overexpressing CLCA2 in the preparation of a drug for promoting apoptosis in breast cancer cells.

6. The use according to any one of claims 1 to 5, characterized in that: The CLCA2-overexpressing vector is a CLCA2-overexpressing lentiviral vector.

7. The use according to claim 6, characterized in that The lentivirus overexpressing CLCA2 includes a target core plasmid overexpressing CLCA2 and a packaging plasmid. The sequence of the target core plasmid overexpressing CLCA2 is shown in SEQ ID NO: 3; preferably, the packaging plasmid includes packaging plasmids PxpaX2 and PMD2G.

8. The use according to any one of claims 1 to 5, characterized in that: The CLCA2-overexpressing lentivirus is obtained by co-transfecting a target core plasmid overexpressing CLCA2 and a packaging plasmid into cells for lentiviral packaging. The sequence of the target core plasmid overexpressing CLCA2 is shown in SEQ ID NO: 3; preferably, the packaging plasmid includes packaging plasmids PxpaX2 and PMD2G, and the cells are HEK293T cells.

9. A lentiviral vector for overexpressing CLCA2, characterized in that: It comprises a target core plasmid for overexpressing CLCA2 and a packaging plasmid. The sequence of the target core plasmid for overexpressing CLCA2 is shown in SEQ ID NO:

3. Preferably, the packaging plasmid comprises packaging plasmids PxpaX2 and PMD2G.

10. A lentivirus that overexpresses CLCA2, characterized in that: The lentivirus is obtained by transfecting the lentiviral vector according to claim 9 into cells for lentiviral packaging; preferably, the cells are HEK293T cells.