Method for improving synthesis efficiency of terminal deoxyribonucleic acid transferase DNA
By controlling the concentration ratio and distribution of the DNA initiating chain and the hindering chain on the solid phase carrier, the problem of low efficiency of TdT enzyme connection with DNA single chain was solved, and the synthesis efficiency of TdT enzyme was improved and the cost was reduced.
Patent Information
- Application Number
- CN202510942300.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-07-11
- Filing Date
- 2025-07-09
- Publication Date
- 2025-09-23
AI Technical Summary
During DNA synthesis, the steric hindrance effect causes low efficiency in the connection between TdT enzyme and DNA single strand on the solid phase carrier, which affects the synthesis efficiency.
By controlling the concentration ratio of the DNA initiating chain and the DNA hindering chain during the solid phase carrier connection process, it is ensured that they are evenly mixed and fixed on the solid phase carrier, reducing or eliminating the steric hindrance effect.
The synthesis efficiency of TdT enzyme is improved, the consumption of TdT enzyme is reduced, and the cost is reduced.
Smart Images

Figure CN120683207A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of DNA synthesis, in particular to a method for improving the DNA synthesis efficiency of terminal deoxyribonucleic acid transferase. Background Art
[0002] Synthetic biology, as an emerging discipline, has rapidly grown in influence since the 21st century. DNA synthesis, as a foundational technology within synthetic biology, is of undeniable importance. DNA synthesis can be performed primarily through chemical and enzymatic methods. Compared to chemical synthesis, enzymatic synthesis is more cost-effective, safer, and more environmentally friendly. It also offers significant potential in terms of length and precision of synthesis.
[0003] Enzymatic synthesis is an emerging DNA synthesis method that primarily utilizes terminal deoxynucleotidyl transferase (TdT) as a tool for constructing DNA sequences. TdT incorporates dNTPs into the ends of oligonucleotides, enabling de novo DNA synthesis. Compared to chemical synthesis, enzymatic synthesis does not require large amounts of toxic reagents, has mild reaction conditions, and can achieve the extension of long DNA single strands in vitro.
[0004] Steric hindrance primarily refers to the spatial obstruction caused by the proximity of certain atoms or groups within a molecule. For example, in ligand compounds, steric hindrance can affect ligands with larger groups, hindering their ability to form coordination complexes with the central atom. Alternatively, in enzymatic reactions, steric hindrance can prevent the substrate and enzyme active site from approaching each other, reducing catalytic activity. Steric hindrance is a double-edged sword: it can reduce reaction activity due to the occupied space, but it can also increase reaction rate in certain reactions due to the repulsive forces between groups.
[0005] The necessary condition for TdT enzyme to synthesize DNA is that it binds to the DNA initiator strand. During the DNA synthesis process, the DNA single strand is usually fixed to a solid phase support. This is to facilitate the collection of the DNA single strand after DNA synthesis and also to simplify the synthesis process. After the DNA is fixed to the solid phase support, the size of the TdT enzyme is much larger than the DNA single strand. Due to the existence of steric hindrance, the distribution of the DNA single strand on the solid phase support will affect the efficiency of the TdT enzyme to connect to the DNA single strand, thereby affecting the synthesis efficiency of the TdT enzyme. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a method for improving the synthesis efficiency of terminal deoxyribonucleic acid transferase DNA.
[0007] In order to solve the above technical problems, the technical solution of the present invention is:
[0008] A method for improving the DNA synthesis efficiency of terminal deoxyribonucleic acid transferase (TdT) by controlling the concentration ratio of the DNA priming chain to the DNA hindering chain during the connection process with the solid phase support, thereby controlling the distribution of the priming chain on the solid phase support, thereby reducing or completely eliminating the steric hindrance effect between the TdT enzyme and the DNA priming chain.
[0009] Preferably, in the above method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase, the DNA priming chain and the DNA blocking chain are uniformly mixed in proportion, and then the mixed solution is added to the solid phase support and stirred to ensure that the DNA priming chain and the DNA blocking chain are fully and evenly mixed, thereby ensuring that the DNA priming chain and the DNA blocking chain can be uniformly and randomly contacted during the connection process with the solid phase support, so that the DNA priming chain and the DNA blocking chain are uniformly fixed on the solid phase support.
[0010] Preferably, in the above-mentioned method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase, the length of the priming chain is greater than or equal to 22 nt, and the priming chain is (T)n, (A)n, (C)n or (G)n, wherein T represents deoxythymidine nucleotide (abbreviated as deoxythymidine), A represents deoxyadenine nucleotide (abbreviated as deoxyadenosine), C represents deoxycytosine nucleotide (abbreviated as deoxycytidine), and G represents deoxyguanine nucleotide (abbreviated as deoxyguanosine).
[0011] Preferably, in the above-mentioned method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase, the length of the DNA hindering chain is greater than or equal to 10 nt, and the length difference between the DNA hindering chain and the DNA priming chain is greater than 12 nt, and the DNA hindering chain is a single DNA chain that is shorter than the priming chain and does not form a complementary pairing with the priming chain.
[0012] Preferably, in the above method for improving the efficiency of terminal deoxynucleotidyl transferase DNA synthesis, the concentration ratio of the DNA initiating strand to the DNA hindering strand is 1:1-1:64.
[0013] Preferably, in the above method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase, after the DNA priming chain is fixed to the solid phase carrier, the area occupied by it after being projected onto the surface of the fixed carrier should be 1.5%-50% of the surface area of the solid phase carrier.
[0014] Preferably, in the above method for improving the efficiency of terminal deoxyribonucleic acid transferase DNA synthesis, the concentration ratio of the DNA priming chain to the DNA hindering chain is 1:16, and the corresponding surface area of the DNA priming chain after being projected onto the solid phase support accounts for 5.9%.
[0015] Preferably, in the above method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase, the solid phase carrier is a microsphere with a diameter of 1 nm to 50,000 nm or a flat substrate containing an array of reaction wells with a diameter of 1 nm to 50,000 nm.
[0016] Preferably, in the above method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase, the material of the solid phase carrier is silica, polystyrene, polydimethylsiloxane, polytetrafluoroethylene, polymethyl methacrylate or gold.
[0017] Preferably, in the above-mentioned method for improving the efficiency of DNA synthesis by terminal deoxyribonucleic acid transferase, the DNA priming chain and the DNA hindering chain are bound to the solid phase support by modifying biotin on the DNA priming chain and the DNA hindering chain, modifying streptavidin on the solid phase support, and utilizing the binding of biotin and streptavidin to connect the DNA priming chain and the DNA hindering chain to the solid phase support. Other connection methods include the binding of amino groups to aldehyde groups, the binding of amino groups to epoxy groups, the binding of carboxyl groups to amino groups, or the binding of gold atoms to thiol groups.
[0018] Technical effect:
[0019] The above-mentioned method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase (TdT) controls the ratio of the DNA priming strand to the DNA hindering strand during its attachment to the solid support, thereby controlling the distribution of the DNA priming strand on the solid support. This reduces or even completely eliminates the steric hindrance between the TdT enzyme and the DNA priming strand. Its main advantages are: 1) improving the efficiency of enzymatic DNA synthesis by the TdT enzyme on the solid support; 2) reducing the consumption of TdT enzyme during the synthesis process, thereby lowering costs. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is a schematic diagram of the present invention connecting a DNA initiating strand and a DNA hindering strand on a solid phase carrier and performing TdT enzyme synthesis, as well as testing the synthesis results.
[0021] In the figure: 1. DNA priming chain; 2. DNA blocking chain; 3. Solid phase carrier; 4. TdT enzyme solution; 5. dNTP monomer; 6. DNA priming chain synthesized by TdT enzyme; 7. DNA single strand with fluorescent group and complementary to the synthesized part of DNA priming chain.
[0022] Figure 2 This is a diagram of the experimental results of Example 1 of the present invention. DETAILED DESCRIPTION
[0023] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.
[0024] Example 1
[0025] like Figure 1 As shown, a method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase is used. Silica microspheres with a diameter of 10 μm are used as solid phase supports, and streptavidin protein is modified on the solid phase support. A DNA single strand with a length of 29 nt (TTTTTTTTTTCTTGCGACGCGATAGAGTA, 5'-3') and biotin-modified at the 5' end is designed as the DNA priming strand for TdT enzyme synthesis. A DNA single strand with a length of 10 nt (TTTTTTTTTT) and biotin-modified at the 3' end is designed and used as a DNA barrier strand to ensure the distribution of the priming strand on the solid phase support. The specific steps are as follows:
[0026] (1) Mixed solutions of DNA priming strand 1 and DNA blocking strand 2 were prepared at concentration ratios of 1:1, 1:2, 1:4, 1:8, 1:16, 1:32, and 1:64, and then bound to streptavidin-modified silica microspheres (solid phase support 3) at room temperature. The total volume of each sample was 50 μL, wherein the concentrations of the DNA priming strands were 16 μM, 8 μM, 4 μM, 2 μM, 1 μM, and 0.5 μM, respectively, the concentration of the DNA blocking strands was 16 μM, and the concentration of the microspheres was 10 mg / mL.
[0027] (2) After half an hour of reaction, the DNA priming chain (1) and the DNA hindering chain (2) are fully bound to the silica microspheres (3), and then the solution is rinsed with DEPC water to remove the remaining DNA priming chain and DNA hindering chain in the solution. After rinsing, the solution volume is maintained at 25 μL;
[0028] (3) According to the TdT enzyme usage standard, 4 μL of TdT enzyme solution, 5 μL of dGTP solution (5 μL of dNTP monomer, N can be any one of A, G, C, T, and base G is used in this embodiment), and 25 μL of a mixture of Green Buffer solution were added to the microsphere solution at different ratios. The final mixture had a TdT enzyme concentration of 0.4 M / μL, a dGTP solution of 200 μM, and a Green Buffer concentration of 1X (10X in the kit).
[0029] (4) Place the seven reagents in a PCR instrument and set the temperature to 37°C for 30 min of DNA synthesis. After the synthesis is completed, wash the microsphere solution with DEPC water. After washing, the solution volume is maintained at 25 μL.
[0030] (5) Prepare 25 μL of a solution of a DNA single chain 7 (sequence CCCCCCCCCCCCCCCCCCCCCCC) with a fluorescent group (Alex488) and partially complementary to the DNA priming chain synthesis part, wherein the DNA single chain concentration is 200 nM. Mix the solution evenly with the solution washed in step (4). After reacting at 37°C for 30 minutes, the DNA single chain (7) with the fluorescent group (Alex488) and the DNA priming chain (6) synthesized by TdT enzyme complete hybridization connection. Wash the microsphere solution with DEPC solution to remove the remaining free DNA single chain with the fluorescent group in the solution. Then observe the microspheres with different ratios of DNA priming chain and DNA blocking chain using a fluorescence microscope.
[0031] The experimental results are as follows Figure 2 As shown, it is clear that the fluorescence intensity is highest at a DNA priming strand to DNA barrier strand concentration ratio of 1:16, indicating that the number of chains synthesized by the TdT enzyme is the largest. If there were no steric hindrance effect, the hybridization result should be highest at 1:1, and the fluorescence intensity would gradually decrease as the priming strand ratio decreases. However, this result is completely inconsistent with that result. Therefore, it is believed that there is a significant steric hindrance effect between the connection between the TdT enzyme and the DNA single strand on the solid phase support, and the DNA synthesis efficiency is highest when the DNA priming strand to DNA barrier strand ratio is 1:16.
[0032] This example demonstrates that the method of the present invention overcomes the steric hindrance effect of TdT enzyme and single-stranded DNA on the solid support by distributing the DNA priming chain on the solid support, thereby further significantly improving the synthesis efficiency of TdT enzyme and reducing the consumption of TdT enzyme, which is of great significance for DNA chain extension on the solid support.
[0033] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention, which are all considered to be within the scope of protection of the present invention.
Claims
1. A method for improving the efficiency of terminal deoxynucleotidyl transferase DNA synthesis, characterized in that: By controlling the concentration ratio of the DNA priming chain and the DNA hindering chain during the connection process with the solid phase carrier, the distribution of the priming chain on the solid phase carrier is controlled, thereby reducing or completely eliminating the steric hindrance effect between the TdT enzyme and the DNA priming chain.
2. The method for improving the efficiency of terminal deoxynucleotidyl transferase DNA synthesis according to claim 1, wherein: The DNA priming chain and the DNA blocking chain are uniformly mixed in proportion, and then the mixed solution is added to the solid phase carrier and stirred to ensure that it is fully and evenly mixed, thereby ensuring that the DNA priming chain and the DNA blocking chain can be uniformly and randomly contacted during the connection process with the solid phase carrier, so that the DNA priming chain and the DNA blocking chain are uniformly fixed on the solid phase carrier.
3. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 1 or 2, characterized in that: The length of the DNA priming chain is greater than or equal to 22 nt, and the DNA priming chain is (T)n, (A)n, (C)n or (G)n.
4. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 1 or 2, characterized in that: The DNA hindering chain is greater than or equal to 10 nt in length, and has a length difference of greater than 12 nt from the DNA priming chain. The DNA hindering chain is a single DNA chain that is shorter than the priming chain and does not form a complementary pairing with the priming chain.
5. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 1 or 2, characterized in that: The concentration ratio of the DNA initiating strand to the DNA hindering strand is 1:1-1:
64.
6. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 1 or 2, characterized in that: After the DNA priming chain is fixed on the solid phase carrier, it is projected onto the surface of the fixed carrier, and the area it occupies should be 1.5%-50% of the surface area of the solid phase carrier.
7. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 1 or 2, characterized in that: The concentration ratio of the DNA priming strand to the DNA hindering strand is 1:16, and the corresponding surface area of the DNA priming strand after being projected onto the solid phase carrier accounts for 5.9%.
8. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 1 or 2, characterized in that: The solid phase carrier is a microsphere with a diameter of 1nm-50000nm or a flat substrate containing a reaction hole array with a diameter of 1nm-50000nm.
9. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 8, characterized in that: The material of the solid phase carrier is silicon dioxide, polystyrene, polydimethylsiloxane, polytetrafluoroethylene, polymethyl methacrylate or gold.
10. The method for improving the efficiency of DNA synthesis by terminal deoxynucleotidyl transferase according to claim 1 or 2, characterized in that: The DNA priming chain and the DNA barrier chain are combined with the solid phase carrier by modifying biotin on the DNA priming chain and the DNA barrier chain, modifying streptavidin on the solid phase carrier, and utilizing the combination of biotin and streptavidin to connect the DNA priming chain and the DNA barrier chain to the solid phase carrier. Other connection methods include combining amino groups with aldehyde groups, combining amino groups with epoxy groups, combining carboxyl groups with amino groups, or combining gold atoms with thiol groups.