Detection kit for combined methylmalonic acidmia

Abstract

The invention relates to a detection kit for combined methylmalonemia, which is a cb1C type kit and comprises a specific primer pair and a probe combination for detecting at least one mutation site of MMACHC, the mutation site is selected from c.609Ggt; a is c.567 dupT, c.658660delAAG, c.482Ggt, and c.482Ggt; a, c.1Agt; g, c, 80Agt; g, c, 217Cgt; 315Cgt, T, c.315Cgt; g and c.394 Cgt; t). The MMACHC gene hotspot mutation region detection kit based on the real-time fluorescent quantitative PCR technology can detect multiple mutation sites on the MMACHC gene at the same time, detection of three genotypes of wild type, homozygous mutant type and heterozygous mutant type on each mutation site is completed, the gene detection requirements of clinical combined type MMA are effectively met, the detection time is shortened, and the detection efficiency is improved. The mutation site coverage rate of CblC defective methylmalonic acidmia combined with homocysteinemia on the MMACHC gene is increased to 93.28%, mutation hot spots of most people are covered, and various types of mutation conditions in hot spot mutation areas can be rapidly, accurately and sensitively detected.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and human genetic disease detection, and in particular to a detection kit for combined methylmalonic acidemia (MMA). Background Art

[0002] Methylmalonic acidemia (MMA), also known as methylmalonic aciduria, is a hereditary disorder caused by a defect in methylmalonyl-CoA mutase or impaired metabolism of its coenzyme, vitamin B12. This disorder leads to the accumulation of organic acids such as methylmalonyl-CoA, methylmalonic acid, and propionic acid, causing energy metabolism disorders and multi-system and multi-organ damage. Based on genotypic classification, over ten subtypes have been identified. With the exception of the cblX subtype, which is X-linked recessive, all others are autosomal recessive.

[0003] The pathogenesis is caused by a deficiency in methylmalonyl-CoA mutase and its impaired metabolism of its coenzyme, vitamin B12. Clinical manifestations include feeding difficulties, lethargy, seizures, intellectual and motor developmental delays, respiratory distress, and hypotonia in infancy. Late-onset patients may experience movement disorders, cognitive impairment, seizures, psychiatric symptoms, ataxia, spinal cord lesions, hemolytic-uremic syndrome, renal failure, decreased vision, anemia, hypertension, cardiomyopathy, and even sudden death. Predisposing factors include infection, starvation, a high-protein diet, and vaccinations, which can precipitate decompensated episodes.

[0004] MMA is divided into two categories based on whether or not homocystinemia is present. Combined MMA is a cobalamin metabolism disorder primarily caused by mutations in the MMACHC gene. Isolated MMA is typically caused by a deficiency in methylmalonyl-CoA mutase (MCM), with mutations in the MUT gene being the most common. Different genotypes respond differently to vitamin B12 treatment. For example, patients with MMACHC mutations respond to vitamin B12, while those with the Mut gene are generally ineffective.

[0005] Existing MMA detection methods primarily include urine gas chromatography-mass spectrometry and blood tandem mass spectrometry. These methods require repeated testing or combined with genetic testing for a definitive diagnosis, which is costly and time-consuming. Furthermore, while second-generation sequencing offers high throughput and coverage, it is expensive and technically demanding, hindering widespread clinical application.

[0006] The method provided by Chinese patent application CN113957144A is to use multiplex PCR-Sanger sequencing to detect multiple mutation sites. Although the method is fast, it still has problems such as complex operation and high cost. Chinese patent application CN110872622A provides a high-throughput detection method for mutation sites of the MMACHC gene based on genetic molecular typing. KASP amplification is performed through a chip pool, and the amplified chip is detected by a laser confocal chip scanner. The method can complete mutation typing of 13 mutation sites of the human MMACHC gene, including c.609G>A, c.658_660delAAG, c.567dupT, c.80A>G, c.482G>A, c.394C>T, c.1A>G, c.315C>G, c.445_446delTG, c.481C>T, c.217C>T, c.331C>T, and c.365A>T, in the same reaction and at the same time. However, the method is complex and cumbersome in operation, requires high equipment, has low sensitivity, and requires high professionalism in reading the results, which is not conducive to clinical promotion.

[0007] In view of the limitations of the above-mentioned existing technologies, there is an urgent need in the art for a solution that is simple to operate, cost-effective, and can quickly and accurately detect methylmalonic acidemia (especially combined methylmalonic acidemia). Summary of the Invention

[0008] (1) Technical issues to be resolved

[0009] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a kit for detecting MMA-related genes and mutated nucleic acids based on fluorescent quantitative PCR technology, so as to be able to quickly, conveniently and accurately detect combined MMA.

[0010] (2) Technical solution

[0011] A detection kit for combined methylmalonic acidemia, a cb1C type kit, comprising a specific primer pair and probe combination for detecting at least one mutation site of MMACHC; the mutation site of MMACHC is at least one selected from c.609G>A, c.567dupT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G and c.394C>T.

[0012] According to one embodiment of the present invention, the mutation sites of MMACHC are a combination of c.609G>A, c.567dupT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G and c.394C>T.

[0013] According to one embodiment of the present invention, the primer and probe sequences for specific detection of the mutation site c.609G>A are as follows:

[0014] Upstream primer c.609-F: nucleotide sequence as SEQ ID NO: 1,

[0015] Downstream primer c.609-R: nucleotide sequence as SEQ ID NO: 2,

[0016] Probe c.609-P: nucleotide sequence as SEQ ID NO: 3.

[0017] According to one embodiment of the present invention, the primer and probe sequences for specifically detecting the mutation site c.567dupT are as follows:

[0018] Upstream primer c.567-F: nucleotide sequence as SEQ ID NO: 5,

[0019] Downstream primer c.567-R: nucleotide sequence as SEQ ID NO: 6,

[0020] Probe c.567-P: nucleotide sequence as SEQ ID NO: 7.

[0021] According to one embodiment of the present invention, the primer and probe sequences for specifically detecting the mutation site c.658_660delAAG are as follows:

[0022] Upstream primer c.658-F: nucleotide sequence as SEQ ID NO: 9,

[0023] Downstream primer c.658-R: nucleotide sequence as SEQ ID NO: 10,

[0024] Probe c.658-P: nucleotide sequence is as shown in SEQ ID NO:11.

[0025] According to one embodiment of the present invention, the primer and probe sequences for specifically detecting the mutation site c.482G>A are as follows:

[0026] Upstream primer c.482-F: nucleotide sequence as SEQ ID NO: 13,

[0027] Downstream primer c.482-R: nucleotide sequence as SEQ ID NO: 14,

[0028] Probe c.482-P: nucleotide sequence as SEQ ID NO:15.

[0029] According to one embodiment of the present invention, the primer and probe sequences for specific detection of the mutation site c.1A>G are as follows:

[0030] Upstream primer c.1-F: nucleotide sequence as SEQ ID NO: 17,

[0031] Downstream primer c.1-R: nucleotide sequence as SEQ ID NO: 18,

[0032] Probe c.1-P: nucleotide sequence is as shown in SEQ ID NO:19.

[0033] According to one embodiment of the present invention, the primer and probe sequences for specifically detecting the mutation site c.80A>G are as follows:

[0034] Upstream primer c.80-F: nucleotide sequence as SEQ ID NO: 21,

[0035] Downstream primer c.80-R: nucleotide sequence as SEQ ID NO: 22,

[0036] Probe c.80-P: nucleotide sequence is as shown in SEQ ID NO: 23.

[0037] According to one embodiment of the present invention, the primer and probe sequences for specifically detecting the mutation site c.217C>T are as follows:

[0038] Upstream primer c.217-F: nucleotide sequence as SEQ ID NO: 25,

[0039] Downstream primer c.217-R: nucleotide sequence as SEQ ID NO: 26,

[0040] Probe c.217-P: nucleotide sequence as SEQ ID NO: 27.

[0041] According to one embodiment of the present invention, the primer and probe sequences for specific detection of the mutation site c.315C>G are as follows:

[0042] Upstream primer c.315-F: nucleotide sequence as SEQ ID NO: 29,

[0043] Downstream primer c.315-R: nucleotide sequence as SEQ ID NO: 30,

[0044] Probe c.315-P: nucleotide sequence is as shown in SEQ ID NO:31.

[0045] According to one embodiment of the present invention, the primer and probe sequences for specifically detecting the mutation site c.394C>T are as follows:

[0046] Upstream primer c.394-F: nucleotide sequence as SEQ ID NO: 33,

[0047] Downstream primer c.394-R: nucleotide sequence as SEQ ID NO: 34,

[0048] Probe c.394-P: nucleotide sequence is as shown in SEQ ID NO: 35.

[0049] According to one embodiment of the present invention, a probe for detecting the wild-type site corresponding to the mutation site of MMACHC is also included.

[0050] According to one embodiment of the present invention, the probe for detecting the wild-type site corresponding to the mutation site c.609G>A is probe c.609-WT, and its nucleotide sequence is as shown in SEQ ID NO: 4;

[0051] The probe for detecting the wild-type site corresponding to the mutation site c.567dupT is probe c.567-WT: its nucleotide sequence is shown in SEQ ID NO: 8;

[0052] The probe for detecting the wild-type site corresponding to the mutation site c.658_660delAAG is probe c.658-WT: its nucleotide sequence is as shown in SEQ ID NO: 12;

[0053] The probe for detecting the wild-type site corresponding to the mutation site c.482G>A is probe c.482-WT: the nucleotide sequence is as shown in SEQ ID NO: 16;

[0054] The probe for detecting the wild-type site corresponding to the mutation site c.1A>G is probe c.1-WT: the nucleotide sequence is as shown in SEQ ID NO: 20;

[0055] The probe for detecting the wild-type site corresponding to the mutation site c.80A>G is probe c.80-WT: the nucleotide sequence is as shown in SEQ ID NO: 24;

[0056] The probe for detecting the wild-type site corresponding to the mutation site c.217C>T is probe c.217-WT: the nucleotide sequence is as shown in SEQ ID NO: 28;

[0057] The probe for detecting the wild-type site corresponding to the mutation site c.315C>G is probe c.315-WT: the nucleotide sequence is as SEQ ID NO: 32;

[0058] The probe for detecting the wild-type site corresponding to the mutation site c.394C>T is probe c.394-WT: the nucleotide sequence is as shown in SEQ ID NO: 36.

[0059] According to one embodiment of the present invention, the probe is labeled and can be detected by a test method, for example, using an isotope or fluorescent label. Preferably, the probe is a fluorescently labeled probe, such as a Taqman fluorescent probe, which has a fluorescent reporter group labeled at its 5' end and a fluorescent quencher group labeled at its 3' end.

[0060] According to one embodiment of the present invention, the kit further includes reagents for amplification reaction, in particular reagents for PCR amplification reaction.

[0061] According to one embodiment of the present invention, the total concentration of the primers in the amplification system is 50-800 nM, preferably 100-500 nM.

[0062] According to one embodiment of the present invention, the concentration of the probe in the amplification system is 30-600 nM, preferably 100-300 nM.

[0063] According to one embodiment of the present invention, the kit includes TaqDNA polymerase, dNTPs, PCR amplification buffer and Mg 2+ Reagents, and optional UNG enzyme or dUTP.

[0064] The causative pathogenic variant in human combined MMA cb1C is in the gene MMACHC. The human MMACHC gene, with Gene ID 25974, is located on chromosome 1, p34.1, and consists of four exons totaling 282 amino acids (transcript NM_015506.3). The protein encoded by this gene is involved in energy transduction for cobalamin (vitamin B12) uptake.

[0065] In the kit provided by the present invention, the specific primers are used to amplify nucleotide fragments from a subject, and the probes can recognize and bind to fragments corresponding to the probe sequences in the template (including the amplified product). By detecting the binding of the probes to the template, the presence of MMA-related genes, such as MMACHC, and the presence and mutation of MMA-related genes in the biological sample can be determined. During the detection process, the presence of the MMA-related gene or mutation in the biological sample can be determined by detecting the fluorescent signal emitted by the probes. Preferably, the probes used in the present invention are Taqman fluorescent probes. The Taqman fluorescent probe method is a well-developed and widely used real-time fluorescence quantitative PCR (Quantitative Real-time PCR) method. The probes in the Taqman fluorescent probe method have a fluorescent reporter group and a fluorescent quencher group at each end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. During PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the reporter and quencher fluorescent groups. This allows the fluorescence monitoring system to receive the fluorescent signal. That is, a fluorescent molecule is formed for each DNA chain amplified, achieving complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product. During the detection process, positive control samples and negative controls can also be set up at the same time.

[0066] The primer pairs and probes in the kit of the present invention can be used for quantitative PCR protocols or quantitative hybridization. Quantitative PCR allows for the quantification of the starting amount of a DNA, cDNA, or RNA template. Quantitative PCR can be based on the detection of fluorescent reporter molecules that increase as the PCR product accumulates in each amplification cycle.

[0067] The primers and probes provided in the kit of the present invention can be used to hybridize between the probe and the target gene in the presence of a solid support. One or more of the probe and the target nucleic acid can be immobilized, for example, on beads, a plate, a slide, or a microtiter plate.

[0068] The primer pairs and probes provided in the kit of the present invention can also be used for detection without immobilizing the primers and probes, for example, hybridization can be performed in a liquid medium background.

[0069] The kit of the present invention can be used in a magnetic bead-based detection system. The magnetic beads used in the present invention are, for example, beads suitable for flow cytometry analysis. The beads can be coupled to a probe to detect the interaction between the probe and the target. In one aspect, the beads are labeled with a unique fluorescent molecule or combination of molecules. By using a laser to excite one or more fluorescent dyes within the beads, the labels on or within the beads can be identified. Detection of binding can also be performed in the context of a microarray.

[0070] The specific primer pairs or probe oligonucleotides in the kit of the present invention can be nucleotide analogs (such as phosphorothioate, alkyl phosphorothioate or peptide nucleic acid) or modified nucleotides (such as locked nucleic acid modified or minor groove binder modified nucleotides).

[0071] The following definitions and explanations will help to better understand the present invention.

[0072] The target material in the sample to be analyzed can be DNA or RNA, such as genomic DNA, messenger RNA, or an amplified form thereof. Various extraction and purification procedures are available for isolating RNA or DNA from a sample (e.g., Sambrook et al., 1989). RNA can be converted to DNA by reverse transcription for primer and probe hybridization reactions.

[0073] The term "probe" according to the present invention generally refers to a single-stranded oligonucleotide, which is designed to specifically hybridize to a target nucleic acid.

[0074] The term "primer" generally refers to a single-stranded oligonucleotide sequence that serves as a starting point for the synthesis of primer extension products that are complementary to the nucleic acid strand to be replicated. Preferably, the primer is about 10-50 nucleotides in length. The specific length and sequence depend on the complexity of the desired DNA or RNA target, as well as the conditions under which the primer is used, such as temperature and ionic strength.

[0075] The expression "primer pair" in the present invention refers to a pair of primers that allow amplification of a part or the whole of a target polynucleic acid fragment, to which the probe is capable of binding.

[0076] The "target" or "target sequence" of the probes or primers of the present invention is the sequence of the target nucleic acid to which the probe or primer is fully complementary or partially complementary (wherein partial complementarity allows for a certain degree of mismatch). It will be understood that in some cases, the complement of the target sequence is also a suitable target sequence. The probes of the present invention are suitably complementary to at least the central portion of their target sequence. In most cases, the probes are fully complementary to their target sequence.

[0077] A probe "specifically hybridizes" to a target polynucleic acid region, meaning that the probe forms a duplex with a portion or the entire region of that region under the experimental conditions used, and under those conditions, the probe does not form a duplex with other regions of the polynucleic acid present in the sample to be analyzed. It should be understood that a probe designed to specifically hybridize to a target polynucleic acid region may fall entirely within that region, or may overlap with that region to a significant extent (i.e., form a duplex with nucleotides both outside and within that region).

[0078] Suitably, specific hybridization of the probe to the target nucleic acid region occurs under stringent hybridization conditions, for example, 3X SSC, 0.1% SDS, 50°C.

[0079] The skilled artisan knows how to vary parameters such as temperature, probe length, and salt concentration to achieve specific hybridization. Hybridization and wash conditions are well known and are exemplified in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989), particularly Chapter II thereof. If desired, the length or sequence of the probe may be slightly modified to maintain the specificity and sensitivity required under a given set of circumstances. Preferred stringent conditions are those that allow type-specific probes to bind to only one type of target nucleic acid.

[0080] In the present invention, oligonucleotides used as primers or probes may also contain nucleotide analogs, such as phosphorothioates, alkylphosphorothioates, or peptide nucleic acids, or may contain intercalators, such as locked nucleic acid-modified or minor groove binder-modified nucleotides. The introduction of these modifications may improve hybridization kinetics, the reversibility of hybrid formation, and the biological stability of the oligonucleotide molecule.

[0081] (3) Beneficial effects

[0082] The MMACHC gene hotspot mutation region detection kit provided by the present invention, based on fluorescent quantitative PCR technology, can simultaneously detect multiple mutation sites on the MMACHC gene and complete three genotyping tests for wild type, homozygous mutant, and heterozygous mutant types at each mutation site. This effectively meets the genetic testing needs of clinical combined MMA, increases the mutation site coverage rate of CblC deficiency methylmalonic acidemia combined with homocystinemia on the MMACHC gene to 93.28%, covers the mutation hotspots of most populations, and can quickly, accurately, and sensitively detect various types of mutations in the hotspot mutation region. At the same time, the kit provided by the present invention has the characteristics of simple operation, easy interpretation of results, high clinical applicability, good reproducibility of experimental results, short detection cycle, and can complete detection in as fast as 2 hours, greatly saving detection time, accelerating clinical diagnosis efficiency, and providing a basis for subsequent treatment and precise medication of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] Figure 1 Amplification maps of the c.609G>A mutation site under different screening systems.

[0084] Figure 2 Figure 2 shows the amplification map of the c.567dupT mutation site under different screening systems.

[0085] Figure 3 This is the amplification map of the c.658_660delAAG mutation system under different screening systems.

[0086] Figure 4 Amplification maps of the c.482G>A mutation site under different screening systems.

[0087] Figure 5 Amplification maps of the c.1A>G mutation site under different screening systems.

[0088] Figure 6 This is the amplification map of c.80A>G under screening system 1.

[0089] Figure 7 Amplification maps of the c.217C>T mutation site under different screening systems.

[0090] Figure 8 Amplification maps of the c.315C>G mutation site under different screening systems.

[0091] Figure 9 Amplification maps of the c.394C>T mutation site under different screening systems. DETAILED DESCRIPTION

[0092] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific implementation methods in conjunction with the accompanying drawings.

[0093] Example 1

[0094] This example establishes a detection system for MMACHC gene mutation sites, and the steps are as follows:

[0095] (1) Synthesis of probes, primers, and DNA templates

[0096] Probes and primers targeting the following mutation sites of the MMACHC gene were synthesized: c.609G>A, c.567dupT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G, and c.394C>T.

[0097] The primers in the primer probe set include a forward primer and a reverse primer for the SNP site. In addition, two different probes are designed according to the SNP site, one wild-type probe is complementary to the wild-type allele, and the other mutant probe is complementary to the mutant allele.

[0098] The wild-type probe used in the detection was labeled with a fluorescent group FAM at the 5' end and a quencher group MGB at the 3' end, while the mutant probe was labeled with a fluorescent group VIC at the 5' end and a quencher group MGB at the 3' end.

[0099] When the TaqMan MGB probe is completely complementary to the template, it will be cut by the 5′→3′ exonuclease of Taq DNA polymerase during extension to produce fluorescence; if there is a base mismatch, the TaqMan MGB probe will not bind to the template and will not be cut during extension, resulting in no fluorescence signal value, thus achieving the purpose of distinguishing different genotypes.

[0100] Table 1 below shows the probe and primer pairs used in this example for detecting mutation sites in the MMACHC gene.

[0101] Table 1: Probe and primer sequences for detecting mutation sites in the MMACHC gene

[0102]

[0103] Example 2

[0104] In this example, the control substances required for the test were prepared. Specifically, positive and negative reference cell lines were designed based on the mutation sites of the MMACHC gene being tested. Using gene editing technology, a series of cell lines with frequently mutated sites were established as positive reference cell lines. Specifically, 293T cells were gene-edited using the CRISPR / Cas system to introduce the following frequently mutated sites in the MMACHC gene: c.609G>A, c.658_660delAAG, c.567dupT, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.394C>T, and c.315C>G.

[0105] The sgRNA (small guide RNA) sequence corresponding to the MMACHC gene mutation site used is as follows:

[0106] 293T-hMMACHC(c.G609A)

[0107] sgRNA:ACTGGCGTGATTGGACTTACCGG;

[0108] 293T-hMMACHC(c.567insT)

[0109] sgRNA:AGCTTCGAGTAGGGCGATACGG;

[0110] 293T-hMMACHC(c.G482A)

[0111] sgRNA:GGGCTGGTTTGCCATCCGAGGGG;

[0112] 293T-hMMACHC(c.A1G)

[0113] sgRNA:TCAGCGTGTAACGTGCCGTATGG;

[0114] 293T-hMMACHC(c.C217T)

[0115] sgRNA:CTGGGTCAGTCAGCATTCGGAGG;

[0116] 293T-hMMACHC(c.C315G)

[0117] sgRNA:GGATCTTGGGGCGTCGGTTGGGG;

[0118] 293T-hMMACHC(c.C394T)

[0119] sgRNA:CAGCCTCCACATCTTGTCGTTGG;

[0120] 293T-hMMACHC(c.658-660delAAG)

[0121] sgRNA:GCTCTTCTGAGTAGCGCTCCTGG;

[0122] 293T-hMMACHC(c.A80G)

[0123] sgRNA:GAGGGATAAACTAACCTGGAAGG;

[0124] When performing performance testing on the detection system of the present invention, four groups of control substances were used. The first group consisted of unmutated MMACHC gene cell lines, i.e., wild-type cells; the second group consisted of cell lines containing mutations in different MMACHC target detection sites (c.609G>A, c.658_660delAAG, c.567dupT, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.394C>T, c.315C>G), i.e., homozygous mutant cells; the third group contained wild-type and homozygous mutant cells in a 1:1 ratio, i.e., heterozygous mutant cells; and the fourth group was a blank control.

[0125] Configuration detection system: PCR mix (2×GenDiff SNP qPCR Mix, purchased from Acryl Bio, catalog number: CM0208), Mg 2+ (MgCl2 Solution (50 mM), purchased from Acre Bio, catalog number: CM0013) and Nuclease-Free Water (UltraPure TMDistilled water, purchased from Thermo Fisher Scientific, catalog number: 10977015).

[0126] Detection validation experiments demonstrated that the minimum detection limit was approximately 2 ng / μL using the specific primer pair and probe provided in Example 1. Samples diluted to no less than 2 ng / μL were tested 20 times, and all test results were positive, with a 100% coincidence rate.

[0127] Example 3

[0128] This example uses the primer pairs and probes described in Example 1 to test 268 clinical samples of dried blood spots and peripheral blood from newborns diagnosed with combined MMA. The clinical samples were obtained from Shenzhen Children's Hospital and have received ethical approval. The testing steps are as follows:

[0129] 1. Extract DNA from samples

[0130] Use the SteadyPure Mag Blood Genomic DNA Extraction Kit (Magnetic Bead Method) (Cat. No. AG21201) to extract genomic DNA from test samples, such as blood spots or whole blood. Quantify the DNA using the Qubit assay before use. The recommended concentration of genomic DNA in the test sample is 2-150 ng / μL.

[0131] 2. PCR amplification

[0132] Prepare amplification system: PCR mix (2×GenDiff SNP qPCR Mix, purchased from Acryl Bio, catalog number: CM0208), Mg 2+ (MgCl2 Solution (50 mM), purchased from Acre Bio, catalog number: CM0013) and Nuclease-Free Water (UltraPure TM Distilled Water, purchased from Thermo Fisher Scientific, Cat. No. 10977015); specific primer pairs and probes are as shown in Example 1.

[0133] Prepare the PCR reaction system according to the number of samples. Perform 9 PCR reactions for each sample. Take 18 μL of reaction solution 1-9 into PCR reaction tubes respectively, and add 2 μL of the DNA to be tested to each reaction tube.

[0134] Set up positive, negative, and blank controls for each experiment. For each reaction solution, determine the number of quality control reactions (n) required. Aliquot reaction solutions 1-9 into n reaction tubes at 18 μL / tube. Add 2 μL of the corresponding control to each reaction solution tube.

[0135] n=positive control (1T) + negative control (1T) + blank control (1T)

[0136] 3. The reaction program settings are shown in Table 2.

[0137] Table 2 Amplification and fluorescence detection reaction procedures

[0138]

[0139] The total reaction volume was 20 μL, and the fluorescence signal of the wild type in reaction solution 1-9 was collected using the FAM channel, and the fluorescence signal of the mutant in reaction solution 1-9 was collected using the VIC / HEX channel.

[0140] 4. Detection

[0141] A fluorescence quantitative PCR instrument (Shanghai Hongshi SLAN-96S) was used to perform PCR amplification and endpoint allele identification on the above detection reaction system. After the reaction was completed, the instrument automatically determined the genotype of the subject's gene locus by reading the fluorescence curve.

[0142] The positive control VIC / HEX reaction channel had an obvious amplification curve, and the detection Ct was ≤32.

[0143] The negative control FAM reaction channel had an obvious amplification curve, and the detection Ct was ≤ 32.

[0144] In the blank control, there was no obvious amplification curve or no Ct value in each reaction channel of FAM and VIC / HEX.

[0145] The above conditions should be met at the same time; otherwise, the test will be deemed invalid and all tests should be repeated.

[0146] The sample to be tested is judged as positive if the Ct is ≤ 32 in the FAM or VIC / HEX fluorescence detection channel.

[0147] If the allele scatter plot of the primer set amplified at a certain mutation site shows a FAM channel Ct ≤ 32 and the corresponding color is red (genotype 1), then the base of the mutation site in the MMACHC gene of the sample to be tested is wild type; if the Ct of the FAM channel and the VIC / HEX channel is ≤ 32 and the corresponding mixed color is blue (genotype 2), then the base of the mutation site in the MMACHC gene of the sample to be tested is a heterozygous mutant; if the VIC / HEX channel Ct ≤ 32 and the corresponding color is green (genotype 3), then the base of the mutation site in the MMACHC gene of the sample to be tested is a homozygous mutant. Sanger sequencing was also used to verify the accuracy of the detection results in this method. The results are shown in Table 3 below.

[0148] A heterozygous mutation refers to a mutation site (e.g., c.609A) in the MMACHC gene on one homologous chromosome and a wild-type site (e.g., c.609G) in the other. A homozygous mutation refers to a mutation site (e.g., c.609A) in both homologous chromosomes.

[0149] Table 3: Sanger sequencing verification

[0150] sample Sanger sequencing Reagents and methods of the present invention consistency c.609G>A heterozygous 129 125 97％ c.609G>A homozygous 22 22 100％ c.567dupT heterozygous 29 29 100％ c.567dupT homozygous 3 3 100％ c.658_660delAAG heterozygous 82 82 100％ c.658_660delAAG homozygous 4 4 100％ c.482G>A heterozygous 39 37 95％ c.482G>A homozygous 1 1 100％ c.1A>G heterozygous 6 6 100％ c.80A>G heterozygous 38 38 100％ c.80A>G homozygous 3 3 100％ c.217C>T heterozygous 17 17 100％ c.315C>G heterozygous 5 5 100％ c.394C>T heterozygous 19 18 95％ c.394C>T homozygous 1 1 100％ Wild type / healthy people 3 3 100％

[0151] The results in the table show that the total consistency of the results of gene mutation detection of 268 patients with combined MMA using the kit of the present invention and the results obtained by Sanger sequencing is 98%.

[0152] Example 4

[0153] The primer pairs and probe combinations shown in Table 1 in Example 1 are the preferred combinations obtained by precise primer and probe design, combined with the optimization of the reaction system, and verified by thermodynamic simulation screening and experimental iteration. Surprisingly, this combination can achieve efficient and simultaneous detection of multiple mutation sites under the same amplification system and under the same amplification and probe recognition reaction conditions, significantly reducing the occurrence of non-specific amplification. In addition, the primer pairs and probe combinations provided by the present invention effectively solve the problems of competitive effects between different primer pairs in multiple reactions, probe signal interference, and imbalance in amplification efficiency, significantly reduce the risk of cross-reactions, and improve the specificity and stability of detection. The following is a comparison of the detection effects of the specific primer pairs and probe combinations provided by the present invention and the unoptimized primer pairs and probe combinations.

[0154] Detection system: PCR mix (2×GenDiff SNP qPCR Mix, purchased from Acryl Bio, catalog number: CM0208), Mg 2+ (MgCl2 Solution (50 mM), purchased from Acre Biotechnology, catalog number: CM0013) and Nuclease-Free Water (UltraPure TM Distilled water, purchased from Thermo Fisher Scientific, catalog number: 10977015).

[0155] The sequences of different primer pairs and probes for detecting mutation sites are shown in Table 4. The probe and primer sequences shown in Table 4 were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0156] Table 4. Probe and primer sequences used for comparison and screening.

[0157]

[0158]

[0159]

[0160] The clinical samples with specific mutation information obtained by Sanger sequencing in Example 3 were used as templates. The tests and results are as follows:

[0161] c. 609G>A mutation screening: There was no significant difference in the Ct values ​​of screening system 1 and screening system 2. The fluorescence value of screening system 2 was higher than that of screening system 1, and screening system 2 was preferred (see the amplification pattern). Figure 1 : c.609G>A mutation system screening amplification results, Ct value results are shown in Table 5 below).

[0162] Table 5: Ct value results of c.609G>A mutation system screening

[0163]

[0164] c.567dupT mutation screening system, heterozygous mutant samples in screening system 1 could not be correctly typed, screening system 2 was preferred (amplification pattern see Figure 2 : c.567dupT mutant system screening amplification results, Ct value results are shown in Table 6 below).

[0165] Table 6: Ct value results of c.567dupT mutant system screening

[0166]

[0167] c.658_660delAAG mutation screening, screening system 1 heterozygous mutant samples could not be correctly typed, screening system 2 amplification effect was better than screening system 1, screening system 2 is preferred (amplification map see Figure 3 : c.658_660delAAG mutation system screening amplification results, Ct value results are shown in Table 7 below).

[0168] Table 7: Ct value results of c.658_660delAAG mutation system screening

[0169]

[0170] c.482G>A mutation screening system, screening system 1 heterozygous mutant samples could not be correctly typed, screening system 2 is preferred (amplification map see Figure 4 : c.482G>A mutation system screening amplification results, Ct value results are shown in Table 8 below).

[0171] Table 8: Ct value results of c.482G>A mutation system screening

[0172]

[0173]

[0174] c.1A>G mutation system screening, screening system 1 amplification effect is better than screening system 2, screening system 1 is preferred (amplification map see Figure 5 : c.1A>G mutation system screening amplification results, Ct value results are shown in Table 9 below).

[0175] Table 9: Ct value results of c.1A>G mutation system screening

[0176]

[0177] c. 80A>G mutation system screening, the amplification effect of screening system 1 is in line with expectations (the amplification map is shown in Figure 6 : c.80A>G mutation system screening amplification results, Ct value results are shown in Table 10 below.

[0178] Table 10: Ct value results of c.1A>G mutation system screening

[0179]

[0180] c.217C>T mutation system screening, screening system 2 amplification effect is better than screening system 1, screening system 2 is preferred (amplification map see Figure 7 : c.217C>T mutation system screening amplification results, Ct value results are shown in Table 11 below).

[0181] Table 11: Ct value results of c.217C>T mutation system screening

[0182]

[0183]

[0184] c.315C>G mutation screening system, screening system 1 has non-specific amplification, screening system 2 is preferred (amplification pattern see Figure 8 : c.315C>G mutant system screening amplification results, Ct value results are shown in Table 12 below).

[0185] Table 12: Ct value results of c.315C>G mutation system screening

[0186]

[0187] c.394C>T mutation screening system. Heterozygous mutant samples in screening system 1 were not correctly typed. Screening system 2 is preferred (the amplification pattern is shown in Figure 9: c.394C>T mutation system screening amplification results, Ct value results are shown in Table 13 below).

[0188] Table 13: Ct value results of c.394C>T mutation system screening

[0189]

[0190] In summary, the primers, kit, and detection method for detecting hotspot mutation regions in the MMACHC gene provided by the present invention utilize TaqMan probe technology to simultaneously detect nine mutation sites on the MMACHC gene and complete three genotyping tests for wild-type, homozygous mutant, and heterozygous mutant types at each site, effectively meeting the genetic testing needs of clinical combined MMA. The kit provided by the present invention increases the coverage of mutation sites on the MMACHC gene for CblC-deficiency methylmalonic acidemia combined with homocystinemia to 93.28%, covering mutation hotspots in most populations and enabling rapid, accurate, and sensitive detection of various types of mutations in hotspot mutation regions. The method is simple to operate, easy to interpret results, highly clinically applicable, and has good reproducibility and precision. In addition, the detection cycle is short, with detection completed in as little as 2 hours, greatly saving detection time, accelerating clinical diagnostic efficiency, and providing a reliable basis for subsequent treatment and precise medication for patients.

[0191] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or make equivalent replacements for some or all of the technical features therein. These modifications or replacements, or when the technical features in the above embodiments do not conflict with each other, can be combined in the manner described in the embodiments, and these modifications, replacements or combinations do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A detection kit for combined methylmalonic acidemia, which is a cb1C type kit, characterized in that: It includes a specific primer pair and probe combination for detecting at least one mutation site of MMACHC; the mutation site of MMACHC is at least one selected from c.609G>A, c.567dupT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G and c.394C>T.

2. The detection kit for combined methylmalonic acidemia according to claim 1, characterized in that: The mutation sites of MMACHC are a combination of c.609G>A, c.567dupT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G and c.394C>T.

3. The detection kit for combined methylmalonic acidemia according to claim 1 or 2, characterized in that: The primer and probe sequences for specific detection of the mutation site c.609G>A are as follows: Upstream primer c.609-F: nucleotide sequence as SEQ ID NO: 1, Downstream primer c.609-R: nucleotide sequence as SEQ ID NO: 2, Probe c.609-P: nucleotide sequence as SEQ ID NO: 3; The primer and probe sequences for specific detection of the mutation site c.567dupT are as follows: Upstream primer c.567-F: nucleotide sequence as SEQ ID NO: 5, Downstream primer c.567-R: nucleotide sequence as SEQ ID NO: 6, Probe c.567-P: nucleotide sequence as SEQ ID NO: 7; The primer and probe sequences for specific detection of the mutation site c.658_660delAAG are as follows: Upstream primer c.658-F: nucleotide sequence as SEQ ID NO: 9, Downstream primer c.658-R: nucleotide sequence as SEQ ID NO: 10, Probe c.658-P: nucleotide sequence as SEQ ID NO: 11; The primer and probe sequences for specific detection of the mutation site c.482G>A are as follows: Upstream primer c.482-F: nucleotide sequence as SEQ ID NO: 13, Downstream primer c.482-R: nucleotide sequence as SEQ ID NO: 14, Probe c.482-P: nucleotide sequence as SEQ ID NO: 15; The primer and probe sequences for specific detection of the mutation site c.1A>G are as follows: Upstream primer c.1-F: nucleotide sequence as SEQ ID NO: 17, Downstream primer c.1-R: nucleotide sequence as SEQ ID NO: 18, Probe c.1-P: nucleotide sequence as SEQ ID NO: 19; The primer and probe sequences for specific detection of the mutation site c.80A>G are as follows: Upstream primer c.80-F: nucleotide sequence as SEQ ID NO: 21, Downstream primer c.80-R: nucleotide sequence as SEQ ID NO: 22, Probe c.80-P: nucleotide sequence as SEQ ID NO: 23; The primer and probe sequences for specific detection of the mutation site c.217C>T are as follows: Upstream primer c.217-F: nucleotide sequence as SEQ ID NO: 25, Downstream primer c.217-R: nucleotide sequence as SEQ ID NO: 26, Probe c.217-P: nucleotide sequence as SEQ ID NO: 27; The primer and probe sequences for specific detection of the mutation site c.315C>G are as follows: Upstream primer c.315-F: nucleotide sequence as SEQ ID NO: 29, Downstream primer c.315-R: nucleotide sequence as SEQ ID NO: 30, Probe c.315-P: nucleotide sequence as SEQ ID NO: 31; The primer and probe sequences for specific detection of the mutation site c.394C>T are as follows: Upstream primer c.394-F: nucleotide sequence as SEQ ID NO: 33, Downstream primer c.394-R: nucleotide sequence as SEQ ID NO: 34, Probe c.394-P: nucleotide sequence is as shown in SEQ ID NO:

35.

4. The detection kit for combined methylmalonic acidemia according to claim 1 or 2, characterized in that: Also included is a probe for detecting the wild-type site corresponding to the mutation site of MMACHC.

5. The detection kit for combined methylmalonic acidemia according to claim 4, characterized in that: The probe for detecting the wild-type site corresponding to the mutation site c.609G>A is probe c.609-WT, and its nucleotide sequence is shown in SEQ ID NO: 4; The probe for detecting the wild-type site corresponding to the mutation site c.567dupT is probe c.567-WT: its nucleotide sequence is shown in SEQ ID NO: 8; The probe for detecting the wild-type site corresponding to the mutation site c.658_660delAAG is probe c.658-WT: its nucleotide sequence is as shown in SEQ ID NO: 12; The probe for detecting the wild-type site corresponding to the mutation site c.482G>A is probe c.482-WT: the nucleotide sequence is as shown in SEQ ID NO: 16; The probe for detecting the wild-type site corresponding to the mutation site c.1A>G is probe c.1-WT: the nucleotide sequence is as SEQ ID NO: 20; The probe for detecting the wild-type site corresponding to the mutation site c.80A>G is probe c.80-WT: the nucleotide sequence is as SEQ ID NO: 24; The probe for detecting the wild-type site corresponding to the mutation site c.217C>T is probe c.217-WT: the nucleotide sequence is as shown in SEQ ID NO: 28; The probe for detecting the wild-type site corresponding to the mutation site c.315C>G is probe c.315-WT: the nucleotide sequence is as SEQ ID NO: 32; The probe for detecting the wild-type site corresponding to the mutation site c.394C>T is probe c.394-WT: the nucleotide sequence is as shown in SEQ ID NO:

36.

6. The detection kit for combined methylmalonic acidemia according to claim 1 or 2, characterized in that: The probe is a Taqman fluorescent probe, the 5' end of which is labeled with a fluorescent reporter group, and the 3' end of which is labeled with a fluorescent quencher group.

7. The detection kit for combined methylmalonic acidemia according to claim 1 or 2, characterized in that: The kit also includes reagents for PCR amplification reaction.

8. The detection kit for combined methylmalonic acidemia according to claim 1, characterized in that: The total concentration of primers in the amplification system is 50-800 nM.

9. The detection kit for combined methylmalonic acidemia according to claim 1, characterized in that: The concentration of the probe in the amplification system is 30-600 nM.

10. The detection kit for combined methylmalonic acidemia according to claim 1, characterized in that: The kit includes TaqDNA polymerase, dNTPs, PCR amplification buffer and Mg 2+ Reagents, and optional UNG enzyme or dUTP.

Images