Application of substance for reducing MMACHC expression in preparation of antitumor drugs

Abstract

The invention discloses application of a substance for reducing MMACHC expression in preparation of antitumor drugs, and relates to the field of molecular biology. The application discovers that MMACHC can regulate and control a metabolism reprogramming pathway of lipid metabolism under tumor conditions for the first time, and knockout of MMACHC can effectively inhibit the lipid metabolism pathway, so that proliferation and invasion of colorectal cancer cells are inhibited, and the development process of tumors is delayed; therefore, the MMACHC is used as a target spot for anti-tumor treatment, and the substance for reducing the expression of the MMACHC is used for preparing the anti-tumor medicine, so that the MMACHC has important significance on comprehensive treatment of tumors.

Description

Technical Field

[0001] This application relates to the field of molecular biology, particularly the application of substances that reduce MMACHC expression in the preparation of drugs for treating rectal tumors. Background Technology

[0002] Colorectal cancer is a common malignant tumor of the digestive system. A 2025 report from the American Cancer Society shows that colorectal cancer ranks third among male malignant tumors and fifth among women. Especially for patients with locally advanced colorectal cancer, the prognosis remains unsatisfactory even after surgery, radiotherapy, chemotherapy, targeted therapy, and immunotherapy.

[0003] Xiangbei Yangrong Decoction originates from Volume 64 of *Yizong Jinjian* (Golden Mirror of Medicine), and has the effects of tonifying qi and nourishing blood, regulating qi and resolving phlegm. It is primarily used to treat stagnation of liver qi and blood in the meridians. Currently, it is applied in the treatment of various primary and secondary lymphomas, breast cancer, and gastric cancer. Current research shows that in colorectal cancer patients undergoing standard radical resection and receiving adjuvant chemotherapy with the conventional XELOX regimen, the combined use of Xiangbei Yangrong Decoction significantly improves overall survival (OS) and disease-free survival (DFS) compared to the traditional XELOX-only group. This formula focuses on tonifying qi and nourishing blood, regulating qi and resolving phlegm. Combined with anti-tumor drugs, it has detoxifying and sensitizing effects, prolonging patient survival, extending survival time with the tumor, and improving quality of life. Furthermore, colorectal cancer patients often experience drug tolerance and side effects during chemotherapy. Using Xiangbei Yangrong Decoction as an adjuvant during chemotherapy does not significantly impair liver and kidney function.

[0004] The MMACHC gene is located on the long arm of human chromosome 1 (1q42.12) and is involved in encoding the C-type protein in methylmalonic aciduria combined with hyperhomocysteinemia, a key gene catalyzing intracellular activation of vitamin B12 (cobalamin). There are no reports yet on the application of MMACHC as a core target in the combined anti-tumor treatment with Xiangbei Yangrong Decoction. Summary of the Invention

[0005] To address the aforementioned issues, this application, through metabolomics sequencing, is the first to demonstrate the regulation of lipid metabolism pathways by MMACHC. Reducing MMACHC expression can downregulate lipid metabolism pathways, thereby delaying tumor growth.

[0006] This invention provides the following technical solutions: First, this application provides the use of a substance that reduces MMACHC expression in the preparation of an antitumor drug; furthermore, the aforementioned tumor refers to colorectal tumors.

[0007] Furthermore, the aforementioned anti-tumor drugs refer to drugs that inhibit lipid metabolism pathways.

[0008] Furthermore, the substance that reduces MMACHC expression mentioned above refers to the MMACHC knockout vector; in one embodiment of this application, the knockout vector is pcDNA3.1-MMACHC constructed using the eukaryotic expression vector pcDNA3.1, which can inhibit the expression of MMACHC in cells and regulate lipid metabolism pathways. In practical applications, other eukaryotic expression vectors such as lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors can also be used to construct MMACHC knockout vectors, as seen in the following literature: (Cohen J (October 7, 2020). "CRISPR, the revolutionary genetic 'scissors,' honored by Chemistry Nobel." Science. doi:10.1126 / science.abf0540.; Cohen J (2018-06-04). "With prestigious prize, an overshadowed CRISPR researcher wins the spotlight." Science | AAAS. Retrieved 2020-05-02; Zhang JH, Pandey M, Kahler JF, Loshakov A, Harris B, Dagur PK, et al.; (November 2014). "Improving the specificity and efficacy of CRISPR / CAS9 and gRNA through target specific DNA reporter." Journal of (Biotechnology.189:1–8.doi:10.1016 / j.jbiotec.2014.08.033.), the vectors disclosed here can all be used to construct MMACHC knockout vectors.

[0009] This application is the first to discover that MMACHC can regulate the metabolic reprogramming pathway of lipid metabolism under tumor conditions: In colorectal cancer patients who regularly used the traditional Chinese medicine formula Xiangbei Yangrong Decoction, the expression level of MMACHC was significantly downregulated in serum samples before and after drug use. Further investigation into the regulation of colorectal cancer cell lines by MMACHC knockout revealed that MMACHC knockout significantly inhibited the proliferation and invasion of colorectal cancer cells. Furthermore, metabolomics sequencing combined with GSEA analysis showed that MMACHC delays the progression of colorectal cancer through lipid metabolism pathways. MMACHC molecules are highly expressed in tumor tissues and peripheral blood. Through rescue experiments, after overexpressing the MMACHC gene in colorectal cancer cell lines, intervention with serum containing Xiangbei Yangrong Decoction increased cell proliferation compared to the control group, indicating that Xiangbei Yangrong Decoction exerts its anti-colorectal cancer effect through the key target of MMACHC. In summary, these results demonstrate that inhibiting MMACHC expression in colorectal cancer can effectively inhibit lipid metabolism pathways, thereby inhibiting the proliferation and invasion of colorectal cancer cells and delaying tumor progression. Therefore, using MMACHC as a target for anti-tumor therapy and preparing anti-tumor drugs by utilizing substances that reduce MMACHC expression is of great significance for the comprehensive treatment of tumors. Attached Figure Description

[0010] Figure 1 This study compares the expression of MMACHC in the peripheral blood of colorectal cancer patients and normal controls.

[0011] Figure 2 The results show the effects of MMACHC on tumor progression in vitro.

[0012] Figure 3 Map of the knockout plasmid vector.

[0013] Figure 4 The results of GSEA enrichment analysis suggest that MMACHC participates in the regulation of tumor development through lipid metabolism pathways. Detailed Implementation

[0014] The technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0015] The Xiangbei Yangrong Decoction used in the following examples is based on a formula that uses ginseng to replenish vital energy, calm the mind, consolidate the body, and benefit the lungs; angelica to invigorate blood and replenish blood; rehmannia to nourish yin and replenish blood, fill marrow and benefit essence; and astragalus as a good medicine for invigorating qi and consolidating the exterior. Modern Chinese medicine also points out that astragalus has the effects of enhancing the body's immune function, protecting the liver, promoting diuresis, and eliminating toxins and pus. Poria is added to the formula to assist astragalus in its ability to support the body's vital energy. Cyperus rotundus is used to soothe the liver, regulate qi, remove blood stasis and relieve pain. Ligusticum chuanxiong is used to promote qi and blood circulation, dispel wind and relieve pain. The combination of cyperus rotundus and ligusticum chuanxiong has the effect of promoting qi and blood circulation and relieving pain. Licorice clears heat and detoxifies, while harmonizing the other medicines. The whole formula supports the body's vital energy and eliminates pathogens, and has the effects of promoting qi and blood circulation, replenishing qi and blood, clearing heat and detoxifying, and resolving stagnation.

[0016] The Xiangbei Yangrong Decoction formula (per bag) involved in the example is as follows: Atractylodes macrocephala 6g, Ginseng 3g, Poria cocos 3g, Tangerine peel 3g, Rehmannia glutinosa 3g, Ligusticum chuanxiong 3g, Angelica sinensis 3g, Fritillaria cirrhosa 3g, Cyperus rotundus 3g, Paeonia lactiflora 3g, Platycodon grandiflorus 2g, Glycyrrhiza uralensis 2g. Bring to a boil over high heat, then reduce to a simmer and continue to cook for 30 minutes to prepare 200ml of decoction.

[0017] The following examples have been approved by the hospital ethics committee.

[0018] Example 1: Detection of serum MMACHC levels in colorectal cancer patients before and after taking Xiangbei Yangrong Decoction (1) Collection and processing of peripheral blood samples from colorectal patients 1.1) Take 2 ml of K2EDTA-anticoagulated peripheral venous blood, centrifuge at 2000 rpm / min for 5 min at 18℃, collect the supernatant plasma in an EP tube, and store it at -80℃ for later use.

[0019] 1.2) The collected blood cells were resuspended in 6-8 ml ACK, allowed to stand at room temperature for 10 min, and then centrifuged at 500g for 5 min.

[0020] 1.3) Discard the supernatant, wash the cell pellet twice with 10 ml PBS buffer, and centrifuge at 500g for 5 min each time.

[0021] 1.4) Discard the supernatant and mix the cell precipitate evenly.

[0022] (2) qRT-PCR detection: 2.1) Eppendorf Centrifuge 5810 R centrifuge, 22℃, 500g, 30min, acceleration 1, deceleration 0. After centrifugation, the tube separated into four layers: the upper layer was plasma, the bottom layer mainly consisted of erythrocytes and granulocytes, and the second layer was lymphocyte separation medium. At the interface between the second and third layers, there was a narrow, white, cloudy band mainly composed of mononuclear cells, including lymphocytes and monocytes. The upper serum layer was first aspirated with a 1mL pipette, and then the cells contained in the narrow, white, cloudy band were transferred to another 15mL centrifuge tube.

[0023] 2.2) Collect cells to be tested, add 1 mL of Trizol, invert and mix several times, extract total RNA, and reverse transcribe to synthesize cDNA. Use cDNA as a template, add the corresponding target gene detection primers for PCR. Detection is performed using a BioRad (CFX96) real-time PCR instrument. The relative expression level of the target gene is calculated using β-actin.

[0024] (3) qRT-PCR detection of MMACHC expression in peripheral blood 3.1) RNA was extracted from cells using Trizol (Invitrogen), and cDNA was obtained by reverse transcription. The expression level of MMACHC was detected by qRT-PCR. The reverse transcription reagent used was the TOYOBO ReverTra Ace qPCR RT Kit.

[0025] 3.2) qRT-PCR detection of MMACHC expression: Human MMACHC primer sequences: Human MMACHC forward: 5'-CCAGGTGGCATGGTACAATGA-3' (SEQ ID NO: 1), Human MMACHC reverse: 5'-GTCAGTCAGCATTCGGAGGTG-3' (SEQ ID NO: 2), Human β-actin primer sequence: Human β-actin forward: 5'-CACGAAACTACCTTCAACTCC-3' (SEQ ID NO: 3), Human β-actin reverse: 5'-CATACTCCTGCTTGCTGATC-3' (SEQ ID NO: 4), Real-time quantitative PCR reaction program: 95℃ for 5 min, 95℃ for 10 s, 60℃ for 30 s, 72℃ for 30 s, for 30 cycles. The relative expression level of MMACHC was calculated using the -ΔCt method.

[0026] Test results as follows Figure 1 As shown, after patients with colorectal adenocarcinoma (COAD) and rectal adenocarcinoma (READ) regularly took Xiangbei Yangrong Decoction for 28 days (one packet each morning and evening, approximately 200ml of liquid), their MMACHC expression was significantly lower than that of the negative control group (patients before receiving Xiangbei Yangrong Decoction intervention).

[0027] Example 2: Effects of MMACHC on in vitro tumor development and progression In vitro cell culture: Colorectal cancer HCT116 cells and Lovo cells (both purchased from the cell bank of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) were cultured in vitro with 10% fetal bovine serum DMEM at 37°C under 5% CO2 conditions. The logarithmic growth phase was used for subsequent experiments.

[0028] Two human colorectal cancer cell lines were treated with different concentrations (0, 5, 10, 20, 40, or 80 μM) of Xiangbei Yangrong Decoction for different time periods (24 h, 48 h, and 72 h). The cell viability results are as follows: Figure 2 As shown in A and B, Figure 2 Figures A and B show the experimental results of HCT116 and LoVo cells, respectively, indicating that the decoction reduced the viability of human colorectal cancer cells in a time- and dose-dependent manner.

[0029] Two human colorectal cancer cell lines were treated with 0, 5, 10, and 20 μM XBYR Decocition for 48 h for monoclonal experiments. The microscopic results are as follows: Figure 2 As shown in Figure C, the clone formation rate (% of control) is as follows: Figure 2 As shown in Figure D, (1) and (2) are HCT116 and LoVo cells, respectively; the experimental results show that the number of cell clones decreases accordingly with the increase of the decoction dosage. The above drug concentrations are all the concentrations used through experimental exploration.

[0030] (2) Establishment of a colorectal cancer xenograft model: Male C57BL / 6 rats aged 6-8 weeks were used. The skin of the right abdominal wall of the rats was disinfected with medical alcohol in a clean bench. Each rat was subcutaneously injected with 1x10 6 1 cell / 200μL

[0031] (3) A gene knockout plasmid vector based on the LentiCRISPR-V2 vector backbone, which includes the following units: 3.1) sgRNA expression unit: Contains an sgRNA expression sequence driven by the U6 promoter. The targeting sequence of this sgRNA is designed based on the specific region of the target gene, is 20 bases in length, and its 3' end is immediately adjacent to an NGG-form PAM sequence. 2) Cas9 protein expression unit: Contains a constitutive promoter such as EFS or EF1α that drives the expression of the Cas9 endonuclease. 3) Resistance selection unit: Contains the ampicillin resistance gene for selection in prokaryotic cells. 4) Restriction sites: Downstream of the U6 promoter, there are two artificially optimized BsmBI restriction endonuclease recognition sites for cloning target-specific sgRNA sequences.

[0032] In this embodiment, the gene knockout plasmid was constructed using the CRISPR-Cas9 plasmid method. The specific construction method is as follows: The design and synthesis of sgRNA oligonucleotide chains were based on the co-exon sequence of the target gene. Using sgRNA design software (CRISPOR), sgRNA target sequences were designed that met the following principles: high specificity and low off-target effect; GC content between 40% and 60%; the 5' base of the target sequence was preferably G to adapt to the high transcription efficiency requirements of the U6 promoter; the selected target sequence (CTACCAACGACAAGATGTGG (SEQ ID NO: 5), PAM is AGG, target chain +) was split into two complementary oligonucleotide chains (Oligo 1 and Oligo 2), and sticky sequences complementary to the digestion ends of the linearized vector BsmBI were added to both ends of each chain.

[0033] 3.2) Linearization of the carrier skeleton The LentiCRISPR-V2 vector was linearized by digesting it with the BsmBI restriction endonuclease to remove the original filler sequence. The digestion products were then subjected to agarose gel electrophoresis to recover and purify the linearized vector fragment.

[0034] 3.3) Annealing and phosphorylation of sgRNA oligonucleotide chains The two oligonucleotide chains synthesized in step 1) were mixed in an equimolar ratio and subjected to annealing and phosphorylation in a system containing T4 polynucleotide kinase (T4PNK). The reaction procedure was as follows: first, the reaction was carried out at 37°C for 30 minutes to phosphorylate and anneal the 5' end of the oligonucleotide chain; then, the mixture was heated at 95°C for 5 minutes, and finally, the temperature was slowly reduced to 25°C at a rate of 5°C per minute to form a double-stranded DNA fragment with sticky ends.

[0035] 3.4) Connection reaction After diluting the annealing product obtained in step 3), it was mixed with the linearized vector fragment obtained in step 2) and ligated using T4 DNA ligase to insert the sgRNA coding sequence into the BsmBI site of the vector backbone.

[0036] 3.5) Plasmid transformation and screening The ligation product was transformed into Stbl3 chemocompetent cells. The specific steps included: a. incubation on ice for 30 minutes; b. heat shock at 42°C for 90 seconds; c. incubation on ice for 10 minutes; d. addition of resuscitation medium and shaking culture at 37°C for 30 minutes; e. centrifugation to collect the cells, spread them on LB agar plates containing ampicillin, and incubate upside down at 37°C overnight.

[0037] 3.6) Identification of positive clones Single colonies are picked from the plate and cultured to expand the culture. Positive clones are then preliminarily screened by colony PCR or plasmid restriction enzyme digestion. The preliminarily identified positive clones are sent for sequencing. The sequencing results are used to confirm whether the sgRNA sequence is correctly inserted, thereby obtaining the required gene knockout plasmid.

[0038] The final plasmid nucleotide sgRNA sequence is as follows: CTACCAACGACAAGATGTGG (SEQ ID NO: 5).

[0039] 3.7) PAM is AGG, targeting chain+.

[0040] The gene knockout plasmid structure obtained from the above steps is as follows: Figure 3 As shown.

[0041] (4) The tumor-bearing rats were divided into two groups: the NC group and the control group.

[0042] Seven days after tumor implantation, LentiCRISPR-V2 vector (NC) or LentiCRISPR-V2-MMACHC (control) was injected locally into the tumor every three days for 2-4 weeks. The injection site was located subcutaneously in the mid-posterior axilla, with an injection dose of 1×10^6 vectors per rat and a single injection volume of 100 μl. During this period, the tumor size was measured every two days, and the tumor volume was calculated using the formula: Volume = 0.5 × Length × Width. The rats were sacrificed 24 hours after the last injection, and the tumor weight was recorded.

[0043] The results of the tumor-bearing experiment in two groups of nude mice with different treatments are as follows: Figure 2 As shown in E and F, local inhibition of MMACHC in the tumor can effectively delay tumor growth.

[0044] Example 3: The Influence of MMACHC on Tumor Development via Lipid Metabolism Pathways (1) Cell culture and treatment with drug-containing serum 1.1) Cell culture conditions: The human colon cancer cell line HCT116 (adherent epithelial-like cells) was used and cultured in RPMI 1640 medium (containing 10% fetal bovine serum and 1% penicillin-streptomycin) at 37°C in a 5% CO2 incubator. When the cell density reached 80%–90%, the cells were washed with PBS and passaged by digestion with 0.25% trypsin-EDTA.

[0045] 1.2) Preparation and Intervention of Drug-Containing Serum: The drug-containing serum from Xiangbei Yangrong Decoction needs to be prepared via animal gavage: The decoction is administered to rats via gavage, 5 ml once daily for 7 consecutive days. Blood is collected after the last administration, and serum is separated by centrifugation (3000 rpm, 15 min). After filtration and sterilization, the serum is aliquoted and stored at -80℃. Intervention protocol: HCT116 cells were divided into a blank control group (using only ordinary serum) and a drug-containing serum group (e.g., 10%, 15%, and 20% concentrations). The cells were treated with the drug-containing serum medium for 24–48 hours (adjusting the time according to the experimental design). Two hours before treatment, the medium was replaced with serum-free RPMI 1640 medium to stabilize the metabolic background.

[0046] (2) Metabolite sample collection and quenching 2.1) Rapid Quenching of Cell Metabolites: Discard the culture medium, wash cells twice with pre-chilled PBS at 4°C, and thoroughly aspirate any remaining liquid. Key step: Directly contact the bottom of the culture dish with liquid nitrogen to rapidly quench cellular metabolic activity (1 minute) and prevent metabolite degradation. Add 500 μL of pre-chilled methanol-water (80:20, v / v) solution, gently scrape cells with a cell scraper, and transfer them to 1.5 mL centrifuge tubes.

[0047] 2.2) Sample pretreatment and preservation: Centrifuge at 1000 rpm for 1 minute at 4℃, discard the supernatant, and collect the cell pellet. Immerse the tip of the centrifuge tube in liquid nitrogen for 1 minute to quench it again, seal the tube opening with Parafilm sealing film, and immediately store at -80℃ or in liquid nitrogen to avoid repeated freeze-thaw cycles.

[0048] (3) Metabolite extraction and mass spectrometry detection 3.1) Metabolite extraction: Extraction was performed using a cold methanol-water-chloroform system (2:1:1): Pre-cooled extraction buffer was added until cell pellet formed, vortexed for 30 seconds, and sonicated on ice for 10 minutes (300 W, 5-second intervals). Centrifuged at 12,000 rpm for 15 minutes at 4°C, and the supernatant (aqueous phase) was used for non-targeted metabolomics analysis.

[0049] 3.2) Mass spectrometry detection parameters: Instrument: UPLC-Q-TOF / MS system, C18 column (1.7 μm, 2.1 × 100 mm), column temperature 40℃. Mobile phase: A is 0.1% formic acid in water, B is acetonitrile; gradient elution (0.2 min 5% B, 2.15 min 5%~95% B). Ionization mode: Electrospray ionization (ESI), positive and negative ion mode scanning, mass range m / z 50~1000.

[0050] (4) Data analysis and quality control 4.1) Data Preprocessing: Peak extraction, alignment, and normalization were performed using Progenesis QI or XCMS software to generate a peak table (retention time, mass-to-charge ratio, peak intensity). Metabolite identification was performed using databases (such as HMDB, KEGG), with a matching mass error of <5 ppm.

[0051] 4.2) Quality Control Measures: Insert Quality Control Samples (QC Samples): Mix all sample extracts and insert one QC sample for every 10 samples to monitor instrument stability. The relative standard deviation (RSD) of the metabolite peaks in the QC samples must be <30% to ensure data reliability.

[0052] In this embodiment, the data analysis and processing methods adopt conventional techniques in the field, such as those disclosed in the literature “Lee, SH, S. Lira-Albarrán, and PF Rinaudo, Proteomic and metabolomic insights into oxidative stress response activation in mouse embryos generated by in vitro fertilization. Hum Reprod Open, 2025. 2025(2): p. hoaf022.”, “Xu, P., et al., Alisol A ameliorates vascular cognitive impairment via AMPK / NAMPT / SIRT1-mediated regulation of cholesterol and autophagy. Theranostics, 2025. 15(18):p. 9415-9446.”, and “Liu, J., et al., Gut microbiota-derived butyrate primes systemic immunity in honey bees by mediating lipid metabolic reprogramming. Nat Commun, 2026.”.

[0053] (5) Metabolomics data preprocessing and metabolite sequencing 5.1) Metabolite Quantification Matrix Standardization: The raw peak area matrix obtained from non-targeted metabolomics is standardized. First, intra-sample normalization (normalized by total peak area) is performed to eliminate overall concentration differences between samples. Then, metabolite levels are standardized (Z-score standardization) to make different metabolite concentrations comparable. Missing Value Handling: For metabolites with concentrations below the detection limit, half the minimum value within the group or KNN imputation is used.

[0054] 5.2) Calculate and rank the association between metabolites and phenotypes: For the Xiangbei Yangrong Decoction-containing serum group vs. the control group, calculate the fold change and significance (t-test p-value) for each metabolite. Ranking index: Calculate the ranking metric score for each metabolite using the following formula:

[0055] All metabolites were sorted from highest to lowest score, generating a sorted list L. Larger positive values ​​indicate more significant upregulation in the drug-containing serum group, while smaller negative values ​​indicate more significant downregulation.

[0056] (6) Gene set database preparation (metabolic pathway adaptation) 6.1) Select the metabolic pathway gene set: Download the gene set (e.g., c2.cp.kegg.v2023.1.Mm.symbols.gmt, Mm is required for rat models) from the C2 (KEGG, Reactome) and C5 (GO) sub-databases of MSigDB.

[0057] 6.2) Metabolite-Gene Mapping: Associating metabolites with pathway genes: Matching metabolite IDs to relevant enzymatic response genes using the KEGG Compound database (https: / / www.kegg.jp / kegg / compound / ).

[0058] (7) GSEA analysis execution and parameter settings 7.1) Run the GSEA algorithm: Tools: Use the clusterProfiler package in R.

[0059] Key parameters: permutation type: Select gene_set (when the number of metabolites is >1000); if the sample size is <7, select phenotype.

[0060] number of permutations: 1000 times (default) to ensure statistical stability.

[0061] Enrichment statistic: Weighted enrichment statistic, which emphasizes the contribution of metabolites at the top / bottom of the ranking.

[0062] Metric for ranking genes: Choose Signal2Noise or Diff_of_Classes to amplify differences between groups.

[0063] 7.2) Calculate the enrichment score (ES) and significance. GSEA iterates through the sorted list L, and for each pathway gene set S: When encountering metabolites within S, ES increases: the increment is related to the absolute value of the metabolite's score (weighted method).

[0064] When encountering S extrametabolites, ES decreases: the decrease is a fixed value (inversely proportional to the size of S).

[0065] The ES value is the maximum deviation of the cumulative statistic. A positive ES indicates that the pathway is enriched at the high expression end in the drug-containing serum group (i.e., metabolite upregulation).

[0066] Significance test: The NES (standardized enrichment score) and FDR q-value were calculated by permutation test (rearranging phenotypic labels 1000 times).

[0067] (8) Interpretation of results: Enrichment of fatty acid oxidation pathway 8.1) Criteria for judging significant enrichment Key metric: |NES|>1 (enrichment intensity threshold).

[0068] FDR q-value < 0.25 (relaxed standard, suitable for exploratory analysis) or < 0.05 (strict standard).

[0069] It also satisfies p-value < 0.05 (uncorrected significance).

[0070] 8.2) Visualization and Verification Use the R package enrichplot to plot: The GSEA enrichment plot (using the gseaplot2 function) displays the ES curves of the fatty acid oxidation pathway.

[0071] Test results as follows Figure 4As shown, after intervention with serum containing Xiangbei Yangrong Decoction in colorectal cancer cells, metabolomics sequencing and GSEA enrichment analysis revealed that, based on the core gene MMACHC, it inhibits the proliferation and invasion of colorectal cancer cells through lipid metabolism pathways, thereby delaying tumor progression. Through rescue experiments, after overexpressing the MMACHC gene in colorectal cancer cell lines, intervention with serum containing Xiangbei Yangrong Decoction resulted in increased cell proliferation compared to the control group. Figure 2 As shown in Figures E and 2F, this indicates that Xiangbei Yangrong Decoction exerts its anti-colorectal cancer effect through the key target of MMACHC, meaning that substances that reduce MMACHC expression can be used in the preparation of anti-tumor drugs.

Claims

1. Application of substances that reduce MMACHC expression in the preparation of antitumor drugs, wherein the tumor refers to colorectal tumors.

2. The application according to claim 1, characterized in that, The antitumor drugs mentioned refer to drugs that inhibit lipid metabolism pathways.

3. The application according to claim 1, characterized in that, The substance that reduces MMACHC expression refers to the MMACHC knockout vector.

4. The application according to claim 3, characterized in that, The vector was constructed based on the eukaryotic expression vector pcDNA3.1.

Images