CRISPR / Cas targeting vector for Mmacc gene c.658660del AAG conditional point mutation and construction method of CRISPR / Cas targeting vector

Abstract

The invention belongs to the field of gene recombination engineering, and particularly relates to a CRISPR / Cas targeting vector for C.658660del AAG conditional point mutation of an Mmachc gene and a construction method of the CRISPR / Cas targeting vector. The vector comprises: (1) a VB157 skeleton plasmid, wherein the VB157 skeleton plasmid comprises an ampicillin resistance expression cassette and a kanamycin resistance expression cassette; (2) a fragment A (5'arm) and a fragment E (3 'arm) which are obtained by amplification from a C57BL / 6JCya mouse BAC clone or wild type (WT) genome; (3) a segment B containing a wild type mouse Mmachc gene; (4) obtaining a c.658660delAAG mutation fragment under the combined action of a fragment C and a fragment D which are positioned on loxP sites on two sides of exon 4 of the Mmachc gene and amplification primers of the fragment C and the fragment D; and (5) an F fragment of a 6xSV40pA sequence located at the upstream of the second loxP site. According to the CRISPR / Cas targeting vector for the C.658660 del AAG conditional point mutation of the Mmachc gene and the construction method of the CRISPR / Cas targeting vector, the CRISPR / Cas targeting vector for the C.658660 del AAG conditional point mutation of the Mmachc gene can be accurately constructed.

Description

Technical Field

[0001] This invention relates to the field of gene recombination, and more particularly to a CRISPR / Cas targeting vector for conditional point mutations of the Mmachc gene c.658_660 del AAG and its construction method. Background Technology

[0002] In constructing mouse conditional mutation models, the CRISPR / Cas system relies on targeted vectors to achieve precise genome editing. Its core lies in the vector's specific modification of target gene sites and the efficient integration of regulatory elements. c.658_660 del AAG is the deletion of AAG at bases 658 to 660 in the coding region, resulting in the final synthesized protein lacking a corresponding amino acid (full-length deletion). Its severity depends on which gene it occurs in and whether the deleted amino acid is critical; for example, in the CFTR gene, this mutation is one of the common causes of cystic fibrosis.

[0003] Existing mutant vectors targeting the mouse Mmachc gene (NCBI Reference Sequence: NM_025962.3) have the following limitations: They lack specific vectors capable of precisely introducing the c.658_660 del AAG mutation. Existing vectors are mostly broad-spectrum mutation tools, which are prone to off-target effects or inaccurate mutation sites. For example, conditional regulatory elements (such as loxP sites and polyA sequences) often fail to mediate conditional mutations effectively due to incorrect insertion positions or sequence deletions, leading to ineffective Cre recombinase mediation or abnormal transcription of the target gene. This results in low integration efficiency of the mutant sequence and a lack of effective transcription termination signals (such as polyA sequences), leading to abnormal expression of the target gene.

[0004] For example, improper sources and amplification methods of homologous arms (HAs) can lead to insufficient homologous recombination efficiency between the vector and the mouse genome, increasing the difficulty of model construction. Furthermore, existing targeting vectors often use homologous arms derived from ordinary genome PCR amplification, resulting in unclear origins and insufficient fidelity, leading to low homologous recombination efficiency with the mouse genome and a high vector construction failure rate.

[0005] In existing technologies, the vector construction process lacks standardization, and the enzyme digestion, ligation steps and reaction systems are not fixed, resulting in low reproducibility of vector construction and large differences in the structure of different batches of vectors.

[0006] In existing technologies, the lack of specific verification methods after vector construction often makes it impossible to confirm the correctness of key regions (such as mutation sites and regulatory elements), leading to errors in the subsequent construction of mouse models.

[0007] In existing technologies, some vectors lack effective screening markers or have failed to function, resulting in time-consuming and low-accuracy screening of positive clones. Summary of the Invention

[0008] The purpose of this invention is to provide a CRISPR / Cas targeting vector for the conditional point mutation of the Mmachc gene c.658_660 del AAG and its construction method, which can accurately construct the CRISPR / Cas targeting vector for the conditional point mutation of the Mmachc gene c.658_660 del AAG.

[0009] To address the aforementioned technical problems, the present invention provides a CRISPR / Cas targeting vector for the conditional point mutation of the Mmachc gene c.658_660 del AAG, and its construction method is as follows: CRISPR / Cas targeting vector for conditional point mutation of Mmachc gene c.658_660 del AAG, the vector comprising: (1) VB157 backbone plasmid containing ampicillin resistance expression cassette and kanamycin resistance expression cassette; (2) A fragment (5'arm) and E fragment (3'arm) amplified from C57BL / 6JCya mouse BAC clone or wild-type (WT) genome; (3) B fragment containing wild-type mouse Mmachc gene; (4) C fragment and D fragment located at loxP sites flanking exon 4 of Mmachc gene, the amplification primers of fragments C and D working together to obtain c.658_660delAAG mutant fragment; (5) F fragment of 6xSV40 pA sequence located upstream of the second loxP site.

[0010] Optionally, the enzyme used for PCR amplification of fragments A and E is high-fidelity Taq DNA polymerase.

[0011] The method for constructing a CRISPR / Cas targeting vector for the conditional point mutation of the Mmachc gene c.658_660 del AAG includes the following steps: (1) PCR amplification of the target fragments: Fragment A, fragment B, fragment C, fragment D, fragment E and fragment F were amplified by PCR. The enzyme used for amplification was high-fidelity Taq DNA polymerase. The primers and templates used are shown in Table 1. (2) VB157 backbone linearization by restriction enzyme digestion. The restriction endonuclease used is AscI / NotI digestion to linearize the backbone; (3) First step ligation: Use ligase to ligate fragments A and B with the linearized VB157 backbone to obtain the intermediate product NKI5452-AB; (4) Second step ligation: After digestion with NotI / SpeI enzyme, NKI5452-AB is ligated with fragments C, D, and E to obtain NKI5452-CDE; (5) Third step of ligation: After the NKI5452-CDE is digested with AfeI / AgeI enzyme, the F fragment is ligated to form a recombinant vector.

[0012] Optionally, after the recombinant vector is introduced, vector verification is performed: through bacterial testing, plasmid extraction and enzyme digestion identification, and sequencing verification.

[0013] Optionally, the ligase used in the first step of ligation is Novizan C115 ligase.

[0014] Optionally, the high-fidelity Taq DNA polymerase is Novizan P515 high-fidelity Taq DNA polymerase.

[0015] Optionally, the PCR amplification system consists of 5 ng template, 4 μL primers, 50 μL enzyme, and 40 μL sterile water per 100 μL. The amplification program is as follows: pre-denaturation at 95℃ for 5 min, 30 cycles (95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 kb / min), and final extension at 72℃ for 10 min.

[0016] Optionally, the plasmid extraction and enzyme digestion identification are performed using the QIAGEN QIAprep® Spin Miniprep Kit (27106) to extract the plasmid, digest it with NcoI and SacI enzymes, and detect the size of the digested fragments by electrophoresis to confirm that it is consistent with the expectation.

[0017] Optionally, the bacterial test is as follows: single colonies are picked and verified by PCR using Novizan P222 Taq enzyme: the PCR amplification system is a 25 μL system: 12.5 μL of 2×Taq enzyme mixture + 4 μL of single colony suspension + 1 μL each of primers Cas9-SF1 / NKI5452-P1 + sterile water to make up to 25 μL.

[0018] Optionally, the connection system for the first, second, and third steps is a 10 μL connection system. Linearized backbone: 100 ng, inserted amplified and recovered target fragment: 50 ng, 2× enzyme mixture: 5 μL, sterile water: to 10 μL; ligation conditions: 50℃ reaction for 15 min, hot cap temperature 105℃.

[0019] The present invention has the following beneficial effects: (1) This invention successfully constructs a CRISPR / Cas targeting vector, which significantly improves homologous recombination efficiency compared to existing technologies, solving the problem of inefficient recombination caused by ambiguous homologous arm origins in existing technologies. The homologous arms (5'arm and 3'arm) of this invention are obtained from the BAC clone of the mouse Mmachc gene using high-fidelity Taq DNA polymerase (Novizan P515). The BAC clone has high genomic fragment integrity, and the high-fidelity Taq DNA polymerase reduces base mismatches during amplification, ensuring high homology between the homologous arms and the Mmachc gene region on mouse chromosome 4. This improvement directly increases the homologous recombination efficiency between the vector and the genome, reduces ineffective integration, and lowers the risk of failure in subsequent mouse model construction.

[0020] (2) The conditional regulation function of this invention is precise and reliable, overcoming the regulatory failure problem caused by the chaotic integration of elements in existing technologies. In this invention, the loxP site is precisely inserted on both sides of exon 4, and the 6xSV40 pA sequence is strictly located upstream of the second loxP site. The integrity and positional accuracy of the element have been verified by sequencing. This design ensures that Cre recombinase can specifically recognize the loxP site, achieving spatiotemporal specific regulation of mutations; at the same time, 6xSV40 pA can effectively terminate abnormal transcription, avoiding interference with the function of target genes, solving the problem of embryonic lethality or phenotypic instability caused by unconditional mutations, and making mutation regulation more precise.

[0021] (3) The standardized and highly reproducible construction process solves the problem of poor stability caused by non-standard operation in existing technologies. This invention adopts a standardized process of stepwise enzymatic digestion (AscI / NotI→NotI / SpeI→AfeI / AgeI) and ligation, using specific enzymes (restriction endonucleases, Novizan C115 ligase) and a fixed reaction system (e.g., 10 μL ligation system containing 100 ng of linearized backbone and 50 ng of insert fragment, reacted at 50℃ for 15 min). The standardized process reduces the randomness of experimental operations, improves the reproducibility and stability of vector construction, and enables different laboratories or batches to stably obtain the correct vector.

[0022] (4) The verification method of this invention is reliable, ensuring the correctness of the vector structure and solving the error risk caused by the lack of effective verification in existing technologies. This invention ensures the correctness of the vector through multi-dimensional verification: ① Enzyme digestion verification: using enzymes such as SacI and XhoI for digestion, the fragment size is completely consistent with the expectation (e.g., XhoI digestion produces a 13.6kb fragment); ② Sequencing verification: covering homologous arms, loxP sites, c.658_660 del AAG mutation region and selection markers, confirming that the sequence is correct. The reliable verification method completely eliminates the risk of vector structure errors, provides a stable foundation for subsequent mouse model construction, and reduces experimental duplication and resource waste caused by vector errors.

[0023] (5) The screening markers of this invention are highly efficient, shortening the screening time for positive clones and solving the problem of inefficient screening in existing technologies. The vector of this invention contains dual screening markers of Kan cassette (kanamycin resistance) and Amp cassette (ampicillin resistance). During the vector construction process, positive clones can be quickly obtained through resistance screening, avoiding the subsequent culture and identification of invalid clones, significantly shortening the screening time, and saving raw materials such as culture media and reagents.

[0024] In summary, through targeted improvements, this invention outperforms existing technologies in terms of homologous recombination efficiency, regulatory precision, construction stability, verification reliability, and screening efficiency, providing an efficient and reliable tool for constructing a Mmachc gene conditional point mutation mouse model. Attached Figure Description

[0025] Figure 1 This is a diagram of the CRISPR / Cas targeting vector construction method for the conditional point mutation of the Mmachc gene c.658_660 del AAG provided by the present invention; Figure 2 These are electrophoresis verification images of fragments A, B, C, D, and E. The top image is the verification electrophoresis image of homologous arms A and E and genomic fragment D, and the bottom image is the verification electrophoresis image of mutant unit B and selection marker C. Figure 3 This is a linearized schematic diagram of the carrier skeleton; Figure 4 This is the plasmid pattern of the intermediate product NKI5452-AB; Figure 5 This is the electrophoresis image of the first step in screening positive PCR clones from ligated colonies; Figure 6 This is the first step: plasmid ligation, enzyme digestion, identification, and electrophoresis image. Figure 7 This is an electrophoresis image of the second step, ligation of colony PCR-positive clones for screening; Figure 8This is a diagram showing the results of the second step: plasmid extraction and enzyme digestion. Figure 9 This is the map of the intermediate vector plasmid containing fragments A, B, C, D, and E obtained from the second step of ligation; Figure 10 This is an electrophoresis image of the third step, ligation of colony PCR-positive clones for screening; Figure 11 This is the electrophoresis image from the third step: plasmid ligation, enzyme digestion, and identification. Figure 12 It is the final vector plasmid map containing fragments A, B, C, D, E, and F; Figure 13 This is a sequencing verification diagram of the backbone and the 5' arm interface of fragment A; Figure 14 This is a DNA sequencing verification diagram of the interface between fragment A's 5' arm and fragment B (Mouse Mmachc genomic region); Figure 15 This is a DNA sequencing verification diagram of the B fragment (Mouse Mmachc genomic region) and the F fragment 6*SV40 interface; Figure 16 This is a DNA sequencing verification diagram of the interface between the F fragment 6*SV40 and the C and D fragments (Mouse Mmachc genomic region (c.658_660 delAAG)); Figure 17 This is a DNA sequencing verification diagram of fragments C and D (Mouse Mmachc genomic region (c.658_660 del AAG)) and the 3' arm interface of fragment E; Figure 18 This is a sequencing verification diagram of the E fragment 3' arm and the backbone interface DNA; Figure 19 The Mmachc wild-type gene is precisely edited using a vector that undergoes homologous recombination with the vector described in this invention via CRISPR / Cas9 technology. Figure 20 It is a linearized structure of the targeting vector NKI5452-VT and a map of its restriction enzyme sites; Figure 21 This is an electrophoresis image of the CRISPR / Cas9 targeting vector digestion of the Mmachc gene c.658_660 del AAG conditional point mutation. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the following embodiments provide a more detailed description of the invention. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of the invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0028] MMACHC encodes a protein that plays a crucial role in the metabolism of vitamin B12 (cobalamin). Mutations in this gene can lead to cblC-type methylmalonic acidemia (MMA), an autosomal recessive disorder of organic acid metabolism.

[0029] c.658_660 del AAG mutation: This is a very common pathogenic mutation in the MMACHC gene, especially prevalent in patients with cblC type MMA. This mutation results in the deletion of lysine at position 220 of the protein (p.Lys220del), severely affecting protein function.

[0030] Conditional point mutations are gene mutations that can be activated at a specific time (such as after administration of a specific drug) or in specific tissue cells.

[0031] The CRISPR / Cas system is a highly efficient "gene scissors" and "delivery tool." It's a powerful gene-editing tool that can create breaks at specific locations in the genome, much like "molecular scissors."

[0032] The targeting vector (usually a plasmid) is responsible for delivering the "scissors" (Cas9 protein) and the "navigation RNA" (sgRNA) into the cell. More importantly, it also carries a designed "repair template".

[0033] The present invention will be described in detail below through examples: Example 1 describes the construction method of a CRISPR / Cas targeting vector for the conditional point mutation of the Mmachc gene c.658_660 del AAG, as well as the bacterial detection, plasmid extraction, and enzyme digestion identification during the construction process. like Figure 1 As shown, the starting vector used in this invention is the VB157 backbone plasmid, which contains Amp cassette (ampicillin resistance expression cassette) and Kan cassette (kanamycin resistance expression cassette), which serve as screening markers for positive clone screening during the vector construction process.

[0034] Then begin: (1) PCR amplification of the target fragment. Fragments A, B, C, D, E and F are amplified by PCR. The enzyme used for amplification is high-fidelity Taq DNA polymerase. The primers and templates used are shown in Table 1. Table 1

[0035]

[0036] The PCR amplification system consisted of 5 ng template, 4 μL primers, 50 μL enzyme, and 40 μL sterile water per 100 μL volume. The amplification program was 95℃ pre-denaturation for 5 min, 30 cycles (95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 kb / min), and a final extension at 72℃ for 10 min. The product was then stored at 4℃. Fragment recovery: After agarose gel electrophoresis, the target fragment was recovered using the QIAGENQIAquick® Gel Extraction Kit (28706).

[0037] This invention selects to amplify the following fragments from the BAC clone or wild-type (WT) genome of C57BL / 6JCya mice: A (5' arm), or 5' homologous arm, is a 1996-base-pair DNA sequence. Located upstream (5' end) of the target editing site on the vector, its sequence is identical to the 1996 bp sequence preceding the target site in the genome. It guides the vector to precisely integrate into a specific location in the genome. The template is BAC / C57BL / 6JCya-WT. B, C, and D are all fragments containing regions of the Mmachc genome. B contains a portion of exon 4, specifically the fourth exon of this gene, which is the part of the gene ultimately retained in mature mRNA and translated into protein. It carries the code for protein production. The c.658_660 del AAG mutation, located in exon 4 of the Mmachc gene, was introduced by the combined action of primers for fragments C and D to obtain the c.658_660delAAG mutant fragment. Specifically, B is 2031 bp, C is 564 bp, and D is 1438 bp, with templates of BAC / C57BL / 6JCya-WT, respectively.

[0038] E (3' arm): 1766 bp, template is BAC / C57BL / 6JCya-WT; 3' homologous arm, in the homologous recombination template, is a genomic DNA sequence located downstream of the predetermined editing site c.658_660 del AAG mutation.

[0039] This sequence was cloned directly from the wild-type genome of the C57BL / 6J mouse strain, which is the fundamental prerequisite for homologous recombination to occur.

[0040] Figure 2 The top image shows the electrophoresis verification images of fragments A, B, C, D, and E. The top image shows the electrophoresis verification images of homologous arms A and E and genomic fragment D. The bottom image shows the electrophoresis verification image of mutant unit B and selection marker C.

[0041] F(6xSV40 pA), pA: is an abbreviation for "poly(A) signal", which is a "period" or "stop and process" signal in the gene transcription process: 1794bp, derived from VT806 plasmid, and a 1.8 kb fragment was recovered after digestion with AscI / NotI enzymes.

[0042] SV40: is an abbreviation for "Simian Virus 40".

[0043] (2) VB157 backbone linearization by restriction enzyme digestion. The restriction endonuclease used is AscI / NotI to linearize the backbone. After linearization, fragments A, B, C, D and E are ligated in three steps. Figure 3 This is a schematic diagram of the linearization of the vector backbone. The diagram shows the Amp cassette (ampicillin resistance gene cassette) and Kan cassette (kanamycin resistance gene cassette) of the vector backbone, and the restriction enzyme sites used for linearization. The Kan cassette is placed between the two restriction enzyme sites, and AscI (6s7) and NotI (6g7) show two rare restriction endonuclease sites. The two restriction endonucleases are positioned on the left and right sides, flanking the Kan cassette.

[0044] (3) First step ligation: Use ligase to ligate fragments A and B with the linearized VB157 backbone to obtain the intermediate product NKI5452-AB; The linearized VB157 backbone was ligated with fragments A (5'arm) and B to obtain an intermediate vector (8158 bp) containing 5'arm, part of exon 4, loxP sites, and Kan cassette. The plasmid map is shown below. Figure 4 As shown.

[0045] Then, the intermediate product NKI5452-AB was tested for bacteria. Eight spots were selected from the plate, and four positive spots were picked using Novizan P222 PCR Taq enzyme. The positive spots were inoculated into 4 ml of PCR primer and incubated overnight at 37°C. The primers for bacterial picking are shown in Table 2. Table 2 Cas9-SF1 cgactcactatagggcgaattgg Cas9-SF1 / NKI5452-P1 334 NKI5452-P1 TGCAGAATGTCAGGGCTCCTAGCC PCR reaction system for bacterial detection: 12.5 μL of 2*Taq enzyme mixture, 4 μL of single colony suspension, 1 μL of primers (2*), and up to 25 μL of sterile water.

[0046] The electrophoresis image of the first step, ligation of colony PCR positive clones, is shown below. Figure 5 As shown, this invention has successfully screened positive bacterial clones containing the target intermediate vector NK15452-Step1-AB from transformed bacterial plates.

[0047] Then, plasmid extraction and enzyme digestion identification were performed: The plasmid was recovered using the QIAGEN QIAprep® Spin Miniprep Kit (27106). Approximately 800 ng of plasmid was taken and digested with NcoI: 5029,1659,899,571 in 20 μL for enzyme digestion verification. Figure 6 Enzyme digestion system: primer 2ul, enzyme 0.7ul, plasmid ~800ng, sterile water Up to 20ul, total volume 20ul.

[0048] The results are as follows Figure 6 The image shown is an electrophoresis diagram of the first step in plasmid ligation and restriction enzyme digestion identification. This is the result of restriction enzyme digestion identification of the intermediate plasmid NK15452-AB successfully constructed in this invention. It uses restriction endonucleases to cut the circular plasmid DNA into fragments of specific lengths, thus ultimately confirming from a physical structure perspective that the plasmid extracted in this invention is the correct vector intended to be constructed in this invention.

[0049] Colony PCR can provide a preliminary indication of successful plasmid construction, while enzyme digestion can confirm, at the DNA molecular structure level, that the plasmid fully conforms to the design.

[0050] (4) Second step ligation: After digestion with NotI / SpeI enzyme, NKI5452-AB is ligated with fragments C, D, and E to obtain NKI5452-CDE; After digestion with NotI / SpeI, NKI5452-AB was ligated with C, D, and E (3'arm) fragments to introduce a complete exon 4 and 3'arm (11830 bp in size) containing the c.658_660 del AAG mutation.

[0051] Then, bacterial testing, plasmid extraction, and enzyme digestion identification were performed, as shown in the first step. The bacterial testing results are as follows: Figure 8 As shown, the plasmid extraction and enzyme digestion results are as follows: Figure 7 As shown; Figure 7 This is the electrophoresis image from the second step: plasmid ligation, enzyme digestion, and identification. Figure 8 This is an electrophoresis image from the second step of the colony ligation PCR positive clone screening process.

[0052] Figure 9 The image shown is a plasmid map of an intermediate vector containing fragments A, B, C, D, and E. It is the intermediate vector K15452-Step2-CDE after fragments C, D, and E are ligated to NKI5452-AB.

[0053] (5) Third step of ligation: After the NKI5452-CDE is digested with AfeI / AgeI enzyme, the F fragment is ligated to form a recombinant vector.

[0054] After digestion with AfeI / AgeI, NKI5452-CDE was ligated with the F (6xSV40 pA) fragment to introduce the 6xSV40 pA sequence (final vector size 13569 bp).

[0055] The above enzyme digestion system is as follows: 2 μL buffer + 0.7 μL enzyme + plasmid (800 ng) + sterile water to make up to 20 μL, react at 37℃ for 2 h, and then recover the linearized backbone by gel extraction.

[0056] The above ligation system used Novizan C115 ligase. The 10 μL ligation system consisted of: linearized backbone: 100 ng; insert fragment (the target fragment recovered from amplification): 50 ng; 2× enzyme mixture: 5 μL; sterile water: to a final volume of 10 μL; ligation conditions: reaction at 50℃ for 15 min, with a hot cap temperature of 105℃.

[0057] Then, bacterial testing, plasmid extraction, and enzyme digestion were performed, following the same method as in the first step of ligation; the results are as follows: Figure 10 and Figure 11 As shown, Figure 10 This is the electrophoresis image of the third step, ligation of colony PCR-positive clones for screening. Figure 11This is the electrophoresis image from the third step, plasmid ligation and restriction enzyme digestion identification. Colony PCR can preliminarily indicate successful plasmid construction, while restriction enzyme digestion identification can confirm, at the DNA molecular structure level, that the plasmid fully conforms to the design. Figure 12 The image shown is the final vector plasmid map containing fragments A, B, C, D, E, and F. This demonstrates that the present invention started from the initial backbone (VB157) and progressively assembled multiple DNA fragments (A, B, C, D, E, F) to obtain an intermediate vector. Figure 4 and Figure 9 And through optimization and verification, the final gene targeting vector NKI5452-VT (with correct structure and complete function) was finally obtained. Figure 12 show).

[0058] Example 2: Recombinant Vector Validation – DNA Sequencing Validation like Figure 13 This is a sequencing verification diagram of the backbone and the 5' arm interface of fragment A. The results show that the DNA sequence of the interface in the recombinant vector is correct.

[0059] Figure 14 This is a sequencing verification diagram of the interface DNA between fragment A (5' arm) and fragment B (Mouse Mmachc genomic region). The results show that the interface DNA sequence of the recombinant vector is correct.

[0060] Figure 15 This is a sequencing verification diagram of the interface DNA of fragment B (Mouse Mmachc genomic region) and fragment F (6*SV40). The results show that the interface DNA sequence of the recombinant vector is correct.

[0061] Figure 16 This is a sequencing verification diagram of the interface DNA between the F fragment 6*SV40 and the C and D fragments (Mouse Mmachc genomic region (c.658_660 delAAG)). The results show that the interface DNA sequence of the recombinant vector is correct.

[0062] Figure 17 This is a sequencing verification diagram of the interface DNA of fragments C and D (Mouse Mmachc genomic region (c.658_660 del AAG)) and fragment E at the 3' arm. The results show that the DNA sequence of this interface in the recombinant vector is correct.

[0063] Figure 18 This is a sequencing verification diagram of the E fragment 3'arm and the backbone interface DNA. The results show that the interface DNA sequence of the recombinant vector is correct. Example

[0064] This embodiment uses a vector that undergoes homologous recombination with the vector in this invention, based on CRISPR / Cas9 technology, to precisely edit wild-type genes.

[0065] The first step was the generation of "mutant allele 1". For example... Figure 19 As shown, the desired point mutation (c.658_660 del AAG) has been successfully introduced into this new gene. Simultaneously, a selectable marker gene (such as KanR) and its necessary regulatory elements were also inserted. Most importantly, the point mutation and the selectable marker are linked by a specific pair of DNA sequences—the loxP site.

[0066] Step 2: Cre recombination – Activating mutations and refining the model Cre-mediated precise excision is then performed by mating an individual carrying the "mutant allele 1" with another individual that expresses Cre recombinase. Cre recombinase is a "molecular scissors" that specifically recognizes the loxP site.

[0067] Final product: a pure, controllable mutant gene. When the Cre enzyme is activated in a specific cell type or at a specific developmental time, it finds two loxP sites and precisely removes all the DNA sequence between them.

[0068] The result of this excision was the creation of "mutant allele 2": The selection marker was removed: this eliminated its potential interference with the surrounding genome, resulting in a "cleaner" genetic background that is closer to the natural state.

[0069] The mutation is preserved and "activated": the point mutation is permanently and precisely preserved in the genome. Now, the loss-of-function effect of this mutated gene will be manifested in the cells where Cre recombination has occurred.

[0070] In summary: Through the first step of gene targeting, we precisely install a "silent" mutation and a tool element into the genome. Subsequently, through the second step of Cre recombination, we can remove the tool element at a predetermined time or in a specific cell population and ultimately "activate" the mutation, thereby achieving precise temporal and spatial control over the loss of gene function. This is the essence of "conditional point mutation" technology. Example

[0071] This embodiment puts Figure 12 The results of linearizing the circular plasmid shown are as follows: Figure 20 As shown in the figure, all the core components of the construction carrier of this invention and their order are clearly marked. From left to right, they roughly include: 5' arm (5' homologous arm): responsible for recombination on the left side of the genome.

[0072] Wild-type mouse Mmachc gene fragment: used for subsequent synthesis of the target gene fragment (the loxp sites flanking the exon function to delete the wild-type exon4 in the middle).

[0073] loxP site: used for precise manipulation mediated by subsequent Cre recombinase.

[0074] Kan cassette (Kanamycin Resistance Kit) with 6xSV40 pA: for screening successfully integrated cells in eukaryotic cells.

[0075] The C and D fragment DNA sequences of the mouse Mmachc gene: used to introduce the 658_660delAAG mutation during post-amplification.

[0076] 3' arm (3' homologous arm): responsible for recombination on the right side of the genome.

[0077] Ampicillin resistance kit: Used to amplify plasmids in bacteria.

[0078] Restriction enzyme cleavage sites (scales and road signs on a map) The symbols marked Scal, NdeI, SacI, XhoI, HindIII, etc., are recognition sites of different restriction endonucleases. Figure 20 It was finally confirmed that all DNA fragments (A, B, C, D, E, F) had been assembled together in the correct order and orientation as designed. Example

[0079] The CRISPR / Cas targeting vector containing the recombinant Mmachc gene c.658_660 del AAG conditional point mutation of this invention was digested with various enzymes. The digestion results are as follows: Figure 21 The image shows the electrophoresis results of Marker (M) and different enzyme digestion groups (1-4); Lane 1 (SacI digestion): 5.5 kb, 3.7 kb, 2.6 kb, 1.4 kb, 0.4 kb fragments; Lane 2 (ScaI digestion): 5.6 kb, 4.3 kb, 3.7 kb fragments; Lane 3 (double digestion with HindIII and NdeI): 5.6 kb, 3.7 kb, 2.7 kb, and 1.5 kb fragments; Lane 4 (XhoI digestion): 13.6 kb fragment.

[0080] SacI digestion of lane 1 yields fragments A, B, C, D, etc., and the actual band size displayed in lane 1 perfectly matches the prediction.

[0081] This embodiment uses various restriction endonucleases (SacI, ScaI, double digestion, etc.) to verify from different perspectives, forming a three-dimensional, cross-validating evidence network. Single digestion (e.g., XhoI): confirms whether the total vector size is correct (13.6 kb under a single condition). Other single digestions (e.g., ScaI) and triple digestions: produce unique, easily identifiable fragment patterns, like a "DNA fingerprint". Double digestion (HindIII + NdeI): provides a more complex and specific verification mode.

[0082] Identification using only one enzyme is relatively weakly convincing. Dividing the plasmid at different sites using three or four enzymes, if the results all meet expectations, can verify the accuracy of the plasmid structure from multiple perspectives. This invention provides detailed enzyme digestion verification data, demonstrating that the plasmid has been completely constructed and its structure has been verified.

[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for Mmachc A CRISPR / Cas targeting vector for the conditional point mutation of the gene c.658_660 del AAG, characterized in that, The vector comprises: (1) a VB157 backbone plasmid, the VB157 backbone plasmid comprising an ampicillin resistance expression cassette and a kanamycin resistance expression cassette; (2) an A fragment (5' arm) and an E fragment (3' arm) amplified from a C57BL / 6J Cya mouse BAC clone or a wild-type WT genome; (3) a B fragment containing a wild-type mouse Mmachc gene; (4) a C fragment and a D fragment located on both sides of a loxP site of the gene exon 4, the amplification primers of the C fragment and the D fragment jointly obtaining a c.658_660delAAG mutant fragment; and (5) a F fragment of a 6xSV40 pA sequence located upstream of a second loxP site. Mmachc ​ 2. The use according to claim 1, wherein the compound is a compound of formula (I) ###0001### (I) or a pharmaceutically acceptable salt thereof. Mmachc A CRISPR / Cas targeting vector of the conditional point mutation of gene c.658_660 del AAG, characterized in that, The enzyme used for PCR amplification of the A segment and the E segment is high-fidelity Taq DNA polymerase.

3. The use according to claim 1 or 2, wherein the compound is a compound of formula (I) ###0001### (I) Mmachc A method for constructing a CRISPR / Cas targeting vector for conditional point mutation of a gene c.658_660delAAG, characterized in that, The steps include: (1) PCR amplification of the target segment, respectively, the A segment, the B segment, the C segment, the D segment, the E segment and the F segment are subjected to PCR amplification, the enzyme used is high-fidelity Taq DNA polymerase, and the primers and templates are as shown in Table 1; (2) VB157 skeleton enzyme linearization, the restriction enzyme used is AscI / NotI enzyme, which linearizes the skeleton; (3) first step connection: the A segment and the B segment are connected with the linearized VB157 skeleton by using a ligase to obtain an intermediate product NKI5452-AB; (4) second step connection: the NKI5452-AB is subjected to NotI / SpeI enzyme digestion, and then the C, D and E segments are connected to obtain NKI5452-CDE; (5) third step connection: the NKI5452-CDE is subjected to AfeI / AgeI enzyme digestion, and then the F segment is connected, and the recombined vector is formed.

4. The method according to claim 3, wherein the method is used for Mmachc A method for constructing a CRISPR / Cas targeting vector of a conditional point mutation of gene c.658_660 del AAG, comprising the steps of: After the recombined vector, the vector is verified: through bacteria detection, plasmid extraction and enzyme digestion identification and sequencing verification.

5. The method according to claim 3, wherein the method is used for Mmachc A method for constructing a CRISPR / Cas targeting vector of a conditional point mutation of gene c.658_660 del AAG, comprising the following steps: The ligase in the first step connection is Novagen C115 ligase.

6. The method according to claim 3, wherein the method is used for Mmachc A method for constructing a CRISPR / Cas targeting vector for conditional point mutation of a gene c.658_660 del AAG, comprising the steps of: The high-fidelity Taq DNA polymerase is Novagen P515 high-fidelity Taq DNA polymerase.

7. The method for Mmachc A method for constructing a CRISPR / Cas targeting vector for conditional point mutation of a gene c.658_660 del AAG, characterized by, The PCR amplification system 100 μL system contains 5 ng of template, 4 μL of primer, 50 μL of enzyme and 40 μL of sterilized water; the amplification program is 95℃ pre-denaturation for 5 min, 30 cycles (95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 kb / min), and 72℃ final extension for 10 min.

8. The method for Mmachc A method for constructing a CRISPR / Cas targeting vector for conditional point mutation of a gene c.658_660 del AAG, characterized by, The plasmid extraction and enzyme digestion identification are performed by using QIAGEN QIAprep® Spin Miniprep Kit (27106) to extract the plasmid, using NcoI and SacI for enzyme digestion, and electrophoresis detection of the enzyme digestion fragment size to confirm the consistency with the expectation.

9. The method for Mmachc A method for constructing a CRISPR / Cas targeting vector for conditional point mutation of a gene c.658_660 del AAG, characterized by, The bacteria detection is: a single colony is picked and subjected to PCR verification by using Novagen P222 Taq enzyme: the PCR amplification system is 25 μL system: 2×Taq enzyme mixture 12.5 μL + single colony water suspension 4 μL + primer Cas9-SF1 / NKI5452-P1 each 1 μL + sterilized water to 25 μL.

10. The method for Mmachc A method for constructing a CRISPR / Cas targeting vector for conditional point mutation of a gene c.658_660 del AAG, characterized by, The connection system of the first step connection, the second step connection and the third step connection is: 10 μL connection system, Linearized skeleton: 100 ng, inserted amplified target segment: 50 ng, 2× enzyme mixture: 5 μL, sterilized water: supplemented to 10 μL; connection condition: 50℃ reaction for 15 min, hot lid temperature 105℃.

Images