Use of salvia miltiorrhiza-bauhinia purpurea vesicle-like nanoparticles

Abstract

The application discloses application of Danshen-Gegen vesicle-like nanoparticles and belongs to the technical field of biological medicine. The Danshen-Gegen vesicle-like nanoparticles (SPVLNs) are extracted and purified from Danshen-Gegen decoction liquid by using a differential super-high-speed centrifugation method. The SPVLNs have good blood compatibility. When the SPVLNs are applied to treating abdominal aortic aneurysm, the SPVLNs can obviously relieve thickening of a blood vessel wall, reduce infiltrative cells of an arterial media and an adventitia, improve reduction and fracture of elastic fibers of the blood vessel wall, increase stretchability of the elastic fibers of the blood vessel wall, reduce contents of tissue muscle fibers and collagen fibers, reduce a fibrosis degree of the collagen fibers, obviously improve pathological changes of a mouse abdominal aorta caused by Ang II, and are safe and non-toxic.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of tanshinone-pueraria vesicle-like nanoparticles. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Abdominal aortic aneurysm (AAA), a vascular disease that seriously threatens the lives and health of middle-aged and elderly people, is characterized by localized dilation of the abdominal aorta exceeding 50% of its normal diameter. Epidemiological surveys show that the prevalence of this disease in people over 55 years of age is 2%-8%, and the clinical detection rate is showing a significant upward trend with the accelerating aging of the population. Of particular concern is the insidious nature of AAA's development; approximately 80% of patients have no obvious clinical symptoms before the aneurysm ruptures. Once rupture occurs, even with emergency surgical intervention, the mortality rate remains as high as 65-85%, making it a pressing clinical challenge in the cardiovascular field. Therefore, AAA seriously endangers human health and survival, making the research and development of drugs for its treatment extremely important.

[0004] Traditional Chinese medicine (TCM) has long been a focus of attention due to its advantages in multi-target synergistic therapy, chronic disease management, and relatively low side effects. However, its complex composition and processing technology also limit its further application. In recent years, self-assembled nanoparticles from TCM have become a hot research topic. Active components of TCM interact to form nanostructures such as nanotubes, nanofibers, micelles, and vesicles, which facilitate drug efficacy. Researchers have found the presence of natural nanoparticles in many decoctions. For example, researchers have found nanostructures in the water extracts of 60 single-herb TCMs and 24 TCM compound formulas. These nanoparticles exhibit good anti-inflammatory, repair, and immunomodulatory pharmacological effects. These studies suggest that vesicle-like nanoparticles (SPVLNs) extracted from decoctions, as a novel natural product, have the potential to become a good candidate source for new drug development. However, no literature reports on extracellular vesicles derived from Danshen-Gegen.

[0005] Furthermore, the oral dosage of Danshen-Pueraria decoction is large, its taste is bitter and difficult to swallow, and its complex composition and strict storage conditions (-20℃) also hinder further research. Therefore, it remains unknown whether it is feasible to extract vesicle-like nanoparticles from Danshen-Pueraria decoction, whether the extracted vesicle-like nanoparticles possess the original biological activity of the decoction, and whether the extracted vesicle-like nanoparticles have good stability.

[0006] Therefore, it is of great significance to provide a vesicle-like nanoparticle with good stability and guaranteed bioactivity for the treatment of abdominal aortic aneurysm (AAA). Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide the application of vesicle-like nanoparticles from Danshen and Pueraria lobata. This invention efficiently separates and purifies high-purity vesicle-like nanoparticles (SPVLNs) from Danshen and Pueraria lobata decoction, which can effectively delay the progression of abdominal aortic aneurysms when applied to them.

[0008] The biomedical value of plant vesicle-like nanoparticles (PVLNs) has attracted much attention. In addition to small molecule chemical components, the extract of a decoction of *Salvia miltiorrhiza* and *Pueraria lobata* contains PVLNs with a diameter of 30-150 nm. These natural nanocarriers can carry active ingredients such as salvianolic acid B and daidzein, and possess the unique advantage of crossing biological barriers and delivering drugs in a targeted manner. These findings provide important clues for elucidating the cross-species regulatory mechanism of PVLNs and suggest that *Salvia miltiorrhiza*-*Pueraria lobata*-derived PVLNs may exert a therapeutic effect on abdominal aortic aneurysms through a synergistic "component-carrier" interaction.

[0009] The Danshen-Gegen compound has the effects of promoting blood circulation, removing blood stasis, and promoting tissue regeneration, and is used in the treatment of various cardiovascular and cerebrovascular diseases. This invention provides a method for extracting vesicle-like nanoparticles from the decoction of Danshen-Gegen, and conducts in-depth research on the function of the extracted vesicle-like nanoparticles to explore their application potential in the treatment of abdominal aortic aneurysms.

[0010] This invention provides a method for extracting vesicle-like nanoparticles from a decoction of *Salvia miltiorrhiza* and *Pueraria lobata*, and evaluates their composition and safety, further exploring their protective effect against abdominal aortic aneurysms. The vesicle-like nanoparticles from the *Salvia miltiorrhiza* and *Pueraria lobata* decoction of this invention conform to recognized characteristics of vesicle-like nanoparticles, containing various lipid compounds and miRNA components, exhibiting good stability and biosafety. Treatment with these vesicle-like nanoparticles from the *Salvia miltiorrhiza* and *Pueraria lobata* decoction improved Ang II-induced changes in the cellular structure of mouse abdominal aortic tissue, specifically by alleviating vascular wall thickening, reducing infiltrative cells in the arterial media and adventitia, improving the reduction and breakage of elastic fibers in the vascular wall, increasing the extensibility of elastic fibers in the vascular wall, reducing the content of muscle fibers and collagen fibers in the tissue, and reducing the degree of collagen fiber fibrosis. This invention provides a theoretical basis and scientific evidence for the treatment of abdominal aortic aneurysms using vesicle-like nanoparticles derived from a decoction of *Salvia miltiorrhiza* and *Pueraria lobata*.

[0011] To achieve the above objectives, the technical solution of the present invention is as follows:

[0012] In a first aspect, the present invention provides the application of tanshinone-pueraria vesicle-like nanoparticles (SPVLNs) in the preparation of drugs for treating abdominal aortic aneurysms.

[0013] In one or more embodiments of the present invention, the average particle size of the tanshinone-pueraria vesicle-like nanoparticles is 50-200 nm, such as 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nm. The average particle size is preferably 60-120 nm, more preferably 80-90 nm, and most preferably 88 mm. Furthermore, the particles exhibit a saucer-like structure, consistent with the size and morphology of exosomes.

[0014] The vesicle-like nanoparticles described are mostly nearly round or elliptical membrane vesicles.

[0015] Compared with fresh SPVLNs, the SPVLNs of the Salvia miltiorrhiza-Pueraria lobata vesicle-like nanoparticles stored at -20℃ for 3 months did not show significant changes in particle size and potential characteristics, demonstrating good stability.

[0016] In one or more embodiments of the present invention, the components of the tanshinone-pueraria vesicle-like nanoparticles include lipid compounds and microRNA.

[0017] The main lipid compounds in SPVLNs include: glycerides (TG, DG, etc.), sphingolipids (Cer, etc.), and glycerophospholipids (PC, PE, PG, etc.): among which, SPH accounts for 39.61%, WE accounts for 24.202%, and PG accounts for 17.216%.

[0018] SPVLNs contain a variety of microRNAs (miRNAs), with 40 of them having an expression level >50. Among them, the miRNA with the highest expression level is gma-miR6300, accounting for 17%, followed by ptc-miR6478, which accounts for 4%.

[0019] In one or more embodiments of the present invention, the function of the preparation of the drug for treating abdominal aortic aneurysm is any one or more of the following:

[0020] (1) Inhibits thickening of the blood vessel wall;

[0021] (2) Reduce the number of infiltrating cells in the arterial media and adventitia;

[0022] (3) Improves the reduction and breakage of elastic fibers in the blood vessel wall;

[0023] (4) Increases the extensibility of elastic fibers in the blood vessel wall;

[0024] (5) Reduces the content of muscle fibers and collagen fibers in tissues;

[0025] (6) Reduce the degree of fibrosis of collagen fibers.

[0026] In one or more embodiments of the present invention, a method for extracting vesicle-like nanoparticles from *Salvia miltiorrhiza* and *Pueraria lobata* includes the following steps:

[0027] (1) Preparation of Danshen-Ge Gen decoction: Add water to Danshen slices and Ge Gen slices, decoct, filter, add water repeatedly, decoct, filter, combine the decoctions from multiple decoctions, and concentrate;

[0028] (2) The supernatant of the decoction of Danshen-Ge Gen in step (1) is obtained by centrifugation, and the supernatant is centrifuged multiple times to obtain the pretreatment supernatant.

[0029] (3) Centrifuge the pretreatment supernatant obtained in step (2), discard the supernatant, and obtain the precipitate;

[0030] (4) Resuspend the precipitate obtained in step (3) in sterile PBS and filter it through a filter membrane to obtain the final product.

[0031] In one or more embodiments of the present invention, in step (1), the mass ratio of danshen slices and kudzu root slices is (0.9-1.1):(0.9-1.1), preferably 1:1, which is more conducive to giving full play to the effects of both.

[0032] In one or more embodiments of the present invention, in step (1), the amount of water added each time is 8-12 times the total mass of the danshen slices and kudzu root slices. For example, it can be 8, 9, 10, 11, or 12 times, preferably 10 times. Adding a large amount of water is to ensure complete submersion of the danshen slices and kudzu root slices, so as to better obtain the cooking liquid.

[0033] In one or more embodiments of the present invention, in step (1), the decoction liquids from 2-3 decoctions are combined. The first decoction mainly extracts water-soluble components (such as alkaloids and glycosides) and volatile components. Subsequent decoctions: by extending the contact time or changing the temperature, further extract fat-soluble components (such as volatile oils and resins) or structurally dense components (such as polysaccharides in rhizomes). Chemical analysis shows that a single decoction can only extract about 50%-70% of the effective components, while the second decoction can extract another 20%-30%. The total extraction rate after three decoctions can reach over 90%.

[0034] In one or more embodiments of the present invention, in step (1), the decoction temperature is 90-110℃, and boiling water is used for decoction. The decoction time is 0.5-4h each time, such as 0.5h, 1h, 1.5h, 2h, 3h, 4h, etc., preferably 2-3h, and most preferably 2h. Danshen and kudzu root are hard in texture, and decoction is used to fully extract fat-soluble active ingredients (such as tanshinone and puerarin). Through preliminary experiments, 1h, 1.5h, 2h, and 3h were selected in the early stage. It was found that the decoction of 2h and 3h had similar effects on improving cell inflammation (macrophages, LPS stimulation, detection indicators: TNF-α, IL-6), and the efficacy was similar. Therefore, in the embodiments, 2h decoction is preferred.

[0035] High-moisture environments are prone to bacterial and mold growth. Concentration reduces the water content of the drug solution, extending its shelf life at room temperature or under refrigeration. Furthermore, some active ingredients (such as glycosides and alkaloids) are more stable in low-moisture environments, which can slow down oxidation or hydrolysis reactions. Therefore, concentration is required in step (1).

[0036] In one or more embodiments of the present invention, in step (2), differential ultra-high speed centrifugation is used for centrifugation. Specifically: during the process of obtaining the supernatant from the Danshen-Gegen decoction in step (1) by centrifugation, the supernatant is centrifuged at 1000g for 5-15min. Further, the supernatant obtained by centrifugation is centrifuged sequentially at 2000g for 15-25min, at 3000g for 25-35min, and at 10000g for 50-70min to obtain the pre-treated supernatant. Multiple centrifugations are used to remove impurities step by step according to particle size.

[0037] In one or more embodiments of the present invention, both steps (2) and (3) are performed under low temperature conditions, namely 3-8°C. The low temperature can effectively preserve the activity of the components extracted from the decoction.

[0038] In one or more embodiments of the present invention, in step (3), ultra-high speed centrifugation is used, centrifuging at 150000g for 80-100min.

[0039] Secondly, the present invention provides a pharmaceutical composition whose active ingredient comprises the tanshinone-pueraria vesicle-like nanoparticles described in the above-mentioned applications.

[0040] Preferably, it also includes pharmaceutically acceptable carriers or excipients.

[0041] Thirdly, the present invention provides a pharmaceutical preparation comprising the tanshinone-pueraria vesicle-like nanoparticles described in the above-mentioned applications.

[0042] Preferably, it also includes pharmaceutically acceptable carriers or excipients.

[0043] The pharmaceutical preparation is an oral or injectable preparation, and the oral preparation includes one of tablets, capsules, solutions, or suspensions.

[0044] The carriers used in the pharmaceutical compositions of the present invention are common carriers available in the pharmaceutical field, including: binders, lubricants, disintegrants, solubilizers, diluents, stabilizers, suspending agents, colorants, and flavoring agents for oral formulations.

[0045] Fourthly, the present invention provides a method for preventing and / or treating abdominal aortic aneurysms, the method comprising administering to a subject a therapeutically effective dose of the above-mentioned Danshen-Pueraria vesicle-like nanoparticles, the above-mentioned pharmaceutical composition, or the above-mentioned pharmaceutical preparation.

[0046] The subject refers to an animal that is already being treated, observed, or experimented on, preferably a mammal, and most preferably a human. "Therapeutic effective dose" refers to the amount that leads to improvement in any parameter or clinical symptom. The actual dose may vary from patient to patient and does not necessarily refer to the total amount that eliminates all disease symptoms; it can be determined using methods known in the art.

[0047] One or more of the above technical solutions have the following advantages or beneficial effects:

[0048] (1) When the vesicle-like nanoparticles of the Danshen-Ge Gen decoction prepared in this invention are applied to the treatment of abdominal aortic aneurysm, they can significantly alleviate the thickening of the blood vessel wall, reduce the infiltrative cells of the arterial media and adventitia, improve the reduction and breakage of elastic fibers in the blood vessel wall, increase the extensibility of elastic fibers in the blood vessel wall, reduce the content of tissue muscle fibers and collagen fibers, reduce the degree of collagen fiber fibrosis, significantly improve the pathological changes of the mouse abdominal aorta induced by Ang II, and are safe and non-toxic.

[0049] (2) The present invention uses differential ultra-high speed centrifugation to extract and purify vesicle-like nanoparticles from the decoction of Danshen-Kudzu. This method is simple to operate, does not require special equipment, is green and pollution-free, and can extract a large amount of Danshen-Kudzu (with an extraction rate of 55 mg / mL and a purity close to 100%) and its vesicle-like nanoparticles.

[0050] (3) The vesicle-like nanoparticles of Salvia miltiorrhiza and Pueraria lobata extracted by the method provided in this invention were characterized to have an average particle size of 88 nm. Furthermore, the nanoparticles were observed to be mostly nearly spherical or elliptical membrane vesicles with a size between 60 and 120 nm under a transmission electron microscope. Compared with fresh SPVLNs, SPVLNs stored at -20℃ for 3 months did not show significant changes in particle size and potential characteristics, demonstrating good stability.

[0051] (4) The present invention performed lipid and mRNA sequencing on the extracted Tanshinone-Pueraria vesicle-like nanoparticles to clarify the specific components and contents of the Tanshinone-Pueraria vesicle-like nanoparticles. The main components of lipid compounds in SPVLNs include: glycerides (TG, DG, etc.), sphingolipids (Cer, etc.), and glycerophospholipids (PC, PE, PG, etc.): among which, SPH accounted for 39.61%, WE accounted for 24.202%, and PG accounted for 17.216%. SPVLNs contain a variety of microRNAs (miRNAs), with 40 types having an expression level >50. Among them, the miRNA with the highest expression level is gma-miR6300, accounting for 17%, followed by ptc-miR6478, which accounts for 4%.

[0052] (5) The present invention evaluated the safety of the extracted tanshinone-pueraria vesicle-like nanoparticles and confirmed that SPVLNs have good blood compatibility through hemolysis test results.

[0053] (6) The vesicle-like nanoparticles of the Danshen-Pueraria decoction prepared in this invention have aortic targeting properties. By comparing the drug distribution characteristics after oral and intravenous administration through in vivo fluorescence imaging in small animals, it can be seen that the drug targeting properties are high. Oral administration is conducive to maintaining the local drug concentration in the aorta (12h is optimal), while intravenous injection highlights the dynamic distribution of blood vessels and the accumulation characteristics in the liver, which provides a reference for optimizing the drug administration strategy.

[0054] (7) Compared with the vesicular nanoparticles (SVLNs) extracted from the decoction of Salvia miltiorrhiza and the vesicular nanoparticles (PVLNs) extracted from the decoction of Pueraria lobata, in vitro, the results showed that the Salvia miltiorrhiza-Pueraria lobata vesicular nanoparticles (SPVLNs) had a synergistic anti-inflammatory effect, and its effect was significantly better than that of the individual Salvia miltiorrhiza vesicular nanoparticles (SVLNs) and the individual Pueraria lobata vesicular nanoparticles (PVLNs). Attached Figure Description

[0055] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0056] Figure 1 This invention relates to the extraction and identification of SPVLNs; wherein, A is a flowchart of the gradient centrifugation method for extracting SPVLNs; B shows the particle size, potential, and particle concentration of SPVLNs; and C is a transmission electron microscope image of SPVLNs.

[0057] Figure 2The diagram shows the identification of lipid compounds in SPVLNs; where A is a percentage chart of lipid compounds in SPVLNs; and B is a bar chart of the content of different types of lipid compounds in SPVLNs.

[0058] Figure 3 The images show the identification of miRNAs in SPVLNs; where A is an agarose gel electrophoresis image of RNA in SPVLNs; and B is a percentage image of miRNA species in SPVLNs.

[0059] Figure 4 For the hemolysis experiment of SPVLNs; where A is a picture of the actual sample in the hemolysis experiment; B is a data comparison chart of the hemolysis experiment;

[0060] Figure 5 For SPVLNs in ApoE - / - Fluorescence distribution in the mouse aorta;

[0061] Figure 6 For SPVLNs in ApoE - / - Fluorescence distribution in mouse liver, spleen, lungs, and kidneys;

[0062] Figure 7 For ApoE - / - Morphological features of the mouse abdominal aorta; where A represents ApoE. - / - A) shows the dilation of the AAA in mice; B) shows the morphology and quantification of the inhibition of abdominal aortic aneurysm by Danshen-Pueraria and its vesicle-like nanoparticles; C) shows the diameter of the abdominal aorta detected by echocardiography in small animals and its quantification.

[0063] Figure 8 Improve ApoE for SP and SPVLNs - / - Changes in the fibrous structure of the mouse abdominal aorta; where A represents ApoE. - / - Mouse abdominal aortic histological staining, scale bar at 200 micrometers; B represents ApoE. - / - Mouse abdominal aorta H&E staining quantification; C represents ApoE. - / - VVG staining quantification of mouse abdominal aorta; D represents ApoE. - / - Masson staining quantification of mouse abdominal aorta; E represents ApoE. - / - Quantification of SiriusRed staining in mouse abdominal aorta;

[0064] Figure 9 In vitro anti-inflammatory experiments were conducted on vesicular nanoparticles (SVLNs) of Salvia miltiorrhiza, vesicular nanoparticles (PVLNs) of Pueraria lobata, and vesicular nanoparticles (SPVLNs) of Salvia miltiorrhiza and Pueraria lobata. Among them, A was the detection of the anti-inflammatory factor TNF-α, and B was the detection of the anti-inflammatory factor IL-6.

[0065] Figure 10This is the adapter structure for the miRNA library. Detailed Implementation

[0066] Explanation of terms involved:

[0067] SP: Salvia miltiorrhiza-Pueraria lobatadecoction.

[0068] NPs: Nanoparticles.

[0069] VLNs: Vesicle-like nanoparticles.

[0070] SPVLNs: Salvia miltiorrhiza-Pueraria lobatadecoction Vesicle-like anoparticles.

[0071] SVLNs: Vesicle-like nanoparticles of Salvia miltiorrhiza.

[0072] PVLNs: Kudzu vesicle-like nanoparticles.

[0073] TG: Triglycerides.

[0074] DG: diglyceride.

[0075] Cer: Ceramide.

[0076] PC: Phosphatidylcholine.

[0077] PE: Phosphatidylethanolamine.

[0078] PG: Phosphatidylglycerol.

[0079] SPH: Sphingomyelin.

[0080] WE: Neutral lipids.

[0081] SPVLNsi.g.: Gavage or oral administration.

[0082] SPVLNsi.v.: Tail vein injection.

[0083] This invention provides a method for extracting vesicular nanoparticles from a decoction of *Salvia miltiorrhiza* and *Pueraria lobata*. The extracted vesicular nanoparticles are further investigated for their composition, targeting properties, and application in the preparation of drugs for treating abdominal aortic aneurysms. Experiments have shown that the vesicular nanoparticles obtained from the decoction of *Salvia miltiorrhiza* and *Pueraria lobata* have a significant therapeutic effect on abdominal aortic aneurysms and are safe and non-toxic, making them suitable for the preparation of drugs for the prevention and treatment of abdominal aortic aneurysms.

[0084] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.

[0085] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0086] Experimental reagents and instruments:

[0087] Experimental reagents and consumables: Salvia miltiorrhiza slices (batch number: 240100791, Kangmei Pharmaceutical Co., Ltd.), Pueraria lobata slices (batch number: 240100109, Kangmei Pharmaceutical Co., Ltd.), 25PC Thick-walled Tube, 3% Uranium acetate, agarose, ethidium bromide, ACQUITY UPLC CSH C18 reverse-phase column (packed with C18 bonded phase spherical silica particles with a particle size of 1.7 μm and a pore size of 130 Å), acetonitrile, isopropanol, methanol, QIAseq® miRNA Library Kit, NR1 cuvette (Guangding Biotechnology Co., Ltd., a dedicated accessory for Thermo Fisher NanoDrop One / OneC ultra-micro spectrophotometer, full name "NanoDrop One Cuvette Cartridge"), Nuclease-free Water, VAHTS DNAClean Beads, 4% paraformaldehyde, angiotensin II, ALZET Osmotic Pumps micro-osmotic pumps, Masson staining kits (Beijing Solarbio Science & Technology Co., Ltd., G1340), HE staining kits (Beijing Solarbio Science & Technology Co., Ltd., G1120), VVG staining kits (Shanghai Maokang Biotechnology Co., Ltd., MM1033), Oil Red O staining kits (Beijing Solarbio Science & Technology Co., Ltd., G1261), pipettes, disposable pipette tips, ApoE - / - (Male, 6 weeks old, 20-25g, purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd.)

[0088] Experimental instruments: electronic balance, rotary evaporator, transmission electron microscope, low-temperature high-speed centrifuge, low-temperature ultracentrifuge, nano-Coulter particle size analyzer, ultra-high performance liquid chromatograph, Q-Exactive Plus mass spectrometer, biosafety cabinet, Quantus Fluorometer, fully automated nucleic acid and protein analysis system, PCR instrument, ultraviolet spectrophotometer, small animal in vivo three-dimensional imaging system, high-frequency small animal ultrasound imaging system, electronic balance, -80℃ freezer, biological tissue slicer, cryostat, panoramic tissue scanner, gas anesthesia machine.

[0089] Example 1

[0090] Preparation of Danshen-Ge Gen decoction:

[0091] Take 500g of Salvia miltiorrhiza slices and 500g of Pueraria lobata slices, add 10 times the amount of distilled water, decoct for 2 hours (in boiling water), and filter. Add another 10 times the amount of distilled water to the dregs, decoct for 2 hours, and filter. Add another 10 times the amount of distilled water to the dregs, decoct for 2 hours, and filter. Combine the three decoctions, concentrate to 1.5L, and store at -20℃ for later use.

[0092] Separation and extraction of vesicle-like nanoparticles from Salvia miltiorrhiza and Pueraria lobata:

[0093] Take 220 mL of Danshen-Pueraria decoction, (1) centrifuge at 1000 g for 10 min at 4 °C using a low-temperature high-speed centrifuge; take the supernatant and centrifuge at 2000 g for 20 min; take the supernatant and centrifuge at 3000 g for 30 min; take the supernatant and centrifuge at 10000 g for 60 min to obtain the pretreatment supernatant; (2) place the pretreatment supernatant in a centrifuge tube for an ultracentrifuge and centrifuge at 150000 g for 90 min at 4 °C using a low-temperature ultracentrifuge. Discard the supernatant, resuspend the precipitate with 1.5 mL of sterile PBS, filter (0.22 μm) to obtain SPVLNs (the extraction rate is 55 mg / mL, and the purity is close to 100%). Use fresh or store at -80 °C until reuse.

[0094] Comparative Example 1

[0095] Preparation of Danshen decoction:

[0096] Take 500g of Salvia miltiorrhiza slices, add 10 times the amount of distilled water, decoct for 2 hours (in boiling water), and filter. Add another 10 times the amount of distilled water to the dregs, decoct for 2 hours, and filter. Add another 10 times the amount of distilled water to the dregs, decoct for 2 hours, and filter. Combine the three decoctions, concentrate to 1.5L, and store at -20℃ for later use.

[0097] Separation and extraction of vesicle-like nanoparticles from Salvia miltiorrhiza:

[0098] Take 220 mL of Danshen decoction, (1) centrifuge at 1000 g for 10 min at 4 °C using a low-temperature high-speed centrifuge; take the supernatant and centrifuge at 2000 g for 20 min; take the supernatant and centrifuge at 3000 g for 30 min; take the supernatant and centrifuge at 10000 g for 60 min to obtain the pretreatment supernatant; (2) place the pretreatment supernatant in a centrifuge tube for an ultracentrifuge and centrifuge at 150000 g for 90 min at 4 °C using a low-temperature ultracentrifuge. Discard the supernatant, resuspend the precipitate with 1.5 mL of sterile PBS, filter (0.22 μm) to obtain Danshen vesicle-like nanoparticles.

[0099] Comparative Example 2

[0100] Preparation of kudzu root decoction:

[0101] Take 500g of kudzu root slices, add 10 times the amount of distilled water, and decoct for 2 hours (boiling water only), then filter. Add another 10 times the amount of distilled water to the dregs, decoct for 2 hours, and filter again. Combine the three decoctions, concentrate to 1.5L, and store at -20℃ for later use. Separation and extraction of kudzu root vesicle-like nanoparticles:

[0102] Take 220 mL of kudzu root decoction, (1) centrifuge at 1000 g for 10 min at 4 °C using a low-temperature high-speed centrifuge; take the supernatant and centrifuge at 2000 g for 20 min; take the supernatant and centrifuge at 3000 g for 30 min; take the supernatant and centrifuge at 10000 g for 60 min to obtain the pretreatment supernatant; (2) place the pretreatment supernatant in a centrifuge tube for an ultracentrifuge and centrifuge at 150000 g for 90 min at 4 °C using a low-temperature ultracentrifuge. Discard the supernatant, resuspend the precipitate with 1.5 mL of sterile PBS, filter (0.22 μm) to obtain kudzu root vesicle-like nanoparticles.

[0103] Example 2

[0104] Morphological characterization was performed on the vesicle-like nanoparticles of Salvia miltiorrhiza and Pueraria lobata extracted in Example 1.

[0105] RPS determination of vesicular nanoparticles of Salvia miltiorrhiza and Pueraria lobata:

[0106] According to the instrument testing operation guide, after the instrument system is clean and free of particulate contamination, the SPVLNs are diluted 3000 times with PBS to the optimal detection range. 200 μL of the test solution is added to the sample slot of the test card. Using a NanoCoulter counter equipped with a nanoporous chip with a measurement range of 60-200 nm, the concentration, particle size distribution, and zeta potential of the SPVLNs sample are detected and calculated using NanoCoulter software.

[0107] TEM observation of vesicle-like nanoparticles from Salvia miltiorrhiza and Pueraria lobata:

[0108] The size and morphology of SPVLNs were detected by transmission electron microscopy. SPVLNs were deposited on a carbon-coated copper grid and fixed with 3% uranium acetate negative stain for 1–10 min. After being blotted dry with filter paper and air-dried at room temperature, they were imaged by transmission electron microscopy at an accelerating voltage of 80 kV.

[0109] Example 3

[0110] The components of the vesicle-like nanoparticles of Salvia miltiorrhiza and Pueraria lobata extracted in Example 1 were analyzed.

[0111] 1. Lipid composition analysis

[0112] 1) Sample preprocessing methods

[0113] Take an appropriate amount of sample, add 200L of water, vortex at MP, add 800μL of MTBE, vortex mix, add 240μL of pre-cooled methanol, vortex mix, sonicate in a low-temperature water bath for 20min, place at room temperature for 30min, centrifuge at 14000g at 10℃ for 15min, take the upper organic phase, blow dry with nitrogen, add 200μL of 90% isopropanol acetonitrile solution to reconstitute before mass spectrometry analysis, vortex thoroughly, take 90mL of the reconstituted solution, centrifuge at 14000g at 10℃ for 15min, take the supernatant for analysis.

[0114] 2) Chromatography-mass spectrometry analysis

[0115] A. Chromatographic conditions

[0116] Samples were separated using a UHPLC NexeraL C-30A ultra-high performance liquid chromatography system. A C18 column was used with a column temperature of 45℃ and a flow rate of 300 μL / min. The mobile phase composition was: A: acetonitrile aqueous solution (acetonitrile:water = 6:4, v / v) + 0.1% formic acid + 0.1 mM ammonium formate; B: acetonitrile isopropanol solution (acetonitrile:isopropanol = 1:9, v / v) + 0.1% formic acid + 0.1 mM ammonium formate. The gradient elution program was as follows: 0-3.5 min, B maintained at 40%; 3.5-13 min, B linearly changed from 40% to 75%; 13-19 min, B linearly changed from 75% to 99%; 19-24 min, B maintained at 40%. Throughout the analysis, samples were placed in an autosampler at 10℃. To avoid the influence of instrument signal fluctuations, samples were analyzed sequentially using a randomized order.

[0117] B. Mass Spectrometry Conditions

[0118] Electrospray ionization (ESI) in both positive and negative ion modes was used for detection. Samples were separated by UHPLC and then analyzed by mass spectrometry using a QExactive series mass spectrometer (Thermo Scientificr M). ESI source conditions were as follows: Heater Temp 300°C, Sheath Gas Flow Rate 45 arb, Aux Gas Flow Rate 15 arb, Sweep Gas Flow Rate 1 lb, spray voltage 3.0 kV, Capillary Temp 350°C, S-Lens RF Level 50%. MS1 scan ranges: 200-1800. Mass-charge ratio of lipid molecules and lipid fragments was collected using the following method: 10 fragment spectra were acquired after each full scan (fμL lscan) (MS2 scan, HCD). MS1 resolution was 70,000 at M / Z 200, and MS2 resolution was 17,500 at M / Z 200.

[0119] C. Data Analysis Process

[0120] LipidSearch was used for peak identification, peak extraction, and lipid identification (secondary identification) of lipid molecules and internal standard lipid molecules. The main parameters were: predictor tolerance: 5 ppm, product tolerance: 5 ppm, and production threshold: 5%. The data extracted by LipidSearch were first subjected to quality evaluation before data analysis.

[0121] 2. RNA agarose gel electrophoresis

[0122] 1) Preparation of agarose gel: Weigh 0.5g of agarose and place it in a clean 100mL Erlenmeyer flask. Add 40mL of distilled water and heat in a microwave oven until the agarose is completely dissolved and homogeneous. Once the gel has cooled to 60-70℃, add 9mL of formaldehyde, 5mL of 10×MOPS buffer, and 0.5μL of ethidium bromide sequentially, mixing thoroughly. Pour the mixture into agarose gel and add 1×TAE electrophoresis buffer until the surface is covered.

[0123] 2) Sample Preparation: Take a 500 μL centrifuge tube treated with DEPC and add the following reagents in sequence: 2 μL 10×MOPS buffer, 3.5 μL formaldehyde, 10 μL formamide (deionized), and 4.5 μL RNA sample. Mix well. Place the centrifuge tube in a 60℃ water bath for 10 minutes, then place it on ice for 2 minutes. Add 3 μL of sample dye to the tube and mix well.

[0124] 3) Sample loading: On the clean bench, use a pipette to transfer 4 μL of total RNA sample onto the sealing film. Add 5 μL of 1×TAE electrophoresis buffer and 1 μL of 10× sample loading buffer to the workbench, mix well, and carefully add to the sample well.

[0125] 4) Electrophoresis: Turn on the power switch and adjust the voltage to 100V to allow RNA to migrate from the negative electrode to the positive electrode. After about 30 minutes, immerse the gel in EB staining solution for 5 minutes, and rinse slightly with water. Observe the RNA electrophoresis results on a UV transilluminator.

[0126] 3. microRNA sequencing

[0127] 1) Experimental Procedure

[0128] RNA extraction

[0129] 1. Add 700 μL of RNA lysis buffer to SPVLNs and incubate at room temperature for 5 min.

[0130] 2. Add 140 μL of chloroform and vortex mix for 15 seconds.

[0131] 3. Incubate at room temperature for 3 minutes, then centrifuge at 12000g for 15 minutes at 4°C (pre-cool the centrifuge beforehand, and immediately return it to room temperature after this step).

[0132] 4. Transfer the upper aqueous phase to a new EP tube (avoid aspirating the middle layer), add 1.5 times the volume of anhydrous ethanol (usually 525µL), and mix by pipetting.

[0133] 5. Take 700µL of the mixture (including all precipitates), transfer it to an RNeasy adsorption column, centrifuge at 8000g for 15s at room temperature, discard the filtrate (reuse the collection tube, the same below), and repeat the same step for the remaining mixture.

[0134] 6. Add 700 μL of Buffer RWT to wash the adsorption column, centrifuge at 8000g for 15s at room temperature, and discard the filtrate.

[0135] 7. Add 500 μL of Buffer RPE to wash the adsorption column, centrifuge at 8000g for 15s at room temperature, and discard the filtrate.

[0136] 8. Add 500 μL of Buffer RPE to wash the adsorption column, centrifuge at 8000g for 2 min at room temperature, and discard the filtrate and collection tube (carefully remove the column to avoid touching the filtrate and residual alcohol).

[0137] 9. Transfer the adsorption column to a new 2mL centrifuge tube (self-provided), centrifuge at 12000g for 1min to dry, and discard the filtrate and collection tube.

[0138] 10. Transfer the adsorption column to a new 1.5 mL centrifuge tube, add 30 μL of RNase-free water to the middle of the adsorption membrane, centrifuge at 8000g for 1 min, and elute the RNA.

[0139] 11. Immediately transfer to a -80°C freezer for storage.

[0140] RNA concentration measurement

[0141] Take 1 μL of each extracted RNA sample, stain it, and measure the RNA concentration using a Quantus Fluorometer.

[0142] RNAQsep100 detection

[0143] Based on the RNA concentration, take an appropriate amount of the RNA stock solution and dilute it with the diluent provided with the NR1 card holder. After dilution, perform the analysis on the instrument.

[0144] 3' Adaptor connector connection

[0145] Prepare the following reaction system in a PCR tube:

[0146] Table 1

[0147]

[0148] After mixing, perform the following reaction in a PCR instrument:

[0149] Table 2

[0150]

[0151] Proceed to the next step immediately after the reaction is complete.

[0152] 5' Adaptor Connector

[0153] Add the following reaction mixture to each PCR tube in the upstream reaction:

[0154] Table 3

[0155]

[0156] After mixing, perform the following reaction in a PCR instrument:

[0157] Table 4

[0158]

[0159] Proceed to the next step immediately after the reaction is complete.

[0160] cDNA synthesis

[0161] Add the following reaction mixture to each PCR tube in the upstream reaction:

[0162] Table 5

[0163]

[0164] After mixing, perform the following reaction in a PCR instrument:

[0165] Table 6

[0166]

[0167] After the above reaction is completed, add the following reaction mixture to each PCR tube:

[0168] Table 7

[0169]

[0170] After mixing, perform the following reaction in a PCR instrument:

[0171] Table 8

[0172]

[0173] cDNA purification:

[0174] 1. Add 143 μL of QMNBeads to the reverse transcription product, vortex for 3 seconds, briefly centrifuge, and incubate at room temperature for 5 minutes.

[0175] 2. After centrifugation, place the product on a magnetic rack and carefully remove the supernatant after the magnetic beads have been completely attracted.

[0176] 3. Add 200µL of freshly prepared 80% ethanol, being careful not to disturb the magnetic beads, and immediately and carefully remove the supernatant. Repeat once.

[0177] 4. Remove all residual liquid and leave the lid open to dry for 10 minutes.

[0178] 5. Remove the centrifuge tube, add 17µL NF-Water to cover the magnetic beads, mix well by pipetting, and incubate at room temperature for 2 minutes.

[0179] 6. After a brief centrifugation, place the centrifuge tube on a magnetic rack. Once the magnetic beads have completely adsorbed, carefully transfer 15µL of supernatant to a new centrifuge tube. This is the purified cDNA, which can be stored at -20°C.

[0180] Library expansion

[0181] Prepare the following reaction system in a PCR tube:

[0182] Table 9

[0183]

[0184] After mixing, perform the following reaction in a PCR instrument:

[0185] Table 10

[0186]

[0187] After the reaction is complete, remove the sample and perform library sorting or store it at -20°C.

[0188] Document Selection

[0189] 1. Take 75 μL of amplification product and add 75 μL of QMNBeads, vortex mix for 3 seconds, briefly centrifuge, and incubate at room temperature for 5 minutes.

[0190] 2. After centrifugation, place the tube on a magnetic rack and wait for the magnetic beads to be completely adsorbed before transferring 145 μL of supernatant to a new centrifuge tube.

[0191] 3. Take 130 μL of QMNBeads and vortex with the supernatant for 3 seconds, then briefly centrifuge and incubate at room temperature for 5 minutes.

[0192] 4. After centrifugation, place the product on a magnetic rack and carefully remove the supernatant after the magnetic beads have been completely attracted.

[0193] 5. Add 200µL of freshly prepared 80% ethanol, being careful not to disturb the magnetic beads, and immediately and carefully remove the supernatant. Repeat once.

[0194] 6. Remove all residual liquid and leave the lid open to dry for 10 minutes.

[0195] 7. Remove the centrifuge tube, add 17µL of NF-Water to cover the magnetic beads, mix well by pipetting, and incubate at room temperature for 2 minutes.

[0196] 8. After a brief centrifugation, place the centrifuge tube on a magnetic rack. Once the magnetic beads are fully adsorbed, carefully transfer 15µL of supernatant to a new centrifuge tube to obtain the miRNA library.

[0197] 9. Take an appropriate amount of miRNA library to detect its concentration and fragment size, and store the remainder at -20℃.

[0198] miRNA library adapter

[0199] Referring to the instruction manual, the miRNA library adapter structure is as follows: Figure 10 As shown, the connector sequence is AACTGTAGGCACCATCAATNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, as detailed below:

[0200] The sequence of the miRNA is shown in SEQ ID NO.1: TAGCTTATCAGACTGATGTTGA;

[0201] The sequence of the Qiagen adapter is shown in SEQ ID NO.2: AACTGTAGGCACCATCAAT;

[0202] The sequence of the Illumina adapter sequence is shown in SEQ ID NO.3: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC.

[0203] 2) Data Analysis

[0204] The small RNA sequencing library was sequenced using the PE150 sequencing protocol, and the quality of the sequencing library was evaluated using FastQC. FastP was used for N-base removal from both ends of the sequence, Q20 filtering, and adapter removal. The cleaned sequences were then aligned with the Rfam library using the Bowtie short sequence alignment tool to remove rRNA, tRNA, and other nCRNAs.

[0205] Bowtie was then used to align the small RNA sequences to the genome. For non-model species, the miRbase library did not record their small RNA sequences; therefore, all small RNAs in the miRbase library were used as references to quantitatively analyze possible small RNAs in the samples (plant species compared to all plant species, animal species compared to all animal species, and other species compared to all species). Simultaneously, a literature review was conducted, and miRNAs identified in the miRbase database were merged and retained as a single record based on complete sequence and expression level consistency. Small RNAs were then ID-numbered in descending order of expression level based on sequence uniqueness. The corresponding families of the miRNAs were then located using the miRbase database.

[0206] Example 4

[0207] Safety evaluation of the tanshinone-pueraria vesicle-like nanoparticles (SPVLNs) extracted in Example 1.

[0208] A hemolysis assay was performed to assess the potential impact of SPVLNs on erythrocytes (RBCs) to determine their biocompatibility. The specific experimental method involved injecting 2 mL of blood (from male ApoE cells) into the blood cells. - / -Blood (obtained from mice) was collected in tubes containing sodium heparin. The blood was then centrifuged at 2500 rpm for 5 min, washed three times with physiological saline until the supernatant was colorless, and then diluted 50-fold with physiological saline. 500 μL of erythrocyte suspension and 500 μL of SPVLNs solutions of different concentrations were mixed to prepare final concentrations of 10, 20, 30, 50, and 100 μg / mL. For positive control tubes, 500 μL of H2O was added to 500 μL of erythrocyte suspension. For negative control tubes, 500 μL of erythrocyte suspension was added to 500 μL of physiological saline. All centrifuge tubes were incubated at 37°C for 1 h and 3 h, and their hemolysis was observed and photographed according to grouping. The tubes were then centrifuged at 2500 rpm for 5 min, the supernatant was collected and placed in a 96-well plate, and the absorbance at 541 nm was measured using a microplate reader.

[0209] Example 5 ApoE - / - Construction of a mouse abdominal aortic aneurysm model

[0210] 1. Animal grouping

[0211] 30 six-week-old ApoE - / - Mice were acclimatized for two weeks and then randomly divided into 5 groups (n=6):

[0212] Table 11

[0213]

[0214] 2. Construction of an abdominal aortic aneurysm model

[0215] (1) Twenty-four 8-week-old mice were randomly selected and divided into four groups. After two weeks of high-fat diet intervention, an abdominal aortic aneurysm (AAA) model was established. Before the experiment, surgical instruments and EP tubes and other consumables were sterilized by autoclaving (121℃, 30min). The average body weight of mice in each group was measured using a precision electronic balance (accuracy 0.1mg). The total dose required for each group was calculated according to the Ang II infusion rate of 1.44mg / kg / d × 28d. Referring to the technical parameters of the Alzet micro-release osmotic pump (Model2004, flow rate 0.25μL / h), the theoretical total output in 28 days was 168μL. Considering the operation loss, a 5% margin was added, and the final solution was prepared at 175μL / mouse.

[0216] (2) Preparation of Ang II solution. Accurately weigh the calculated amount of Ang II powder into a sterile EP tube, and add sterile physiological saline to prepare a working concentration solution (the final concentration is calculated based on body weight). Use a 200 μL pipette to accurately measure 175 μL of the solution and inject it into the EP tube. Slowly infuse the solution into the osmotic pump reservoir using a 1 mL sterile syringe, taking care to eliminate gas interference. Place the prepared osmotic pump in sterile physiological saline at 37°C for equilibration for 24 hours before use.

[0217] (3) Surgical implantation procedure. Experimental animals were induced with anesthesia using 2% isoflurane (containing 30% oxygen) and then maintained with inhalation anesthesia using 1.5% isoflurane. They were fixed in a prone position on a temperature-controlled operating table (37℃). After hair removal, the surgical area was disinfected sequentially with 75% ethanol and povidone-iodine. A 1cm longitudinal incision was made along the midline of the neck and back, and the subcutaneous connective tissue was bluntly dissected to form a cyst. An osmotic pump preloaded with Ang II solution or control saline was implanted into the cyst. The incision was closed in layers with 5-0 absorbable sutures, and the animals were housed individually in an SPF-grade environment to recover.

[0218] (4) During the process, mice were continuously fed a high-fat diet. After 28 days of modeling, the mice were euthanized and the aorta, heart, liver, spleen, lungs and kidneys were completely removed. After rinsing three times with PBS buffer (0.1M, pH 7.4), half of the mice were fixed in 10 volumes of 4% paraformaldehyde fixative (4℃, pH 7.4) for 24 hours for histological identification. Half of the mice were stored in specimen bags at -80℃.

[0219] Example 6: Small Animal Ultrasound Imaging

[0220] At 7, 14, 21, and 28 days post-implantation of the micro-release osmotic pump, the abdominal aorta was morphologically assessed using a high-frequency small animal ultrasound imaging system. (1) First, a gas circuit system for the small animal anesthesia machine was established, with the oxygen flow rate set at 1.5 L / min. The evaporator was pre-filled with isoflurane (2% vol induction concentration, 1.2% vol maintenance concentration). The experimental animals were placed in an induction chamber (30×20×15cm). 3 (1) After inhalation anesthesia, the patient was transferred to a constant temperature operating table (37℃) and anesthesia was maintained by a nasal cone device. (2) After removing hair from the chest and abdomen, hair removal cream (Nair™) was applied evenly for 3 minutes, and the skin surface was cleaned with saline. The surgical area was disinfected with 75% ethanol and iodine-containing disinfectant (povidone-iodine) in sequence. (3) The ultrasound system was started and preheated for 15 minutes. A 23-MHz high-frequency linear array probe (X10-23L, VisualSonics) was selected, and the parameters were set as follows: imaging depth 1.2cm, dynamic range 50dB, frame rate 30Hz. Sterile ultrasound coupling agent was applied to the mouse abdomen. The ultrasound probe was held and placed below the xiphoid process of the mouse sternum. The longitudinal section of the descending aorta was identified in two-dimensional mode. The color Doppler mode was switched (speed bar 15cm / s) to confirm the characteristic laminar flow signal. The probe was rotated at the level of the superior mesenteric artery branch to obtain a cross-sectional image. The probe was then moved down to the level of the left renal artery to confirm the abdominal aorta. Returning to the longitudinal axis section, measure the intima-media distance between the anterior and posterior walls of the left renal artery, 1 mm below its lower border. When a fluctuating blood flow signal consistent with the heart rate is detected in color Doppler mode, switch the ultrasound machine to two-dimensional ultrasound mode and measure the maximum diameter of the renal artery in the lower abdominal aorta. The average of three consecutive cardiac cycles is taken as the final result.

[0221] Example 7 Small Animal Fluorescence Imaging Experiment

[0222] Distribution of SPVLNs in AAA model mice: ApoE - / - Mice were randomly divided into a DIO-SPVLNs group (n=18) based on body weight. The mice were fed a high-fat diet for 2 weeks, followed by a high-fat diet combined with Ang II intervention for 4 weeks. After oral and tail vein injection of DIL-SPVLNs, ApoE levels were dynamically observed at 6h, 12h, and 24h. - / - Changes in the distribution of SPVLNs in mice.

[0223] Example 8 Masson staining

[0224] 1. Tissue embedding

[0225] (1) Fixation: The tissue was fixed in 4% paraformaldehyde for at least 24 hours, cut into appropriate sizes, placed in a tissue embedding cassette, and rinsed with running water overnight;

[0226] (2) Dehydration and clearing: Dehydrate the sample by gradient of 50% ethanol for 40 min, 70% ethanol for 40 min, 80% ethanol for 40 min, 95% ethanol for 40 min, anhydrous ethanol I for 1 h, and anhydrous ethanol II for 1 h; then add xylene I for 1 h and xylene II for 1 h until the sample is clear.

[0227] (3) Embedding: Melt the wax at 55-60℃ in advance, soak the soft wax for 1 hour, soak the hard wax for 1 hour, and place it in the embedding box;

[0228] (4) Sectioning: Use a paraffin microtome to cut the embedded tissue into sections with a thickness of 4μm, spread them in warm water, remove the slides and dry them for later use.

[0229] 2. Staining

[0230] (1) Dewaxing: Place the abdominal aortic sections in a 60℃ constant temperature oven for at least 1.5 hours. Then, place the sections in the following order: xylene I for 15 minutes → xylene II for 15 minutes → anhydrous ethanol I for 5 minutes → anhydrous ethanol II for 5 minutes → 95% ethanol for 2 minutes → 85% ethanol for 2 minutes → 75% ethanol for 2 minutes → 50% ethanol for 2 minutes → distilled water for 2 minutes → PBS for 5 minutes × 3 times. It should be noted that xylene I and xylene II are the same reagents, and each reagent is placed for 15 minutes in turn. The same applies to anhydrous ethanol I and anhydrous ethanol II.

[0231] (2) Stain with the prepared Weigert iron hematoxylin solution for 5 min; differentiate with differentiation solution for 5-15 s, then wash with water;

[0232] (3) Stain with Ponceau red and magenta solution for 3 min, then wash with weak acid working solution for 1 min;

[0233] (4) Wash with phosphomolybdic acid solution for 1 min, then wash with weak acid working solution for 1 min; stain with aniline blue solution for 1.5 min, then wash with weak acid working solution for 1 min.

[0234] (5) Dehydration and clearing mounting: Place the slides in 95% ethanol for 1 min, anhydrous ethanol I for 1 min, anhydrous ethanol II for 1 min, xylene I for 1 min, xylene II for 1 min, and then mount with neutral resin.

[0235] Example 9 HE staining

[0236] (1) Dewaxing: Same as step 2 in Example 8;

[0237] (2) Hematoxylin staining: stain with hematoxylin dye for 3 min, rinse with tap water; differentiate with differentiation solution for 30 s, rinse with tap water;

[0238] (3) Eosin staining: Stain with eosin dye for 2 min;

[0239] (4) Dehydrated transparent sealing film.

[0240] Example 10 VVG staining

[0241] (1) Dewaxing: Same as step 2 in Example 8;

[0242] (2) Dewax the paraffin sections to water using conventional methods. Place the sections into a staining vat containing the prepared complete Verhǒeff staining solution and immerse for 15-30 minutes until the color turns dark black. Rinse quickly with running water to remove excess staining solution.

[0243] (3) Use Verhǒeff differentiation solution to differentiate for a few seconds until the elastic fibers are clear, then rinse thoroughly with running water.

[0244] (4) Quickly rinse with 95% ethanol to remove iodine.

[0245] (5) Rinse with running water for 2-3 minutes.

[0246] (6) Place the slices in a 5% sodium thiosulfate solution for 3 minutes.

[0247] (7) Rinse thoroughly with running water and then rinse with distilled water.

[0248] (8) Counterstain with VG staining solution for 30 seconds, and blot away any excess staining solution.

[0249] (9) Rapid differentiation with 95% ethanol.

[0250] (10) Dehydrated transparent sealing film.

[0251] Example 11 Sirius Red Staining

[0252] (1) Dewaxing: Same as step 2 in Example 8;

[0253] (2) Prepare iron hematoxylin staining solution before use, add staining solution for 5-10 minutes, wash with distilled water for 10-20 seconds to remove excess staining solution, wash with tap water to return to blue for 5-10 minutes, and wash with distilled water 3 times, each time for 5-10 seconds.

[0254] (3) Stain with Sirius red staining solution for 10-15 minutes. For tissues that are easier to stain, the staining time can be controlled within 5-10 minutes. Rinse the sections quickly with distilled water to remove excess staining solution.

[0255] (4) Dehydrated transparent sealing film.

[0256] Example 12 In vitro experiment

[0257] The Salvia miltiorrhiza and Pueraria lobata vesicle-like nanoparticles (SPVLNs) prepared in Example 1, and the Salvia miltiorrhiza vesicle-like nanoparticles (SVLNs) and Pueraria lobata vesicle-like nanoparticles (PVLNs) prepared in Comparative Examples 1 and 2 were subjected to in vitro anti-inflammatory experiments. The specific experimental steps are as follows:

[0258] To compare the anti-inflammatory effects of the three vesicle-like nanoparticles, RAW264.7 cell suspensions were mixed at 5 × 10⁻⁶. 3 / wells were seeded at a density of / wells in 96-well plates. When the confluence of RAW264.7 cells was about 80%, 10 μg / mL LPS was added for stimulation for 12 h. Subsequently, the cells were divided into 5 groups: (1) control group (2) model group (3) 20 μg / mL SVLNs group (4) 20 μg / mL PVLNs group (5) 20 μg / mL SPVLNs group.

[0259] After 24 h of treatment, the supernatant was collected from each group of cells. The levels of TNF-α and IL-6 in the supernatant were detected according to the detection procedure of the ELISA kit.

[0260] Experimental results:

[0261] 1. Extraction and identification of vesicle-like nanoparticles from Salvia miltiorrhiza and Pueraria lobata

[0262] like Figure 1 As shown in A, this experiment used gradient centrifugation to separate and purify nanoparticles (NPs) from the Salvia miltiorrhiza-Pueraria lobata decoction (SP). The average particle size of the NPs, as determined by a nanocoulter particle size analyzer, was 88 nm. Figure 1As shown in B; and under a transmission electron microscope, the NPs were observed to be mostly nearly round or elliptical membrane vesicles, with a size between 60-120 nm, such as Figure 1 As shown in C in the figure. These characterization results fully demonstrate that the isolated NPs conform to the recognized characteristics of vesicle-like anoparticles (VLNs), indicating that the method successfully extracted Salvia miltiorrhiza-Pueraria lobatadecoction vesicle-like anoparticles (SPVLNs) from SP. It is worth noting that compared with fresh SPVLNs, SPVLNs stored at -20℃ for 3 months did not show significant changes in particle size and potential characteristics, exhibiting good stability, such as Figure 1 As shown in B in the diagram.

[0263] 2. Compositional analysis of vesicle-like nanoparticles from Salvia miltiorrhiza and Pueraria lobata:

[0264] Identification and analysis of lipid compounds:

[0265] like Figure 2 As shown, the main lipid compounds in SPVLNs are: glycerides (TG, DG, etc.), sphingolipids (Cer, etc.), and glycerophospholipids (PC, PE, PG, etc.): among which SPH accounts for 39.61%, WE accounts for 24.202%, and PG accounts for 17.216%.

[0266] AcCa: Acetylcarnitine. Cer: Ceramide. CerP: Ceramide phosphate. CL: Cardiolipin. DG: Diacylglycerol. DGDG: Digalactosyldiacylglycerol. DGMG: Digalactosylmonoacylglycerol. GM3: Monosialotetrahexosylganglioside. Hex1Cer: Monosaccharide-ceramide. Hex2Cer: Disaccharide-ceramide. LPC: Lysophosphatidylcholine. LPE: Lysophosphatidylethanolamine. LPG: Lysophosphatidylglycerol. LPI: Lysophosphatidylinositol. MG: Monoglyceride. MGDG: Monogalactosyldiacylglycerol. MGMG: Monogalactosylmonoacylglycerol. OAHFA: Esterified ω-hydroxy fatty acid. PC: Phosphatidylcholine. PE: Phosphatidylethanolamine. PG: Phosphatidylglycerol. phSM: Phosphorylated sphingomyelin. PI: Phosphatidylinositol. PS: Phosphatidylserine. SM: Sphingomyelin. SPH: Sphingosine. SQDG: Sulfoquinovosyl Diacylglycerol. ST: Sterol ester. TG: Triglyceride.WE: Wax ester.

[0267] microRNA component identification and analysis:

[0268] like Figure 3 As shown: SPVLNs contain a variety of microRNAs (miRNAs), with 40 of them having an expression level >50. Among them, the miRNA with the highest expression level is gma-miR6300, accounting for 17%, followed by ptc-miR6478, which accounts for 4%.

[0269] 3. Safety evaluation of Danshen-Pueraria vesicle-like nanoparticles:

[0270] The results of the hemolysis test are as follows Figure 4 As shown. A comparison between the experimental group nanocarriers and the positive control group showed no significant rupture of red blood cells, indicating good blood compatibility of SPVLNs. p <0.0001). Specifically, there was no significant change in hemolysis absorbance at different concentrations of SPVLNs at 1h and 3h. The hemolysis experiment results confirmed that SPVLNs have good blood compatibility.

[0271] 4. Targeted drug delivery effect of Danshen-Pueraria vesicle-like nanoparticles

[0272] Figure 5 To observe DIL-SPVLNs in ApoE using in vivo fluorescence imaging in small animals - / - Distribution in the mouse aorta. Figure 6 To observe DIL-SPVLNs in ApoE using in vivo fluorescence imaging in small animals - / - Distribution of these organs in mice.

[0273] This study compared the drug distribution characteristics after oral and intravenous administration using in vivo fluorescence imaging in small animals. In the SPVLNs (ig) group, the fluorescence intensity in the aorta (including the heart) gradually increased from 6 to 12 hours (peaking at 12 hours) and disappeared at 24 hours, indicating diffusion from the intestine to the aorta after absorption. In the SPVLNs (iv) group, the aortic fluorescence was strongest at 6 hours, then decayed and migrated (accumulating in the abdominal aorta at 12 hours and sinking to the iliac artery at 24 hours), reflecting the dynamic distribution of the drug after entering the bloodstream. Figure 5 ).

[0274] Furthermore, in the SPVLNs (ig) group, liver fluorescence was weak at 6 h, increased at 12 h, and decreased at 24 h, possibly related to portal vein absorption and liver metabolism; bilateral kidney fluorescence peaked at 6 h and then decreased with excretion, disappearing at 24 h, indicating that the kidneys are the main excretion route. Liver fluorescence continuously increased over time, weak at 6 h and strongest at 24 h, suggesting continuous uptake by hepatocytes or accumulation of metabolites; renal clearance showed left-right asymmetry, with weak residual fluorescence in the left kidney at 6 h and 24 h, possibly related to anatomical / blood flow differences. Figure 6 The remaining organs in both groups showed no fluorescence.

[0275] At the vascular morphology level, dynamic ultrasound monitoring showed that the intravenous injection group of SPVLNs exhibited the best inhibitory effect on vasodilation. Figure 7 This may be due to the particle size effect and surface charge properties promoting the passive targeted accumulation of drugs in diseased blood vessels.

[0276] In summary, this indicates that the drug has high targeting ability, oral administration is beneficial for maintaining local drug concentration in the aorta (optimal at 12h), while intravenous injection highlights the dynamic distribution in blood vessels and the accumulation characteristics in the liver, providing a reference for optimizing the drug administration strategy.

[0277] 5. Danshen-Pueraria and their vesicle-like nanoparticles inhibit the formation of abdominal aortic aneurysms.

[0278] The therapeutic effects of SP and SPVLNs were evaluated at the animal level. ApoE in each group was examined using ultrasound imaging. - / - Morphological characteristics of the abdominal aorta in mice. Compared with Saline, the Model group showed significant dilation of the abdominal aortic segment ( p =0.0002), such as Figure 7 As shown in B. Different administration methods all resulted in varying degrees of reduction in aortic diameter, with the tail vein injection of SPVLNs showing a significant reduction ( p =0.0126). The analysis of the vessel diameter measurements is consistent with the ultrasound image results, such as... Figure 7 As shown in C.

[0279] 6. Danshen-Pueraria and their vesicle-like nanoparticles improve the fibrous structure of the abdominal aorta in mice.

[0280] ApoE was observed in each group using H&E staining, VVG staining, Masson staining, and SiriusRed staining. - / - Microstructural changes in the abdominal aorta tissue of mice. H&E staining revealed that, compared with the Saline group, the abdominal aortic wall of the Model group mice was significantly thickened, and the number of infiltrating cells in the arterial media was increased. p<0.0001); SP and SPVLNs treatment can improve this phenomenon, as evidenced by the fact that the abdominal aortic wall of mice in the SP, SPVLNs (ig), and SPVLNs (iv) groups is thinner than that in the Model group, the cells are more densely arranged, and there are fewer infiltrating cells in the arterial media. p <0.0001), such as Figure 8 As shown in A and B in the diagram. Iron hematoxylin in the VVG staining solution has a strong adsorption capacity for vascular elastic fibers, and can be used to observe the morphology and changes of vascular elastic fibers. In this experiment, VVG staining results showed that, compared with the Saline group, the Model group mice had significantly fewer elastic fibers in the abdominal aortic wall (…). p <0.0001), reduced extensibility and fracture, and loss of the original concave-convex morphology; while the elastic fibers of the abdominal aortic wall of mice in the SP, SPVLNs (ig), and SPVLNs (iv) groups were similar to those in the Saline group, and significantly increased compared to the Model group. p <0.0001), with increased extensibility and no fracture, still exhibiting an uneven texture, such as Figure 8 As shown in A and C. Masson staining was used to distinguish between muscle fibers and collagen fibers; muscle fibers were stained red while collagen fibers were stained blue. In this experiment, Masson staining revealed that, compared to the Saline group, the collagen fibers in the abdominal aorta of the Model group mice were significantly thicker. p <0.0001), cells were disordered and unevenly distributed, and the content of myofibrils was also increased; while SP, SPVLNs (ig), and SPVLNs (iv) treatment could alleviate this phenomenon. Compared with the Model group, SP ( p <0.0001), SPVLNs (ig) ( p =0.0075), SPVLNs (iv) ( p The mice in the <0.0001) group had fewer collagen and muscle fibers in their abdominal aorta, and the cells were more orderly arranged. Figure 8 As shown in A and D. Furthermore, SiriusRed staining revealed a significant increase in type I, type II, and type IV collagen fibers in the abdominal aorta of mice compared to the Saline group. p <0.0001); while SP ( p =0.0065), SPVLNs (ig) ( p =0.0310), SPVLNs (iv) ( p The type I, type II, and type IV collagen fibers in the abdominal aorta of mice in the group with a ratio of 0.0002 were all reduced compared to the Model group, similar to the Saline group. Figure 8 As shown in A and E in the diagram.

[0281] These pathological staining results indicate that SP, SPVLNs (ig), and SPVLNs (iv) treatment can improve the cellular structural changes in the mouse abdominal aorta induced by Ang II, specifically by alleviating vessel wall thickening, reducing infiltrative cells in the arterial media and adventitia, improving the reduction and breakage of elastic fibers in the vessel wall, increasing the extensibility of elastic fibers in the vessel wall, reducing the content of muscle fibers and collagen fibers in the tissue, and reducing the degree of collagen fiber fibrosis. These findings provide important theoretical basis for developing novel anti-aneurysm strategies based on the synergistic effects of multiple components of traditional Chinese medicine, and also provide methodological reference for the modernization research of traditional Chinese medicine.

[0282] 7. In vitro anti-inflammatory experiment

[0283] In vitro, the anti-inflammatory effects of three vesicle-like nanoparticles were compared. Raw264.7 cells were stimulated with LPS, and then TNF-α in the supernatant was detected using an ELISA kit. Figure 9 (A) and IL-6 (such as) Figure 9 (B in the text). The results showed that the anti-inflammatory effect of Salvia miltiorrhiza and Pueraria lobata vesicle-like nanoparticles (SPVLNs) was significantly better than that of Salvia miltiorrhiza vesicle-like nanoparticles (SVLNs) and Pueraria lobata vesicle-like nanoparticles (PVLNs).

[0284] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Use of Danshen-Gegen vesicle-like nanoparticles in the preparation of a medicament for treating abdominal aortic aneurysm. The average particle size of the Danshen-Gegen vesicle-like nanoparticles is 50-200 nm. The components of the Danshen-Gegen vesicle-like nanoparticles include lipid compounds and microRNAs. The extraction method of Danshen-Gegen vesicle-like nanoparticles comprises the following steps: (1) Preparing Danshen-Gegen decoction liquid: adding water to Danshen and Gegen decoction pieces, decocting, filtering, repeatedly adding water, decocting, filtering, and combining the decoction liquids, and concentrating; (2) Obtaining the supernatant of the Danshen-Gegen decoction liquid in step (1) by centrifugation, and obtaining the pretreated supernatant by multiple centrifugation treatments; (3) Obtaining the precipitate by centrifugation of the pretreated supernatant obtained in step (2) and discarding the supernatant; (4) Resuspending the precipitate obtained in step (3) in sterile PBS, and filtering with a filter membrane to obtain the Danshen-Gegen vesicle-like nanoparticles; In step (1), the decoction liquids of 2-3 times are combined; In step (1), the decoction temperature is 90-110°C, and the decoction time is 0.5-4 h; In step (1), the mass ratio of Danshen decoction pieces to Gegen decoction pieces is (0.9-1.1):(0.9-1.1); In step (1), the amount of water added each time is 8-12 times the total mass of Danshen decoction pieces and Gegen decoction pieces; In step (2), during the process of obtaining the supernatant of the Danshen-Gegen decoction liquid in step (1) by centrifugation, centrifugation is performed at 1000g for 5-15 min; the obtained supernatant is sequentially centrifuged at 2000g for 15-25 min, at 3000g for 25-35 min, and at 10000g for 50-70 min to obtain the pretreated supernatant; In steps (2) and (3), low-temperature conditions are used, and the low temperature is 3-8°C; In step (3), ultra-high-speed centrifugation is used, and centrifugation is performed at 150000g for 80-100 min.

2. Use according to claim 1, characterized in that, The functions of the medicament for treating abdominal aortic aneurysm are any one or more of the following: (1) Inhibiting vascular wall thickening; (2) Reducing the infiltration of cells in the arterial media and adventitia; (3) Improving the reduction and rupture of elastic fibers in the vascular wall; (4) Increasing the extensibility of elastic fibers in the vascular wall; (5) Reducing the content of tissue muscle fibers and collagen fibers; (6) Reducing the degree of fibrosis of collagen fibers.

3. A pharmaceutical composition, characterized by, The active ingredient is the Danshen-Gegen vesicle-like nanoparticles used in any one of claims 1-2.

4. The pharmaceutical composition of claim 3, wherein, It also includes a pharmaceutically acceptable carrier.

5. A pharmaceutical preparation, characterized by, The Danshen-Gegen vesicle-like nanoparticles used in any one of claims 1-2 and the pharmaceutically acceptable carrier are prepared.

6. The pharmaceutical preparation according to claim 5, characterized in that, The pharmaceutical preparation is an oral preparation or an injection preparation.

Images