Application of 5-HT3 receptor antagonists in the preparation of antitumor drugs

Abstract

This invention belongs to the field of medical technology, and specifically relates to the application of serotonin 3 receptor antagonists in the preparation of antitumor drugs. This invention, through research, demonstrates for the first time that serotonin 3 receptor antagonists can inhibit the activity of tumor cells resistant to third-generation EGFR-TKIs. More importantly, serotonin 3 receptor antagonists can not only reverse HER2 S310F mutation-mediated resistance to third-generation EGFR-TKIs, but also reverse secondary resistance to third-generation EGFR-TKIs, thus enabling their use as antitumor drugs for patients resistant to third-generation EGFR-TKIs. The combined use of serotonin 3 receptor antagonists and third-generation EGFR-TKIs exhibits a significant synergistic effect in inhibiting the proliferation of lung adenocarcinoma cells, with minimal toxic side effects on liver and kidney function, providing an effective treatment strategy for clinically reversing third-generation EGFR-TKI resistance and improving the treatment efficacy of NSCLC.

Description

Technical Field

[0001] This invention belongs to the field of medical technology, and in particular relates to the application of 5-hydroxytryptamine 3 receptor antagonists in the preparation of antitumor drugs. Background Technology

[0002] The latest statistics from the International Agency for Research on Cancer (IARC) of the World Health Organization show that lung cancer remains the leading cause of both cancer incidence and mortality. Non-small cell lung cancer (NSCLC) accounts for more than 80% of all lung cancers, with approximately 60% being adenocarcinoma. In Asians, nearly half of lung adenocarcinoma patients are epidermal growth factor receptor (EGFR) mutation positive. Tyrosine kinase inhibitors (TKIs) have significantly improved the clinical prognosis of patients with EGFR activating mutation NSCLC, but drug resistance is inevitable. The T790M mutation is the most common mechanism for resistance to first- and second-generation EGFR-TKIs, accounting for approximately 50%. For patients with T790M mutation-induced resistance to first- and second-generation EGFR-TKIs, third-generation EGFR-TKIs such as amitinib and osimertinib remain effective treatment options. However, the resistance mechanisms of third-generation EGFR-TKIs are complex, and there are currently no effective treatment options. Treatment strategies mainly rely on traditional chemotherapy, but chemotherapy has limited efficacy, significant toxic side effects, and impacts patients' quality of life, falling far short of clinical needs. Therefore, there is an urgent need to explore new drugs to overcome third-generation EGFR-TKI resistance, reduce adverse reactions, and prolong the effective treatment time of third-generation EGFR-TKI drugs. Summary of the Invention

[0003] To address the above-mentioned technical problems, this invention provides the application of 5-HT3 receptor antagonists in the preparation of antitumor drugs. This invention is the first to demonstrate that 5-HT3 receptor antagonists can reverse HER2 S310F mutation-induced resistance to third-generation EGFR-TKIs and secondary resistance, thereby prolonging the effective duration of amitinib. The combined use of 5-HT3 receptor antagonists and third-generation EGFR-TKIs also exhibits a synergistic effect and has fewer toxic side effects, thus showing promising application prospects in lung cancer treatment.

[0004] To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0005] The first aspect of this invention provides the use of a 5-hydroxytryptamine 3 (5-HT3) receptor antagonist in the preparation of an antitumor drug, wherein the antitumor drug is an antitumor drug targeting resistance to third-generation EGFR-TKIs.

[0006] 5-HT3 receptor antagonists are primarily used to prevent or treat nausea and vomiting caused by radiotherapy and chemotherapy. Some 5-HT3 receptor antagonists are also approved for the treatment of irritable bowel syndrome (IBS). These drugs are well-tolerated with limited side effects. This invention demonstrates through research that 5-HT3 receptor antagonists can inhibit the activity of tumor cells resistant to third-generation EGFR-TKIs. More importantly, 5-HT3 receptor antagonists can not only reverse HER2 S310F mutation-mediated resistance to third-generation EGFR-TKIs, potentially improving patient prognosis while controlling toxic side effects, but also reverse secondary resistance to third-generation EGFR-TKIs (such as amitinib). Therefore, they can be used as anti-tumor drugs for patients resistant to third-generation EGFR-TKIs. They can be used alone, but are more suitable for combination therapy with third-generation EGFR-TKIs, providing an effective treatment option for patients resistant to third-generation EGFR-TKIs.

[0007] Currently, no studies have reported the relationship between 5-HT3 receptor antagonists and EGFR-TKI sensitivity. This invention validates a new indication for 5-HT3 receptor antagonists, which not only holds promise as a new strategy for improving cancer treatment in patients resistant to third-generation EGFR-TKIs, but also significantly reduces economic costs and shortens development time compared to developing new drugs.

[0008] Preferably, the third-generation EGFR-TKI includes ametinib and osimertinib.

[0009] Preferably, the 5-hydroxytryptamine 3 receptor antagonist is palonosetron (CAS: 135729-62-3).

[0010] A second aspect of the present invention provides a pharmaceutical composition comprising a third-generation EGFR-TKI and a 5-hydroxytryptamine 3 receptor antagonist.

[0011] This invention demonstrates through in vitro experiments that in constructed HER2 S310F mutant lung adenocarcinoma cell lines H1975 S310F, PC9 S310F, H3255 S310F, and amitinib-second resistant cells H1975 AR, amitinib sensitivity is reduced, while palonosetron significantly reduces the IC50 of amitinib, increasing cell sensitivity to amitinib. Simultaneously, the combination index (CI) of palonosetron and amitinib is less than 1, indicating that palonosetron can sensitize amitinib and improve its anti-tumor efficacy. In vivo combined drug trials demonstrate that in a PC9 S310F mouse xenograft model, the combination of palonosetron and amitinib significantly increases the tumor inhibition rate, exhibiting a significant synergistic effect, highly consistent with in vitro experiments.

[0012] Preferably, the third-generation EGFR-TKI includes ametinib and osimertinib.

[0013] More preferably, the third-generation EGFR-TKI is amitinib.

[0014] Preferably, the 5-hydroxytryptamine 3 receptor antagonist includes granisetron, tropisetron, ondansetron, dolasetron, ramosetron, and palonosetron.

[0015] More preferably, the 5-hydroxytryptamine 3 receptor antagonist is palonosetron.

[0016] A third aspect of the present invention provides the use of the above-described pharmaceutical composition in the preparation of antitumor drugs.

[0017] Preferably, the antitumor drug is an anti-lung cancer drug.

[0018] Preferably, the antitumor drug is an oral preparation.

[0019] The beneficial effects of this invention are as follows: This invention is the first to discover that 5-HT3 receptor antagonists can reverse amitinib resistance, enhance the anti-tumor effect of amitinib, and have no significant hepatotoxicity or nephrotoxicity. In vitro and in vivo activity tests have demonstrated that the combination of 5-HT3 receptor antagonists and amitinib exhibits a significant synergistic effect in inhibiting the proliferation of lung adenocarcinoma cells. In vivo combined use can effectively inhibit the proliferation of xenograft tumors in nude mice, with minimal toxic side effects on liver and kidney function. Furthermore, 5-HT3 receptor antagonists and EGFR-TKIs are typically administered orally, making them convenient for patients. Therefore, compared with existing conventional chemotherapy, the combined application of 5-HT3 receptor antagonists and third-generation EGFR-TKIs not only provides convenience for patient treatment but also avoids toxic side effects, thus providing a new treatment strategy for clinically targeting and reversing amitinib resistance and improving the treatment effect of NSCLC, showing promising application prospects in lung cancer treatment. Moreover, compared to developing new drugs, combining existing drugs can significantly reduce overall R&D costs and shorten the research time. Attached Figure Description

[0020] Figure 1 This is the sequencing result of the HER2 S310F mutant plasmid in Example 1 of this invention;

[0021] Figure 2 This refers to the protein immunoblotting experiment results in Example 1 of this invention;

[0022] Figure 3 The dose-response curve was measured using the CCK-8 method in Example 1 of this invention, and the IC50 of amitinib against H1975 EV / S310F was calculated.

[0023] Figure 4The dose-response curve measured using the CCK-8 method in Example 1 of this invention is used to calculate the IC50 of amitinib against PC9 EV / S310F.

[0024] Figure 5 The dose-response curve was determined using the CCK-8 method in Example 1 of this invention, and the IC50 of amitinib against H3255 EV / S310F was calculated.

[0025] Figure 6 The dose-response curves measured using the CCK-8 method in Example 1 of this invention are used to calculate the IC50 of osimertinib at H1975 EV / S310F, PC9 EV / S310F, and H3255 EV / S310F.

[0026] Figure 7 The dose-response curve measured using the CCK-8 method in Example 1 of this invention was used to calculate the IC50 of amitinib against H1975 WT / AR.

[0027] Figure 8 This invention relates to the effects of amitinib on subcutaneous tumorigenesis and tumor formation in PC9 EV / S310F cells in Example 1 of this invention. Figure A shows mouse tumor images after 30 days of subcutaneous tumorigenesis of PC9 EV / S310F cells and 16 days of drug treatment; Figure B shows the changes in mouse tumor volume starting from day 6 after subcutaneous tumorigenesis; Figure C shows the tumor weight after 30 days of subcutaneous tumorigenesis of PC9 EV / S310F cells and 16 days of drug treatment; Figure D shows the changes in mouse body weight starting from day 6 after subcutaneous tumorigenesis.

[0028] Figure 9 This invention describes the inhibitory effects of single treatments with granisetron, tropisetron, ondansetron, dolasetron, ramosetron, and palonosetron, single treatment with ametinib, and combined treatment with both drugs on H1975 S310F cells, as well as the CI index of the combined use of the two drugs in Example 2 of this invention.

[0029] Figure 10 This invention describes the inhibitory effects of palonosetron monotherapy, ametinib monotherapy, and the combination of the two drugs on the cell viability of H3255S310F, PC9 S310F, and H1975 S310F cells in Example 3 of this invention, as well as the CI index of the combination of the two drugs.

[0030] Figure 11 This is a schematic diagram of the drug administration cycle in animal experiments according to Example 4 of the present invention;

[0031] Figure 12 This is the dose-response curve measured by the CCK-8 method in Example 4 of the present invention. The black dashed line represents the cell viability after 5 days of treatment with a fixed concentration of 5 μM palonosetron.

[0032] Figure 13 These are the experimental results of H1975 S310F, PC9 S310F, and H1975 AR cloning in Example 4 of this invention;

[0033] Figure 14 These are images of mouse tumors after 16 days of treatment with different groups of drugs in Example 4 of this invention, along with curves showing changes in tumor weight and volume.

[0034] Figure 15 These are the weight change curves of mice in different groups in Example 4 of the present invention;

[0035] Figure 16 These are liver and kidney function-related indicators in different groups of mice in Example 4 of this invention. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the implementation methods of this invention without inventive effort fall within the protection scope of this invention.

[0037] EGFR-TKI resistance is a pressing problem in the clinical treatment of NSCLC, especially resistance to third-generation EGFR-TKIs. Currently, conventional chemotherapy is the primary treatment, but its efficacy is limited and its side effects are significant, failing to meet clinical needs. This invention is the first to discover that a 5-HT3 receptor antagonist can reverse amitinib resistance and enhance the anti-tumor effect of amitinib. Furthermore, the combination of the 5-HT3 receptor antagonist and amitinib exhibits a significant synergistic effect in inhibiting the proliferation of lung adenocarcinoma cells. In vivo, the combined use effectively inhibits the proliferation of xenograft tumors in nude mice without significant hepatotoxicity or nephrotoxicity.

[0038] Based on the research results, this invention provides the application of 5-HT3 receptor antagonists in the preparation of antitumor drugs.

[0039] This invention also provides a pharmaceutical composition and its application in the preparation of antitumor drugs.

[0040] The following detailed description, using specific embodiments, will further illustrate this point.

[0041] The cell culture medium used in the following examples is RPMI-1640 medium supplemented with penicillin-streptomycin antibiotics and fetal bovine serum.

[0042] Unless otherwise specified, the raw materials, reagents, pharmaceuticals, or instruments used in the following embodiments are all commercially available products. The methods used in the following embodiments are, unless otherwise specified, conventional methods in the art.

[0043] Example 1

[0044] This embodiment provides the in vitro and in vivo verification process and results of HER2 S310F mutation-mediated resistance to third-generation EGFR-TKIs.

[0045] 1. Experimental Method:

[0046] 1.1 Construction of stable H1975, PC9 and H3255 cell lines with HER2 S310F mutation

[0047] 1.1.1 Construction of HER2S310F point mutant plasmid

[0048] (1) Design of point mutation primers:

[0049] Forward (SEQ ID No. 1): TGGGATTCTGCACCCTCGTCTGCCCC;

[0050] Reverse (SEQ ID No. 2): GGGTGCAGAATCCCACGTCCGTAGAAAGGTAG.

[0051] (2) Point mutations were induced using the above-mentioned mutation primers on the basis of commercially available HER2 overexpression plasmids via PCR. The PCR system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0052] Table 1 PCR system

[0053]

[0054] Table 2 PCR reaction procedure

[0055]

[0056] (3) The Dpn digestion substrate DNA system is shown in Table 3.

[0057] Table 3 Digestive System

[0058]

[0059] Digestion schedule: 37°C for 3 hours; 80°C for 20 minutes to terminate digestion; 4°C forever.

[0060] (4) Escherichia coli transformation: DH5α was removed from the -80°C freezer and placed on ice. 2 μl of DpnI digestion product was added to 50 μl of Escherichia coli, and the mixture was incubated on ice for 30 min. The mixture was then heat-shocked in a 42°C metal bath for 90 s and incubated on ice for 2 min. 300 μl of liquid LB (without ampicillin) was added, and the mixture was shaken at 200 rpm for 40 min. After centrifugation at 2700 rpm for 7 min, the supernatant was discarded, and 80 μl of liquid LB was added to resuspend the Escherichia coli precipitate. The precipitate was then dropped onto a solid LB plate and spread evenly. The plate was inverted until the liquid completely immersed in the solid LB, and then the plate was placed in an incubator at 37°C for 12-16 h.

[0061] (5) After the bacterial culture was sent for testing, the sequencing results were analyzed. The steps were the same as before. The analysis results indicated that the HER2S 310F plasmid base mutation was successful.

[0062] (6) Plasmid extraction

[0063] 1.1.2 Lentiviral Packaging

[0064] (1) HEK293T cells were cultured in 10cm culture dishes. When the cell density was about 90% and the cells were in good growth condition, they were used for virus packaging.

[0065] (2) Take out the packaged plasmids pSPAX2 and VSVG, as well as the target plasmids Vector, HER2 OE and HER2S310F from the -20℃ freezer and lay them on ice.

[0066] (3) Packaging system is shown in Tables 4 and 5:

[0067] Table 4 Packaging System A

[0068]

[0069] Table 5 Packaging System B

[0070]

[0071] Add packaging system B to packaging system A, mix thoroughly by pipetting, and let stand at room temperature for 20 minutes. At this time, discard the original culture medium in the HEK293T cell culture dish and replace it with 5 ml of DMEM Only medium to starve the cells.

[0072] (4) After the packaging system mixture has been left to stand at room temperature for 20 minutes, add the above-mentioned mixed packaging system to the HEK293T cell culture dish, shake gently to mix, and place in a 37℃ incubator for further culture.

[0073] (5) After 6-8 hours, discard the culture medium and virus packaging system mixture in the HEK293T cell culture dish and replace it with 10 ml of DMEM complete culture medium.

[0074] (6) Observe the color of HEK293T cell culture medium after about 48 hours. When the color is orange-yellow and the HEK293T cells are in good condition, the virus solution can be collected.

[0075] (7) Virus collection: Transfer HEK293T cell culture medium to a 15ml centrifuge tube and centrifuge at 800rpm for 3min to avoid cell debris in the virus solution. Pour the supernatant into a 6cm culture dish and place a 0.22μM filter into a new 15ml centrifuge tube. Use a 10ml syringe to aspirate the supernatant and transfer the virus solution to the 0.22μM filter for filtration. Aliquot the filtered virus solution into 1.5ml EP tubes, label the EP tube caps with the intervention gene, date, operator, etc., and store at -80℃.

[0076] 1.1.3 Construction of stable transfection cell lines

[0077] (1) Cell seeding: Seed the cells to be transfected into 6-well plates, culture overnight, and observe that the cell density is about 30-40% and the growth status is good.

[0078] (2) Mix 1 ml of 16400nly + 1 ml of virus solution + 2 μl of polybrene in a 5 ml centrifuge tube, discard the original culture medium in the 6-well plate, add the virus mixture to the 6-well plate, and label the well caps with the virus solution type and treatment time.

[0079] (3) After 6-8 hours, discard the virus mixture in the 6-well plate and replace it with 2 ml of 1640 complete medium. After 48 hours of culture, use the appropriate concentration of puromycin for screening. After 7-10 days, perform Western blot verification.

[0080] 1.1.4 Western blot

[0081] Protein sample preparation:

[0082] (1) Preparation: Pre-cool PBS, pre-cool 1.5ml EP tube, preheat the constant temperature metal bath to 95℃, prepare protein lysis buffer (as shown in Table 6), and prepare a bowl of ice.

[0083] Table 6 Preparation of protein lysis buffer

[0084]

[0085] (2) Cells for protein extraction were removed from the intercellular space, and the cell density was observed under a microscope to assess the required volume of protein lysis buffer. All operations after cell removal from the intercellular space were performed on ice to minimize protein degradation.

[0086] (3) Discard the original culture medium and wash the cells three times with pre-cooled PBS. After the last wash, discard as much PBS as possible to avoid residual PBS diluting the protein concentration.

[0087] 1.2 Construction of the EGFR-TKI resistant lung adenocarcinoma cell line H1975 AR

[0088] (1) Take H1975 cells in the logarithmic growth phase. When the confluence reaches 80%-90%, add 0.05μM ametinib for treatment and place them in a 37℃ 5%CO2 incubator for routine culture.

[0089] (2) When the cell density reaches about 50%, discard the original culture medium, wash twice with PBS, and replace with drug-free whole culture medium to continue culturing.

[0090] (3) When the cells grow to 80%-90% confluence again, discard the original culture medium, wash twice with PBS, and repeat the treatment with 0.05μM ametinib 6-8 times.

[0091] (4) After the cells stabilized at 0.05 μM amitinib, the amitinib concentration was gradually increased, and the treatment was repeated in the same manner as above, until the cells could stabilize at 10 μM amitinib concentration, thus obtaining an amitinib-resistant lung adenocarcinoma cell line.

[0092] (5) Detect the IC50 value of the drug-resistant cell line and calculate the resistance index (RI). RI = IC50 value of the drug-resistant cell line / IC50 value of the parent cell line. If RI > 2, the constructed drug-resistant cell line is considered to meet the requirements of the drug-resistant strain.

[0093] 1.3 CCK8 Experiment

[0094] (1) After digesting, centrifuging, and resuspending the cells obtained in sections “1.1” and “1.2”, count them and dilute them with cell culture medium to 1×10⁻⁶. 4 The cell suspension was seeded at a rate of 100 μl / well in 96-well plates and cultured overnight.

[0095] (2) Drug treatment: Amitinib was diluted with cell culture medium to the following concentration gradients: 0, 0.001, 0.01, 0.1, 1, 5, 10, 50, 100 μM, to obtain amitinib culture media of different concentrations. Osimertinib was diluted with cell culture medium to the following concentration gradients: 0, 0.001, 0.01, 0.1, 0.5, 1, 5, 10, 50 μM, to obtain osimertinib culture media of different concentrations. After discarding the cell culture medium in the 96-well plate, amitinib culture medium or osimertinib culture medium of different concentrations was added, with 6 auxiliary wells for each concentration.

[0096] (3) CCK8 detection: After 120 h of drug treatment, prepare the required amount of CCK8 dilution solution according to 90 μl RPMI-1640 medium + 10 μl CCK8, discard the original medium of the 96-well plate, add 100 μl CCK8 dilution solution to each well, incubate at 37℃ for 2 h, and then use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance value at 450 nm.

[0097] (4) Cell viability = (OD) treatment -OD blank ) / (OD control - OD blank ) × 100%. Wherein, OD treatment : Absorbance of wells in which amitinib or osimertinib culture medium was added during the drug processing steps; OD control : Absorbance of wells containing cell culture medium without amitinib added during the drug processing step; OD blank : Absorbance of the blank aperture.

[0098] Calculate IC using GraphPad Prism 8 50 And draw a diagram.

[0099] 1.2 In vivo tumor formation experiment in nude mice

[0100] This animal experiment was reviewed by the Ethics Committee of Tianjin Medical University Cancer Hospital.

[0101] (1) 24 male BALB / c nude mice aged 4-5 weeks were acclimatized for one week.

[0102] (2) After digesting and centrifuging PC9 EV and PC9 S310F cells in good growth condition, the cells were washed with PBS, counted, and then diluted to 1×10⁻⁶. 6 Cell suspension of 100 μl per mouse was administered subcutaneously in the left groin.

[0103] (3) 13 days after tumor implantation (tumor volume is 150-200 mm) 3 (Approximately) Administration began: Nude mice were randomly divided into four groups: EV-Ctrl, EV-Aum, S310F-Ctrl, and S310F-Aum. The EV-Aum and S310F-Aum groups were administered amitinib (dissolved in 0.5% sodium carboxymethyl cellulose aqueous solution, 100 μl gavage) at a dose of 5 mg / kg once daily. The EV-Ctrl and S310F-Ctrl groups were administered 100 μl of 0.5% sodium carboxymethyl cellulose aqueous solution once daily by gavage. Tumor length and width were measured with calipers every other day, and mouse weight was measured using an electronic scale. Tumors were harvested after 16 days of administration.

[0104] 2. Experimental Results:

[0105] 2.1 CCK8 Experimental Results

[0106] Sequencing results of the HER2 S310F mutant plasmid are as follows: Figure 1 As shown, the Western Blot results are as follows: Figure 2 As shown. Sequencing and Western blotting results indicate that this experiment successfully constructed stable HER2 S310F mutant H1975, PC9, and H3255 cell lines. CCK8 assays confirmed that the IC50 of amitinib was significantly higher in the HER2 S310F mutant stable lines compared to control cells (EVs). Figures 3-5 As shown in the figure): In H1975 cells mutated by HER2 S310F, the IC50 of amitinib increased from 0.36 μM to 2.57 μM; in PC9 cells mutated by HER2 S310F, the IC50 increased from 0.01 μM to 0.086 μM; and in H3255 cells mutated by HER2 S310F, the IC50 increased from 0.97 μM to 4.77 μM. CCK8 results indicated that osimertinib also showed a significant increase in IC50 in HER2 S310F mutant cells (e.g., ...). Figure 6 As shown in the figure, the IC50 of osimertinib increased from 0.14 μM to 1.46 μM in H1975 cells after HER2 S310F mutation, from 0.024 μM to 0.143 μM in PC9 cells after HER2 S310F mutation, and from 1.13 μM to 3.07 μM in H3255 cells after HER2 S310F mutation.

[0107] Figure 7 The results indicate that the amitinib-induced secondary resistance cells were successfully constructed in this experiment. The amitinib IC50 of H1975 AR cells was significantly higher than that of wild-type H1975 cells (H1975 WT), increasing from 0.39 μM to 5.85 μM.

[0108] The above results suggest that the HER2 S310F mutation leads to a significant increase in the IC50 of third-generation EGFR TKIs ametinib and osimertinib, meaning that HER2 S310F mediates resistance to third-generation EGFR TKIs.

[0109] 2.3 Results of in vivo tumor formation experiment in nude mice

[0110] like Figure 8As shown, PC9 EV tumors were highly sensitive to amitinib, with significant reductions in tumor volume and weight after 16 days of treatment with amitinib at 5 mg / kg. Amitinib was largely ineffective against PC9 S310F tumors; no significant difference in tumor volume and weight was observed between the PC9 EV and control groups after 16 days of treatment with amitinib at 5 mg / kg. No differences in body weight were observed among the four groups, suggesting that the toxic side effects of amitinib monotherapy are manageable.

[0111] The above results suggest that, consistent with in vitro cell experiments, HER2 S310F-mutant tumors in nude mouse xenograft models are resistant to amitinib.

[0112] Example 2

[0113] This embodiment uses the CCK8 assay to verify the synergistic effect of 5-HT3 receptor antagonists and ametinib.

[0114] 1. Experimental Methods

[0115] (1) H1975 S310F cells in good growth condition were digested, centrifuged, resuspended, counted, and diluted to 2×10⁻⁶. 4 The cell suspension was seeded at a rate of 100 μl / well in 96-well plates and cultured overnight.

[0116] (2) Drug treatment: Amitinib was diluted with cell culture medium to the following concentration gradients: 0.25, 0.5, 1, 2, and 4 μM to obtain amitinib culture media of different concentrations; different 5-HT3 receptor antagonists (granisetron, tropisetron, ondansetron, dolasetron, ramosetron, and palonosetron) were diluted to the following concentration gradients: 0.75, 1.5, 3, 6, and 12 μM to obtain 5-HT3 receptor antagonist culture media of different concentrations. Amitinib and different 5-HT3 receptor antagonists were diluted together with cell culture medium to obtain drug-containing culture media with amitinib concentrations of 0.25, 0.5, 1, 2, and 4 μM and 5-HT3 receptor antagonist concentrations of 0.75, 1.5, 3, 6, and 12 μM. After discarding the cell culture medium in the 96-well plate, add the above-mentioned amitinib culture medium, 5-HT3 receptor antagonist culture medium, or drug-containing culture medium, with 6 auxiliary wells for each concentration. Wells containing cell culture medium without amitinib or 5-HT3 receptor antagonist serve as blank controls.

[0117] (3) CCK8 detection: After 72 h of drug treatment, discard the original culture medium of the 96-well plate, add 100 μl of CCK8 dilution to each well, incubate at 37℃ for 2 h, and then use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance value at 450 nm.

[0118] (4) Cell viability = (OD) treatment -OD blank) / (OD control - OD blank ) × 100%. Wherein, OD treatment : Absorbance of wells containing amitinib culture medium, 5-HT3 receptor antagonist culture medium, or drug-containing culture medium added during drug processing; OD control : Absorbance of wells containing cell culture medium without amitinib or 5-HT3 receptor antagonists during drug processing; OD blank : Absorbance of the blank well. The synergistic index (CI) of the two drugs was calculated using CompuSyn software. A CI < 1 indicates that the two drugs have a synergistic effect.

[0119] 2. Experimental Results:

[0120] like Figure 9 As shown, the combined use of 5-HT3 receptor antagonists granisetron, tropisetron, ondansetron, dolasetron, ramosetron, and palonosetron with ametinib has a synergistic effect on inhibiting the activity of H1975 S310F mutant cells, and the CI index of the two-drug combination at most concentrations is significantly <1.

[0121] Example 3

[0122] This embodiment verifies the synergistic effect of palonosetron and ametinib against H3255 S310F and PC9 S310F mutant cells.

[0123] The second-generation 5-HT3 receptor antagonist palonosetron is more specific and has a longer half-life. In this experiment, palonosetron and amitinib were used in H3255 S310F and PC9 S310F mutant cells, as well as amitinib-second-resistant cells H1975 AR, for both single-drug and combined treatment, as in Example 2.

[0124] like Figure 10 As shown, palonosetron and ametinib both exhibited significant synergistic effects in inhibiting the activity of HER2 S310F mutant cells and H1975 AR cells.

[0125] Example 4

[0126] This embodiment verifies the in vitro and in vivo efficacy and safety of the combined use of palonosetron and ametinib.

[0127] 1. Experimental Method:

[0128] 1.1 CCK8 Experiment

[0129] (1) H1975 S310F mutant cells, PC9 S310F mutant cells, and H1975 AR cells in good growth condition were digested, centrifuged, resuspended, counted, and diluted to 1×10⁻⁶. 4 The cell suspension was seeded at a rate of 100 μl / well in 96-well plates and cultured overnight.

[0130] (2) Drug treatment: Amitinib was diluted with cell culture medium to prepare amitinib culture medium of different concentrations; palonosetron was diluted with cell culture medium to prepare 5 μM palonosetron culture medium; amitinib and palonosetron were co-diluted with cell culture medium to prepare amitinib + palonosetron culture medium containing different concentrations of amitinib and 5 μM palonosetron. After discarding the cell culture medium in the 96-well plate, amitinib culture medium, palonosetron culture medium, or amitinib + palonosetron culture medium of different concentrations were added, with 6 auxiliary wells for each treatment concentration.

[0131] (3) CCK8 detection: After 120 h of drug treatment, prepare the required amount of CCK8 dilution solution according to 90 μl RPMI-1640 medium + 10 μl CCK8, discard the original medium of the 96-well plate, add 100 μl CCK8 dilution solution to each well, incubate at 37℃ for 2 h, and then use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance value at 450 nm.

[0132] (4) Cell viability = (OD) treatment -OD blank ) / (OD control - OD blank ) × 100%. Calculate IC50 and plot it using GraphPadPrism 8. Where OD treatment : Absorbance of wells containing amitinib culture medium, palonosetron culture medium, or amitinib + palonosetron culture medium added during the drug processing steps; OD control : Absorbance of wells containing cell culture medium that does not contain amitinib or palonosetron during the drug processing step; OD blank : Absorbance of the blank aperture.

[0133] 1.2 Cloning Experiment

[0134] (1) After digesting, centrifuging, resuspending and counting the H1975 S310F mutant cells, PC9 S310F mutant cells and H1975 AR cells in good growth condition, they were seeded into 12-well plates at 1000 cells / well and cultured overnight.

[0135] (2) Drug treatment: Ametinib was diluted with cell culture medium to prepare 2 μM, 0.01 μM and 5 μM ametinib culture medium; palonosetron was diluted with cell culture medium to prepare 5 μM palonosetron culture medium; ametinib and palonosetron were co-diluted with cell culture medium to prepare ametinib + palonosetron culture medium containing 2 μM, 0.01 μM and 5 μM ametinib and 5 μM palonosetron. The culture plates containing each mutant cell were divided into a control group, an amitinib monotherapy group, a palonosetron monotherapy group, and a combination of amitinib and palonosetron. After discarding the cell culture medium in the 12-well plates, 2 μM amitinib culture medium was added to the amitinib monotherapy group corresponding to H1975S310F mutant cells, 5 μM palonosetron culture medium was added to the palonosetron monotherapy group, and amitinib + palonosetron culture medium containing 2 μM amitinib and 5 μM palonosetron was added to the combination of amitinib and palonosetron. For S310F mutant cells, the amitinib monotherapy group was treated with 0.01 μM amitinib culture medium, the palonosetron monotherapy group was treated with 5 μM palonosetron culture medium, and the amitinib + palonosetron combination group was treated with amitinib + palonosetron culture medium containing 0.01 μM amitinib and 5 μM palonosetron. For H1975 AR cells, the amitinib monotherapy group was treated with 5 μM amitinib culture medium, the palonosetron monotherapy group was treated with 5 μM palonosetron culture medium, and the amitinib + palonosetron combination group was treated with amitinib + palonosetron culture medium containing 5 μM amitinib and 5 μM palonosetron. All groups were treated with the drugs for 10 days.

[0136] (3) Staining and statistics: Discard the culture medium, wash with PBS, fix the cells with 4% tissue fixative, and then stain with 0.5% crystal violet. Take pictures and save them, count the number of cell colonies and perform statistical analysis, and plot the graphs using GraphPad Prism 8.

[0137] 1.3 In vivo tumor formation experiment in nude mice

[0138] This animal experiment was reviewed by the Ethics Committee of Tianjin Medical University Cancer Hospital.

[0139] (1) 28 male BALB / c nude mice aged 4-5 weeks were acclimatized for one week.

[0140] (2) After digesting and centrifuging the well-grown PC9 S310F cells, wash them with PBS, count them, and then dilute the cells to 1×10⁻⁶. 6 Cell suspension of 100 μl per mouse was administered subcutaneously in the left groin.

[0141] (3) 13 days after tumor implantation (tumor volume is 150-200 mm)3 (Approximately) Administration began: Nude mice were randomly divided into a control group, an amitinib group, a palonosetron group, and an amitinib + palonosetron group. The amitinib group received 5 mg / kg amitinib (dissolved in 0.5% sodium carboxymethyl cellulose aqueous solution) via gavage once daily, with a gavage volume of 100 μl. The palonosetron group received 50 μg / kg palonosetron (dissolved in water) via intraperitoneal injection every other day, with an injection volume of 100 μl. The amitinib + palonosetron group received amitinib (dissolved in 0.5% sodium carboxymethyl cellulose aqueous solution) via gavage once daily, with a gavage volume of 100 μl, and palonosetron (dissolved in water) via intraperitoneal injection every other day, with an injection volume of 100 μl. The control group received 100 μl of 0.5% sodium carboxymethyl cellulose aqueous solution via gavage once daily, and 100 μl of 0.5% sodium carboxymethyl cellulose aqueous solution via intraperitoneal injection every other day. The administration cycle was as follows: Figure 11 As shown. Tumor length and width were measured daily using calipers, and mouse weight was measured using an electronic scale. Blood samples were collected from the eyeballs on day 16 of treatment to detect liver and kidney function-related indicators: blood urea nitrogen (BUN), creatinine, aspartate aminotransferase (AST), and alanine aminotransferase (ALT). Mice were euthanized after blood collection, and the tumors were harvested.

[0142] 2. Experimental Results:

[0143] 2.1 CCK8 Experimental Results

[0144] like Figure 12 As shown, the addition of palonosetron to H1975 S310F, PC9 S310F and H1975 AR cells significantly reduced the IC50 of ametinib.

[0145] 2.2 Cloning experiment

[0146] like Figure 13 As shown, the clone formation results indicated that the combination therapy group had the fewest clones, suggesting that the combination of the two drugs had a more significant inhibitory effect on clone formation than either drug alone.

[0147] 2.3 In vivo tumor formation experiment in nude mice

[0148] like Figure 14 As shown, the combined treatment group of the two drugs exhibited the most significant inhibitory effect on tumor growth. This result suggests that both in vitro cell experiments and in vivo animal experiments yielded consistent results: palonosetron can reverse amitinib resistance and significantly enhance the antitumor effect of amitinib.

[0149] like Figure 15 As shown, there was no significant difference in the weight of the four groups of mice; Figure 16As shown, no significant increase was observed in liver and kidney function-related indicators in mice in the ametinib + palonosetron group, suggesting that the combined use of ametinib and palonosetron has minimal toxic side effects on liver and kidney function.

[0150] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A pharmaceutical composition, characterized in that, It consists of a third-generation EGFR-TKI and a 5-HT3 receptor antagonist; the third-generation EGFR-TKI is amitinib, and the 5-HT3 receptor antagonist is granisetron, tropisetron, ondansetron, dolasetron, ramosetron, and palonosetron. When the concentrations of ametinib are 0.25µM, 0.5µM, 1µM, 2µM, and 4µM, the concentrations of palonosetron are 0.75µM, 1.5µM, 3µM, 6µM, and 12µM, respectively. When the concentrations of ametinib are 0.25µM, 0.5µM, 1µM, 2µM, and 4µM, the concentrations of granisetron are 0.75µM, 1.5µM, 3µM, 6µM, and 12µM, respectively. When the concentrations of ametinib are 0.25µM, 0.5µM, 1µM, 2µM, and 4µM, the concentrations of tropisetron are 0.75µM, 1.5µM, 3µM, 6µM, and 12µM, respectively. When the concentrations of ametinib are 0.25µM, 0.5µM, 1µM, and 4µM, the concentrations of ondansetron are 0.75µM, 1.5µM, 3µM, and 12µM, respectively. When the concentrations of ametinib are 0.25µM, 0.5µM, 1µM, 2µM, and 4µM, the concentrations of dolasetron are 0.75µM, 1.5µM, 3µM, 6µM, and 12µM, respectively. When the ametinib concentration is 0.25µM, 0.5µM, 1µM, and 2µM, the ramosetron concentration is 0.75µM, 1.5µM, 3µM, and 6µM, respectively.

2. The pharmaceutical composition according to claim 1, characterized in that, The 5-hydroxytryptamine 3 receptor antagonist is palonosetron.

3. The use of the pharmaceutical composition according to claim 1 or 2 in the preparation of an antitumor drug, wherein the antitumor drug is an anti-lung cancer drug.

Images