Cordycepin nano delivery body, and preparation method and application thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a cordycepin nano delivery body and a preparation method and application thereof. The method utilizes rolling circle amplification technology, and connects the cordycepin on the circular DNA through base complementary pairing to obtain the cordycepin nano delivery body. The prepared cordycepin nano carrier is a nanoparticle, and the particle size is 100-120 nm. The application utilizes the characteristics that the cordycepin can form unconventional base complementary pairing with DNA, and first and successfully adopts the biological macromolecule DNA as the cordycepin carrying carrier to obtain the cordycepin nano delivery body with high efficient carrying, controllable slow release and high biological safety, and the cordycepin nano delivery body has good targeting property to melanoma. The cordycepin nano delivery body has mild and safe preparation condition, and the preparation process is simple and easy to operate, and is beneficial to the industrialized production of the nano carrier and the wide clinical application.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a cordycepin nanodelivery system, its preparation method, and its application. Background Technology

[0002] Cordycepin, or 3'-deoxyadenosine, is a nucleoside antibiotic with various biological activities, including antibacterial, anti-leukemic, immunomodulatory, free radical scavenging, and anti-ischemia-reperfusion injury pharmacological effects. In recent years, cordycepin has shown promising antitumor activity in both in vitro and in vivo animal experiments. However, its poor solubility, low activity, and easy metabolism after oral administration significantly limit its application.

[0003] Melanoma is a highly malignant and metastatic skin tumor with an increasing incidence rate and limited effectiveness of traditional treatments. Current clinical treatments primarily rely on chemotherapy drugs (such as dacarbazine), targeted therapy (such as BRAF / MEK inhibitors), and immune checkpoint inhibitors (such as PD-1 antibodies). However, these therapies have significant drawbacks: chemotherapy drugs have severe toxic side effects and easily induce drug resistance; targeted therapy is only effective for some patients carrying the BRAF V600E mutation, and most patients relapse within a short period. Furthermore, the dense stromal barrier and immunosuppressive microenvironment of melanoma further hinder drug penetration and efficacy, necessitating the development of novel treatment strategies that are highly effective, low in toxicity, and synergistic in multiple mechanisms.

[0004] Cordycepin, a natural nucleoside analogue, has emerged as a potential candidate drug for melanoma treatment due to its multi-target anti-tumor mechanism and high safety profile. Studies have shown that cordycepin can induce tumor cell apoptosis by activating the Caspase-3 / 9 pathway and inhibit cell proliferation by suppressing the PI3K / AKT / mTOR signaling pathway; simultaneously, it can downregulate MMP-2 / 9 and VEGF expression, inhibiting tumor invasion and metastasis. Furthermore, cordycepin exhibits significantly lower toxicity to normal cells than traditional chemotherapy drugs and does not cause serious side effects such as myelosuppression, further highlighting its unique advantages in overcoming drug resistance and improving overall therapeutic efficacy.

[0005] However, the clinical application of cordycepin is limited by its inherent limitations: poor water solubility results in oral bioavailability of less than 5%; it is easily and rapidly degraded in vivo by adenosine deaminase (ADA), resulting in a short half-life (<1 hour); and the free drug has difficulty penetrating the dense matrix of melanoma. To address these issues, innovative design of nanoparticle delivery systems has become crucial for overcoming these bottlenecks. Using carriers to deliver cordycepin can protect it from enzymatic degradation in vivo, ensuring the drug remains active before reaching the target site and offering advantages such as improved targeting. However, in existing cordycepin delivery research, whether on cordycepin nanoparticles or formulations, the carriers are mostly chemical substances, such as polyethylene glycol and biotin, all of which have varying degrees of biotoxicity.

[0006] In their previous research, the inventors’ research group used a novel method of molecular dynamics simulation and experimental collaboration to accelerate the screening of DNA base-organic small molecule interaction structures. They discovered that cordycepin can form a triplet structure with thymine through unconventional base complementary pairing (Xinyu Feng et al. Angew Chem Int Ed. 2024 Aug 26; 63(35):e202408003.). Based on this discovery, cordycepin is expected to be delivered through biological carriers.

[0007] However, it remains unclear how to construct an effective cordycepin nanobiota based on this invention, and how to provide a highly efficient nanobiota that carries and delivers cordycepin for the treatment of melanoma. This is a technical problem that needs to be solved. Summary of the Invention

[0008] To address the aforementioned technical problems, one objective of this invention is to provide a method for preparing cordycepin nanodelivery.

[0009] The present invention adopts the following technical solution:

[0010] A method for preparing cordycepin nanodelivery devices, utilizing rolling circle amplification (RoBA) technology, involves linking cordycepin to circular DNA via base complementary pairing to obtain cordycepin nanodelivery devices, comprising the following steps:

[0011] S1. Preparation of circular DNA: The primer chain solution and template chain solution are mixed, and a circular DNA product is formed by annealing and ligation reactions. The sequence of the primer chain is shown in SEQ ID No:1, and the sequence of the template chain is shown in SEQ ID No:2.

[0012] S2. Rolling circle amplification: The prepared circular DNA was mixed with cordycepin solution to prepare a rolling circle amplification reaction system. The reaction was carried out in a PCR instrument at 30℃ for 10-60 min, and then the reaction was terminated by incubation at 75℃ for 10 min to obtain the desired cordycepin nanodelivery.

[0013] Preferably, the PCR instrument reaction time is 30℃ for 30 minutes.

[0014] Preferably, in step S1, after the primer chain solution and template chain solution are mixed, ligation buffer is added, annealing is performed using a PCR instrument, T4 ligase is added, ligation is performed by standing at 25°C for 3 hours, and then the reaction is terminated by incubation at 65°C for 10 minutes.

[0015] Preferably, the primer chain solution and template chain solution are mixed at a molar ratio of (2-4):1, 5 μL of 10× ligation buffer is added, double-distilled water is added to a final volume of 50 μL, and then annealing is performed.

[0016] Preferably, the annealing process is as follows: reacting at 95°C for 2 min, reacting at 65°C for 30 min, reacting at 50°C for 30 min, reacting at 37°C for 30 min, and reacting at 22°C for 30 min.

[0017] Preferably, the amount of T4 ligase used is 10-20 U / μL.

[0018] More preferably, the primer chain solution and the template chain solution are mixed at a concentration ratio of 2:1; the amount of T4 ligase used is 10 U / μL.

[0019] Preferably, in step S2, the rolling circle amplification reaction system includes circular DNA, cordycepin solution, Φ29 DNA polymerase, dNTP, BSA, and Φ29 DNA polymerase reaction buffer.

[0020] Preferably, in the rolling circle amplification reaction system, the final concentration of cordycepin is 10-16 mM, the final concentration of Φ29 DNA polymerase is 2-3 U / μL, and the final concentration of dNTPs is 1-2 mM / μL.

[0021] More preferably, the final concentration of cordycepin is 16 mM, the final concentration of Φ29 DNA polymerase is 2 U / μL, and the final concentration of dNTP is 2 mM / μL.

[0022] The second objective of this invention is to provide a cordycepin nanodelivery device, which is prepared using the preparation method described above.

[0023] Preferably, the cordycepin nanodelivery medium is a nanoparticle with a particle size of 100-120 nm.

[0024] A third objective of this invention is to provide the application of the cordycepin nanodelivery as described above in the preparation of drugs for treating melanoma.

[0025] The beneficial effects of this invention are as follows:

[0026] 1. Based on the inventors' research group's previous work, this application is the first to successfully utilize the biomolecule DNA as a carrier for cordycepin. DNA possesses high designability, modifiability, programmability, biocompatibility, and biodegradability, offering advantages such as good biosafety and highly adjustable controlled release when used as a drug carrier. This application leverages the characteristic that cordycepin can form unconventional base complementary pairs with DNA, employing RCA technology to construct a cordycepin carrier. Based on a DNA hydrogel, a cordycepin nanodelivery system with high efficiency, controllable sustained release, and high biosafety was obtained.

[0027] 2. The limitations of cordycepin's clinical administration mainly stem from the inherent physicochemical defects of the free drug, resulting in a failure to significantly enhance its therapeutic efficacy. Specifically, unmodified cordycepin molecules suffer from poor water solubility, short biological half-life, and insufficient targeting. Simply forming the naked drug into an oral formulation also results in first-pass effect and enterohepatic circulation, greatly reducing the therapeutic effect of cordycepin. Cordycepin has anti-tumor effects; therefore, this invention uses a DNA nanocarrier to carry cordycepin, enabling its slow release at the tumor site, thereby enhancing its anti-tumor effect.

[0028] 3. The preparation conditions of the cordycepin nanocarrier provided in this application are mild and safe, without the use of acids, alkalis and organic solvents, and without the generation of toxic byproducts. The preparation process is simple and easy to operate, which is conducive to the industrial production and wide clinical application of nanocarriers.

[0029] 4. High expression of MDR1 (multidrug resistance protein, i.e., P-glycoprotein) in melanoma cells is a crucial mechanism for chemotherapy resistance. This application utilizes an RCA-CCS nanocarrier constructed using rolling circle amplification (RoBCA) technology. By introducing an MDR1 aptamer into the primer sequence, a dual-functional design is achieved: firstly, the aptamer specifically binds to the overexpressed P-glycoprotein on the surface of tumor cells, endowing the nanoparticles with the ability to actively target and recognize melanoma cells; secondly, the carrier efficiently loads cordycepin, and the nanoparticles protect it from nuclease degradation, achieving efficient drug loading and release of cordycepin. This drug delivery system successfully overcomes the limitations of traditional chemotherapy, providing an innovative solution to overcome multidrug resistance in melanoma through a three-pronged action of "recognition-blockade-killing." Its core value lies in combining the natural antitumor activity of cordycepin with the precise manipulation of nanotechnology, laying an important theoretical foundation for the development of targeted anticancer agents based on natural products. Attached Figure Description

[0030] Figure 1 This is a schematic diagram of the preparation of cordycepin nanodelivery in this application.

[0031] Figure 2The gel electrophoresis characterization of RCA-CCS is shown in Figure A, which shows the successful binding of the primer strand and the template strand, and Figure B shows the successful synthesis of the RCA product.

[0032] Figure 3 The results are from scanning electron microscopy (SEM) of RCA-CCS. Figures A and B show the observations at different magnifications.

[0033] Figure 4 The results are for the high-performance liquid chromatography characterization of RCA-CCS.

[0034] Figure 5 The results of targeted experiments using RCA-CCS on B16F10 and Hacat cells.

[0035] Figure 6 The effect of RCA-CCS on the viability of B16F10 cells.

[0036] Figure 7 Flowchart of drug administration for mouse melanoma experiments.

[0037] Figure 8 These are photographs of the appearance of mice in different groups at the end of the drug administration experiment in mice with melanoma.

[0038] Figure 9 These are photographs of melanoma tumor tissues obtained from different groups of mice in a mouse melanoma experiment.

[0039] Figure 10 This is a graph showing the changes in tumor tissue volume (Figure A) and weight (Figure B) in a mouse melanoma experiment.

[0040] Figure 11 TUNEL staining results for tumor tissues from different groups of mice.

[0041] Figure 12 The results of ELISA detection of IFN-γ in the serum of mice in each group were obtained.

[0042] Figure 13 H&E stained sections of major organs (heart, liver, spleen, lung, and kidney) of mice in each group. Detailed Implementation

[0043] The technical solution of the present invention will be described in more detail below with reference to experiments.

[0044] Experimental cells: Mouse melanoma cells B16F10, purchased from Wuhan Pronosei Life Science Technology Co., Ltd.

[0045] Experimental animals: SPF-grade C57BL / 1 magnetic mice, 6–8 weeks old, weighing 20±1g, were purchased from Cyagen (Suzhou) Biotechnology Co., Ltd. The animal housing was maintained at a temperature of 25±1℃, with 12-hour light / dark cycles, and free access to food. Experiments began after 7 days of acclimatization.

[0046] Main drugs: Cordycepin, purchased from Shanghai Aladdin Company; DNA primer strands, purchased from General Biotechnology (Anhui) Co., Ltd.

[0047] Example 1

[0048] See Figure 1 The preparation method of cordycepin nanodelivery includes the following steps:

[0049] S1. Preparation of circular DNA:

[0050] Primer Strand Sequence: ACTGTTTACCGTGTAGGCATCCC AGTGTCCGCGA (SEQ ID No: 1);

[0051] Template chain (circular strand) sequence: GGGATGCCTACACGGTAAAC AGTTAAAAAAAAAAAAAAAAAAAAAAAAAAATACT AGATGCTGAGGTACAGG TTTCGCGGACACT (SEQ ID No:2);

[0052] The underlined part represents the complementary pairing sequence of the MDR1 aptamer.

[0053] Dilute the two single-stranded DNAs: Centrifuge the primer tube (1000-3000 r / min) for several minutes to allow the DNA to gather at the bottom of the tube. After adding an appropriate amount of double-distilled water, cap the tube, heat it in a water bath and vortex to mix it thoroughly so that the DNA is fully dissolved and the DNA concentration is about 10 μM.

[0054] The primer and template solutions were mixed, and 5 μL of 10× ligation buffer was added. Double-distilled water was then added to a final volume of 50 μL. The mixture was annealed using a PCR instrument with the following annealing program: 95°C for 2 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and 22°C for 30 min. After annealing, T4 ligase (10 U / μL) was added to the mixture, and the mixture was incubated at 25°C for 3 h for ligation. After incubation, the mixture was treated at 65°C for 10 min to inactivate the T4 ligase, thus terminating the reaction. The product, circular DNA, was stored at 4°C for later use.

[0055] S2. Rolling circle amplification (RCA): The product of step S1 above was mixed with cordycepin solution, Φ29 DNA polymerase, dNTP, BSA (1X), and 10×Φ29 DNA polymerase reaction buffer to obtain the rolling circle amplification reaction system. The reaction was performed at 30℃ for 30 min using a PCR instrument. After the reaction was completed, the reaction was terminated by passing the solution through 75℃ for 10 min to obtain the desired cordycepin nanodelivery body (cordycepin nanoparticles), denoted as RCA-CCS.

[0056] verify

[0057] 1) Non-denaturing polyacrylamide gel electrophoresis characterization

[0058] RCA-CCS was characterized by 8% non-denaturing polyacrylamide gel electrophoresis, such as... Figure 2 As shown in Figure A, the primer strand and template strand form a new structure through complementary base pairing, which has a larger structure and appears to be located relatively higher in the gel image; as shown in Figure A. Figure 2 As shown in Figure B, the RCA product accumulates in the sample well, proving that a large-structure nanocarrier was successfully synthesized via the RCA reaction.

[0059] 2) Scanning electron microscopy characterization

[0060] Take 30 μL of the prepared RCA-CCS and perform gradient dehydration and desalting using anhydrous ethanol of different concentrations.

[0061] First, add 500 μL of 50% anhydrous ethanol in a gradient, mix for 2–3 min, centrifuge at 12,000 rpm for 12 min, discard the liquid, and retain the precipitate. Next, add 500 μL of 75% anhydrous ethanol, mix for 2–3 min, centrifuge at 12,000 rpm for 12 min, discard the liquid, and retain the precipitate. Finally, add 500 μL of 95% anhydrous ethanol, mix for 2–3 min, centrifuge at 12,000 rpm for 12 min, discard some of the liquid, and use a pipette to evenly spread the remaining product evenly on an 8 mm * 8 mm square silicon wafer.

[0062] The silicon wafer is treated with platinum spraying, fixed on the sample stage, and then measured on the instrument.

[0063] like Figure 3 As shown, the scanning electron microscope results show that the nanoparticles with uniform particle size are visible in the field of view. The cordycepin nanoparticles prepared by this method have uniform particle size and the particle size distribution is between 100-120 nm.

[0064] 3) High-performance liquid chromatography (HPLC) characterization

[0065] To demonstrate the successful mounting of cordycepin on the RCA, the cordycepin content in the cordycepin nanoparticles was determined using the HLPC method.

[0066] Take 600 μL of the prepared RCA-CCS and perform four ultrafiltrations using a 10 kDa ultrafiltration tube to remove excess free small molecule cordycepin. Collect the waste liquid from each ultrafiltration and measure the A at 260 nm.

[0067] After ultrafiltration, approximately 260 μL of final product was obtained. 32 μL of 10× Reaction buffer and 28 μL of DNase I were added, and the mixture was incubated at 37°C for 12 h. After the reaction, 32 μL of 25 mM EDTA was added, and PCR was performed at 65°C for 10 min to inactivate the enzyme, yielding approximately 350 μL of product. Treatment of the ultrafiltration product with DNase I disrupts the DNA structure, exposing the small molecule drug cordycepin in a free state for concentration testing.

[0068] Add approximately 5 mL of double-distilled water to the product (approximately 350 μL) to dilute the sample, and then perform the analysis.

[0069] The results are as follows Figure 4 As shown, the product exhibits the characteristic absorption peak of cordycepin, and the concentration of cordycepin is 4.74 μg / mL, demonstrating that the delivery vector provided in this application has good loading efficiency for cordycepin.

[0070] Example 2

[0071] Targeting of Cordycepin Nanoparticles

[0072] Mouse melanoma cells (B16F10) were cultured in 1640 medium containing 10% fetal bovine serum at 37°C. Human immortalized keratinocytes (HaCat) were cultured in DMEM medium containing 10% fetal bovine serum at 37°C. Cell smears were placed in 24-well plates, and logarithmically growing B16F10 and HaCat cells were collected and transferred to 24-well plates. After cell adhesion, cordycepin nanoparticles prepared using Cy3-labeled fluorescent dUTPs (prepared as in Example 1, except that fluorescently modified dUTPs were used for the dNTPs) were added. After co-culturing for 2 hours, the cells were washed with PBS and fixed with 4% paraformaldehyde (PFA) at 4°C for 30 minutes. Subsequently, the liquid was removed, and the cell nuclei were stained with DAPI at 4°C for 5 minutes. Finally, the cell smears were removed from the 24-well plates, dried, fixed on glass slides, and observed using a laser confocal microscope.

[0073] like Figure 5 As shown, laser confocal microscopy results indicate that B16F10 cells take up cordycepin nanoparticles significantly more than HaCat cells, which is attributed to the overexpression of MDR1 on B16F10 cells. In this design, the RCA product contains abundant MDR1 aptamers, which can selectively target B16F10 cells with high MDR1 expression.

[0074] Example 3

[0075] Cordycepin nanoparticles inhibit tumor cell activity

[0076] Mouse melanoma cells (B16F10) were cultured in 1640 medium containing 10% fetal bovine serum at 37°C. Cells in the logarithmic growth phase were collected and transferred to 6-well plates, and co-cultured for 24 h with 0.4 ng / μL, 0.8 ng / μL, 1.2 ng / μL, 1.6 ng / μL, and 2 ng / μL of RCA-CCS, respectively. After co-culture, the cells were analyzed using Fixed ViabilityDye eFluor. TM 520 reactive dyes were used to detect cell viability.

[0077] like Figure 6 As shown, cordycepin nanoparticles can reduce the viability of B16F10 cells, and the inhibitory effect is stronger with increasing dose, showing significant differences (**p<0.001; *p<0.05).

[0078] Example 4

[0079] Cordycepin nanoparticles improve B16F10 cell-induced mouse melanoma

[0080] 1. RCA-CCS Preprocessing

[0081] Before administration, the RCA-CCS product prepared in Example 1 should be ultrafiltered five times to remove excess free cordycepin. The steps are as follows: 1) Rinse the ultrafiltration tube with double-distilled water and centrifuge at 1000 rpm for 5 min; 2) Add 200 μL of RCA-CCS product, then add 300 μL of 1×TAE / Mg, let stand for 3 min, and then centrifuge at 7000 rpm for 10 min; 3) Discard the waste liquid, add 1×TAE / Mg to the ultrafiltration tube to the 500 μL mark, let stand for 3 min, and then centrifuge at 7000 rpm for 10 min; 4) Repeat step 3) three times. After the last ultrafiltration, collect the final product in the ultrafiltration tube to obtain the RCA-CCS for the experiment.

[0082] 2. Preparation and administration of mouse melanoma model

[0083] The experimental animals were 32 six-week-old female C57BL / 6J mice. The 32 mice were randomly divided into four groups of eight mice each: the model group, the cordycepin gavage group, the low-dose RCA injection group, and the high-dose RCA injection group.

[0084] Modeling process: Shave the hair on the right back of the mice one day in advance. The next day, digest the prepared B16F10 cells into centrifuge tubes, resuspend them in physiological saline, and adjust the cell concentration to 5*10. 6 Cells / mL were subcutaneously injected into the right back of C57BL / 6J mice, 0.1 mL per mouse (note that the cell suspension must be mixed well before each injection) to establish a melanoma xenograft model. The tumors were allowed to grow to 50-100 mm² in the mice. 3 (V 肿瘤体积 = Length * Width 2 / 2), begin administration.

[0085] Melanoma mice were randomly divided into four groups:

[0086] Group 1: Model group, receiving the same volume of physiological saline via intraperitoneal injection;

[0087] Group 2: Cordycepin gavage group, Cordycepin was administered by gavage at a dose of 5 mg / kg;

[0088] Group 3: Low-dose RCA injection group, mice were administered ultrafiltered RCA-CCS product via tail vein at a dose of 0.05 mg / kg;

[0089] Group 4: High-dose RCA injection group, mice were administered RCA-CCS product prepared in Example 1 via tail vein (the product was ultrafiltered 5 times before each administration to remove excess free cordycepin), at a dose of 0.1 mg / kg.

[0090] Experimental flowchart as follows Figure 7 As shown, mouse body weight and tumor volume were recorded before the first administration. Subsequently, tumor volume was measured and recorded daily before each administration, until the tumors in the model group reached approximately 1500 mm. 3 The mice were then euthanized.

[0091] 2. Evaluation of the therapeutic effect of cordycepin nanoparticles

[0092] (1) Weight and volume of melanoma

[0093] After the administration was completed, the mice in the treatment group were photographed, such as... Figure 8 As shown. The size of the mouse tumor was recorded before sacrifice. The mouse was sacrificed, the tumor tissue on its back was removed, weighed, and photographed. (See attached image.) Figure 9 and Figure 10 As shown, the melanoma tumors in mice in groups 3 and 4 were smaller in size and weight, demonstrating that the treatment effects of both groups were superior to those of the cordycepin gavage group, and the growth inhibition effect on melanoma was even better with increasing dosage.

[0094] (2) TUNEL staining to detect apoptotic cells in melanoma tissue

[0095] TUNEL (Terminal deoxynucleotidyl transferase dUTP Nick End Labeling) is a method for detecting DNA breaks. During apoptosis, endogenous nucleases are activated, causing DNA to break between nucleosomes, forming numerous 3'-OH ends. TUNEL technology uses terminal deoxynucleotidyl transferase (TdT) to attach labeled dUTPs (such as fluorescent or enzyme-labeled ones) to the 3'-OH ends of DNA breaks, thereby labeling cells where DNA breaks have occurred.

[0096] TUNEL-positive cells are generally considered to be cells undergoing apoptosis because DNA breakage is one of the key characteristics of apoptosis. In melanoma tissue, the number of TUNEL-positive cells can reflect the level of tumor cell apoptosis, thereby assessing the biological behavior of the tumor or the effectiveness of treatment.

[0097] like Figure 11 As shown, both groups 3 and 4 had more TUNEL-positive cells, demonstrating that the treatment effects of both groups were superior to those of the cordycepin gavage group, and the growth inhibition effect on melanoma was even better with increasing dosage.

[0098] (3) ELISA detection of IFN-γ in serum

[0099] At the end of the experiment, blood was collected from the eyeballs of all mice, centrifuged, and serum was obtained. Following the reagent manufacturer's instructions, the sample was added to the wells of an ELISA plate. After the colorimetric reaction stopped, dual-wavelength detection was performed using a microplate reader, with the detection wavelength set to 450 nm and the reference wavelength to 610 nm. The concentration of IFN-γ in the sample was calculated.

[0100] like Figure 12 As shown, the serum IFN-γ concentration in mice in each treatment group was significantly higher than that in the model group (group 1), and the differences were statistically significant (**p<0.001; *p<0.05). Compared with the cordycepin gavage group (group 2), the serum IFN-γ concentration in mice in both cordycepin RCA product injection groups was significantly higher, and the increase was more significant in group 4, with statistically significant differences. ## (p<0.001) demonstrates that the treatment effect of both groups was better than that of the cordycepin gavage group, and the growth inhibition effect on melanoma was also better with increasing dose.

[0101] (4) Biosafety testing of cordycepin nanoparticles

[0102] H&E staining analysis is a core safety assessment tool in animal experiments. By visually displaying changes in organ and tissue structure and cell morphology, it can comprehensively reveal the potential toxicity of experimental interventions, verify model stability, and provide morphological evidence for mechanism research.

[0103] At the end of the experiment, mice were anesthetized and euthanized. Hearts, livers, spleens, lungs, and kidneys were harvested. Each tissue was immediately placed in 4% paraformaldehyde for dehydration, paraffin embedding, sectioning, and H&E staining. The tissue sections were then observed under a microscope. Figure 13 It was found that no organic changes were observed in the major organs of mice in each treatment group, demonstrating that the cordycepin nanoparticles have good biocompatibility and can ensure a balance between efficacy and safety.

[0104] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing cordycepin nanodelivery, characterized in that, Using rolling circle amplification (RoBA), cordycepin is linked to circular DNA via base complementarity pairing to obtain cordycepin nanodelivery devices, comprising the following steps: S1. Preparation of circular DNA: The primer chain solution and template chain solution were mixed at a molar ratio of (2~4):1, 5 μL of 10× ligation buffer was added, and double-distilled water was added to a final volume of 50 μL. Annealing was performed using a PCR instrument. The annealing program was as follows: 95℃ for 2 min, 65℃ for 30 min, 50℃ for 30 min, 37℃ for 30 min, and 22℃ for 30 min. After annealing, T4 ligase was added, and the mixture was incubated at 25℃ for 3 h for ligation. The reaction was then terminated by incubation at 65℃ for 10 min to obtain the circular DNA product. The sequence of the primer chain is shown in SEQ ID No:1, and the sequence of the template chain is shown in SEQ ID No:

2. S2. Rolling Circulation Amplification: The prepared circular DNA was mixed with cordycepin solution to prepare a rolling circulation amplification reaction system. The rolling circulation amplification reaction system included circular DNA, cordycepin solution, Φ29 DNA polymerase, dNTPs, BSA, and Φ29 DNA polymerase reaction buffer. The final concentration of cordycepin was 10-16 mM, the final concentration of Φ29 DNA polymerase was 2-3 U / μL, and the final concentration of dNTPs was 1-2 mM / μL. The reaction was performed at 30℃ for 10-60 min, and then the reaction was terminated by incubation at 75℃ for 10 min to obtain the desired cordycepin nanodelivery.

2. The method for preparing a cordycepin nanodelivery as described in claim 1, characterized in that, The primer chain solution and template chain solution are mixed at a concentration ratio of 2:

1.

3. The method for preparing a cordycepin nanodelivery as described in claim 1, characterized in that, The amount of T4 ligase used is 10~20 U / μL.

4. The method for preparing a cordycepin nanodelivery as described in claim 3, characterized in that, The amount of T4 ligase used was 10 U / μL.

5. The method for preparing a cordycepin nanodelivery as described in claim 1, characterized in that, In the rolling circle amplification reaction system, the final concentration of cordycepin was 16 mM, the final concentration of Φ29 DNA polymerase was 2 U / μL, and the final concentration of dNTPs was 2 mM / μL.

6. A cordycepin nanodelivery system, characterized in that, It was prepared using the preparation method described in any one of claims 1-5.

7. The cordycepin nanodelivery as described in claim 6, characterized in that, The cordycepin nanodelivery is composed of nanoparticles with a particle size of 100-120 nm.

8. The use of the cordycepin nanodelivery as described in claim 6 or 7 in the preparation of a drug for treating melanoma.

Images