Application of DCT gene SNP molecular marker in black-bone chicken molecular marker-assisted breeding

Screening the GG and TT genotypes of black-bone chickens through DCT gene SNP molecular markers solved the problem of slow progress in the selection and breeding of black-bone chicken muscle blackness, realized molecular marker-assisted breeding of live chickens, and improved the accuracy and efficiency of breeding.

CN120700162AActive Publication Date: 2025-09-26JIANGSU INST OF POULTRY SCI +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511004822.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-21
Publication Date
2025-09-26
Estimated Expiration
2045-07-21

AI Technical Summary

Technical Problem

The selection and breeding of black-bone chicken muscle black color has been slow and inaccurate. The existing method requires observation after slaughter, which is costly and slows down the genetic progress from generation to generation.

Method used

Using DCT gene SNP molecular markers, two SNP sites of the DCT gene (SNP1 site GG genotype and SNP2 site TT genotype) were screened out through time-of-flight mass spectrometry analysis technology. They were used as molecular markers for the black color of the skin and muscle of black-bone chickens, and were used in molecular marker-assisted breeding of live chickens to screen and eliminate individuals with inferior genotypes.

Benefits of technology

It has accelerated the progress of generational selection for the blackness of the skin and muscles of black-bone chickens, improved the accuracy and efficiency of selection, reduced costs, and realized the feasibility of early selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120700162A_ABST
    Figure CN120700162A_ABST
Patent Text Reader

Abstract

The invention discloses application of a DCT (Discrete Cosine Transform) gene SNP (Single Nucleotide Polymorphism) molecular marker combination in black-bone chicken black-color molecular-assisted breeding, the SNP molecular marker combination comprises two SNP sites SNP1-SNP2, and in black-bone chicken skin and muscle black-color molecular-marker-assisted breeding, a GG dominant genotype individual at the SNP1 site and a TT dominant genotype individual at the SNP2 site can be selected and reserved, so that the black-bone chicken skin and muscle black-color molecular-marker-assisted breeding can be realized. The method for eliminating SNP1-SNP2 site disadvantaged genotype individuals is used for assisting in improving breeding of the black-bone chicken muscle and skin black color, and the black color generation breeding progress is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and in particular to DCT Application of gene SNP molecular markers in molecular marker-assisted breeding of black-bone chicken black color. Background Art

[0002] Black-bone chickens, characterized by their black skin and meat, are beloved by consumers for their high melanin content and unique nutritional and medicinal properties. In the research, development, and utilization of black-bone chickens, the primary research objectives are to achieve these characteristics, with these characteristics being their most notable. Melanin deposition is the primary cause of the dark color, and consumers often judge the quality of a product based on the depth of its dark color. Melanin deposition is a complex regulatory system, controlled by multiple genes and signaling pathways. Dopachrome Tautomerase (DCT), also known as TYRP2, is the most critical, rate-limiting enzyme in melanin synthesis.

[0003] Studies have shown that the muscle brightness L* value reflects the brightness of the muscle surface. The lower the L* value, the darker the muscle color, the higher the muscle blackness, and the higher the melanin content. This establishes that the brightness L* value can be used as a reference indicator for the selection of the blackness trait. Currently, in the breeding process, black-bone chickens are usually slaughtered first, and then the blackness of the muscle of the black-bone chickens after slaughter is observed with the naked eye for selection. The black-bone chickens after slaughter cannot be further grown and developed, and the blackness cannot be observed, which is costly and the generational genetic progress is slow. Therefore, the search for molecular markers that are significantly correlated with the blackness of the skin and muscle does not require the slaughter of black-bone chickens. Molecular markers can be used directly for early selection of the skin and muscle blackness of live chickens, which saves costs and is of great significance for improving the generational selection progress of black-bone chickens with blackness of the skin and muscle. Summary of the Invention

[0004] Aiming at the problem that the current progress of black-bone chicken muscle black color selection is slow, the present invention provides a DCT The application of gene SNP molecular markers in black-bone chicken skin and muscle black color molecular marker assisted breeding. DCT The relevant information of gene SNP molecular markers is as follows:

[0005] The screening method of the SNP molecular marker is as follows: The MassARRAY platform based on time-of-flight mass spectrometry was used to genotype 60 SNP sites of melanin deposition-related genes, and SNP sites without polymorphism were eliminated. The association analysis between polymorphic site genotype and meat color lightness L* value was performed using univariate analysis of variance in the general linear model of SPSS 16.0 software. DCT Two SNP sites in the gene are polymorphic. The correlation between this SNP marker and back skin color, chest skin color, thigh skin color, chest muscle, and thigh muscle brightness L* values ​​was analyzed. The GG genotype at SNP1 had significantly lower L* values ​​for chest muscle, back skin, and chest skin brightness than the GA and AA genotypes, indicating that the GG genotype had a higher degree of darkening of the chest muscle, back skin, and chest skin, making it the dominant genotype for darkening of the chest muscle, back skin, and chest skin. The TT genotype at SNP2 had a significantly lower L* value for chest skin brightness than the CT and CC genotypes, indicating that the TT genotype had a higher degree of darkening of the chest skin, making it the dominant genotype for darkening of the chest skin. DCT The GG and TT genotypes of the two SNPs of the gene can be used as important molecular markers for molecular-assisted breeding of breast muscle, back skin, breast skin and breast skin blackness of black-bone chickens, respectively.

[0006] The nucleotide sequences of the primers for the above-mentioned SNP molecular markers are as follows:

[0007] Specifically, the above DCT The method for applying gene SNP molecular markers in molecular marker-assisted breeding of black-bone chicken muscle blackness includes the following steps: (1) Extract the total genomic DNA of the chicken to be tested; Preferably, the genomic DNA of the chicken to be tested is obtained by collecting blood from the wing vein of an individual of the chicken species.

[0008] (2) Determination of skin and muscle brightness L* value: After slaughtering the live chicken, first measure the brightness L* value of the back skin, chest skin and thigh skin, then measure the thigh skin and chest skin 4cm apart. 2 The skin was cut open (2cm x 2cm) to expose the thigh and chest muscles. The lightness L* values ​​of the thigh and chest muscles were measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were performed by the same person, and the areas measured were essentially the same.

[0009] (3) Design primers based on the SNP sites, perform PCR amplification, and perform sequencing verification and genotyping; The PCR product was sent to a biotechnology company for sequencing. The resulting sequence was compared with the chicken reference genome to identify the polymorphic site. The nucleotide sequence of the PCR product at the SNP site is shown below: DCT -SNP1 site, rs315605008 (mutation site A / G), PCR product: 203 bp.

[0010] GATTGATGGGCAATGAGTCCTTTGCK(A / G)CTTCCCTACTGGGACTTTGCTACAGGTAGAAACACATGTGATGTGTGCACAGACCAGCTCTTGGAGCACCACGGCCAGACGACCCAGGGCTGATCAGCCTGAACTCCAGATTCTCCCGGTGGCAAATAGTTTGCAACAGGTACGGAAATATCTAGGGAAAGCCTGCATACTGACTG.

[0011] DCT -SNP2 site, rs317953595 (mutation site C / T), PCR product: 248 bp.

[0012] CTGAACTCACCGATGCTGAACCTCCATAATTTGGCTCACTCTTTTCTGAATGGAACCAGTGTTCTCCCTCACGCAGCTGCCAAK(C / T)GATCCCATCTTTGTGGTATGGCTTTTTCCTCCAGCATG AGTGCCGCTGGTTGCATATCCGAGGCAGCTGTCTCACCAGAAATTAGCAGAAATAGAAATGAATTCCCTAGAAACAAATTCTTTAATTACAAGAGGACCGCTCTTTCCTTGAACTCTGCCACACCT.

[0013] Note: The K marked in the above sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0014] (4) Based on the genotype results, select individuals with a dominant genotype with higher skin and muscle darkening, and eliminate individuals with a disadvantageous genotype with lower darkening.

[0015] The specific method for determining individuals with the dominant genotype is as follows: DCT The gene SNP1 (rs315605008) site has three genotypes: GG, GA, and AA. The brightness L* values ​​of chest muscle, back skin, and chest skin of the GG genotype were significantly lower than those of the GA and AA genotypes (P <0.05), indicating that the GG genotype individuals have higher darkening of chest muscles, back skin and chest skin, and are the dominant genotypes for darkening of chest muscles, back skin and chest skin. The chest skin brightness L* value of the TT genotype at SNP2 site is significantly lower than that of the CT and CC genotypes ( P <0.05), indicating that the TT genotype has a higher degree of chest skin darkness and is the dominant genotype for chest skin darkness.

[0016] Through the above technical solution, the present invention achieves the following beneficial effects: You can DCT The GG and TT genotypes of the two SNPs in this gene can serve as important molecular markers for the molecular-assisted breeding of breast muscle, back skin, breast skin, and breast skin blackness in black-bone chickens, respectively. By selecting individuals with the GG and TT genotypes and eliminating individuals with other genotypes, this approach can assist in improving the selection of breast muscle, back skin, and breast skin, accelerating the progress of generational selection for breast muscle, back skin, and breast skin blackness. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 In the embodiment of the present invention DCT Mass spectrometry typing diagram of gene SNP1 (rs315605008); Figure 2 In the embodiment of the present invention DCT Mass spectrometry typing diagram of gene SNP2 (rs317953595) site. DETAILED DESCRIPTION

[0018] The present invention aims to solve the problem that conventional breeding of black-bone chicken skin and muscle black color is slow and inaccurate. DCT The application of gene SNP molecular markers in molecular marker-assisted breeding for skin and muscle blackness of black-bone chickens is described in detail below through examples. It should be understood that the specific embodiments described herein are only for the purpose of illustrating and explaining the present invention and are not intended to limit the present invention.

[0019] Example 1 Screening of Molecular Markers Significantly Associated with Black-bone Chicken Muscle Blackness 1. Materials and Methods 192 Silky-bone hens were randomly selected, their foot numbers were recorded, and 1 mL of blood was collected from the sub-wing vein. The blood was anticoagulated with ACD, mixed, and stored at -20°C for later use. DNA was extracted using the conventional phenol-chloroform method. DNA samples from 192 individuals were sent to a biological company for Silky-bone hens melanin related analysis. DCT The gene was detected by mass spectrometry based on the MassARRAY time-of-flight mass spectrometry platform, data was collected, and SNP locus genotyping was performed.

[0020] 2. Determination of skin and muscle brightness L* value After the live chickens were slaughtered, the back skin, chest skin and thigh skin brightness L* value were measured first, and then the thigh skin and chest skin were 4cm apart. 2 The skin was cut open (2cm x 2cm) to expose the thigh and chest muscles. The lightness L* values ​​of the thigh and chest muscles were measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were performed by the same person, and the areas measured were essentially the same.

[0021] 3. Analysis of genotyping and its correlation with muscle brightness L* value 3.1 SNP genotyping The MassARRAY platform based on time-of-flight mass spectrometry was used to genotype 192 individuals at 60 SNP sites of melanin deposition-related genes, and SNP sites without polymorphism were eliminated. DCT The gene has two polymorphic SNP sites. The information of these two SNP sites is shown in Table 1. Both SNP sites have three genotypes. The results of mass spectrometry analysis are shown in Figure 1 and Figure 2 . Figure 1 This is the mass spectrometry typing diagram of SNP1 (rs315605008 A>G), NO call (0), G(24), GA(89), A(79), GG=0.13, GA=0.46, AA=0.41. Figure 2 This is the mass spectrometry typing diagram of SNP2 (rs317953595 C>T), NO call (1), C(39), CT(104), T(48), CC=0.20, CT=0.55, TT=0.25.

[0022] Table 1 DCT Gene polymorphism SNP site information

[0023] 3.2 DCT Genetic polymorphism analysis of SNP loci Haploview 4.1 was used to determine whether the two SNPs were linked and in Hardy-Weinberg (HW) equilibrium. Genotype frequencies, allele frequencies, and heterozygosity were also calculated for the two SNPs. The results are shown in Table 2.

[0024] As shown in Table 2, there are three genotypes at both SNP sites. DCT Gene SNP1 and SNP2 are in HW equilibrium ( P>0.05). SNP1 site Ho=0.464, He=0.459, genetic diversity is high, SNP2 site Ho=0.545, He=0.499, genetic diversity is also high.

[0025] Table 2 DCT Genetic polymorphisms of SNP1 and SNP2 and Hardy-Weinberg equilibrium test

[0026] 3.3 Correlation analysis between SNP markers and skin and muscle brightness L* values The association analysis between polymorphic locus genotype and meat color lightness L* value was performed using univariate analysis of variance in the general linear model of SPSS 16.0 software. The fixed factor was the different genotypes of the SNP marker, and the dependent variables were skin color and meat color lightness L* value. The LSD method was used to compare the significance of the differences in meat color lightness L* value between different marker genotypes. P <0.05 indicates significant difference.

[0027] DCT Correlation analysis between gene SNP markers and skin and muscle brightness L* value traits found DCT The SNP1 site of the gene was significantly correlated with the brightness L* values ​​of chest muscle, back skin, and chest skin, but not with the brightness L* values ​​of thigh muscle and thigh skin. The results are shown in Table 3. DCT The SNP2 site of the gene was significantly correlated with the brightness L* value of the chest skin, but was not correlated with the brightness L* values ​​of the chest skin, thigh skin, chest muscle and thigh muscle. The results are shown in Table 4.

[0028] From Table 3, we can see that DCT The gene SNP1 (rs315605008) site has three genotypes: GG, GA, and AA. The brightness L* values ​​of chest muscle, back skin, and chest skin of the GG genotype were significantly lower than those of the GA and AA genotypes ( P <0.05), indicating that the GG genotype individuals had higher darkening of chest muscles, back skin and chest skin, and were the dominant genotype for darkening of chest muscles, back skin and chest skin.

[0029] As shown in Table 4, the chest skin brightness L* value of the TT genotype at SNP2 was significantly lower than that of the CT and CC genotypes ( P <0.05), indicating that the TT genotype has a higher degree of chest skin darkness and is the dominant genotype for chest skin darkness.

[0030] In breeding, DCTThe GG and TT genotypes of the two SNPs in this gene can serve as important molecular markers for the molecular-assisted breeding of breast muscle, back skin, and breast skin blackness in black-bone chickens, respectively. By selecting individuals with the GG and TT genotypes and eliminating individuals with other genotypes, this method can assist in improving the selection of breast muscle, back skin, and breast skin, and accelerate the progress of generational selection for breast muscle, back skin, and breast skin blackness.

[0031] Table 3 DCT Association analysis between SNP1 gene locus and skin and muscle brightness L* value traits (mean ± standard deviation)

[0032] Note: Different lowercase letters in the same column at the same locus indicate significant differences in meat color brightness L* values ​​between different genotypes ( P <0.05), those without letters indicate that there is no significant difference in meat color brightness L* values ​​among different genotypes ( P >0.05).

[0033] Table 4 DCT Association analysis between SNP2 gene locus and skin and muscle brightness L* value traits (mean ± standard deviation)

[0034] Note: Different lowercase letters in the same column at the same locus indicate significant differences in meat color brightness L* values ​​between different genotypes ( P <0.05), those without letters indicate that there is no significant difference in meat color brightness L* values ​​among different genotypes ( P >0.05).

[0035] Example 2 Molecular marker-assisted breeding of black-bone chicken muscle blackness Through molecular marker-assisted breeding of genes related to the black color of the skin and muscles of Silky Black-bone Chickens, the muscle brightness L* value of the Black-bone Chicken strain B of the Silky Black-bone Chicken matching system was selected, thereby improving the black color of the skin and muscles of the Silky Black-bone Chickens.

[0036] At 4 weeks of age, genotyping was performed on the chickens in the group of black-bone chicken strain B hens, and the dominant genotype individuals with higher muscle blackness were retained. The specific plan is as follows: (1) At 4 weeks of age, 600 (half male and half female) Silky B chickens were blooded from their wing veins using a disposable syringe. DNA was extracted using the phenol-chloroform method. The total genomic DNA of the tested chickens was extracted. DCT The primers for gene SNP1 (rs315605008) and SNP2 (rs317953595) sites, the primer sequences are shown in Table 5.

[0037] Table 5 Primer sequence information

[0038] (2) PCR amplification, electrophoresis, and sequencing for genotyping: PCR amplification products were analyzed using 1.5% agarose gel electrophoresis and sequenced for genotyping. Genotyping of silky-bone chickens was performed, and individuals with a dominant genotype with a higher degree of skin and muscle blackness were retained.

[0039] PCR total reaction system 50 μL: DNA template 4 μL, dNTP (2 mmol / L) 2 μL, Mg 2+ (3 mmol·L -1 ) 0.6 μL, 1× PCR reaction buffer 5 μL, upstream and downstream primers (10 μmol·L -1 ) 1 μL each, Taq polymerase (1 U·μL -1 ) 2.5 μL, and add ultrapure water to 50 μL.

[0040] The PCR reaction procedure was as follows: initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min. The PCR-amplified target fragments were detected by electrophoresis on a 1.5% agarose gel.

[0041] The PCR product was sent to a biotechnology company for sequencing. The resulting sequence was compared with the chicken reference genome to identify the polymorphic site. The nucleotide sequence of the PCR product at the SNP site is shown below: DCT -SNP1 site, rs315605008 (mutation site A / G), PCR product: 203 bp.

[0042] GATTGATGGGCAATGAGTCCTTTGCK(A / G)CTTCCCTACTGGGACTTTGCTACAGGTAGAAACACATGTGATGTGTGCACAGACCAGCTCTTGGAGCACCACGGCCAGACGACCCAGGGCTGATCAGCCTGAACTCCAGATTCTCCCGGTGGCAAATAGTTTGCAACAGGTACGGAAATATCTAGGGAAAGCCTGCATACTGACTG.

[0043] DCT -SNP2 site, rs317953595 (mutation site C / T), PCR product: 248 bp.

[0044] CTGAACTCACCGATGCTGAACCTCCATAATTTGGCTCACTCTTTTCTGAATGGAACCAGTGTTCTCCCTCACGCAGCTGCCAAK(C / T)GATCCCATCTTTGTGGTATGGCTTTTTCCTCCAGCAT GAGTGCCGCTGGTTGCATATCCGAGGCAGCTGTCTCACCAGAAATTAGCAGAAATAGAAATGAATTCCCTAGAAACAAATTCTTTAATTACAAGAGGACCGCTCTTTCCTTGAACTCTGCCACACCT Note: The K marked in the sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0045] (3) Determination of skin and muscle brightness L* value: After the live chickens were slaughtered at 10 weeks of age, the brightness L* value of the back skin, chest skin and thigh skin was first measured, and then the thigh skin and chest skin were 4 cm apart. 2 The skin was cut open (2cm x 2cm) to expose the thigh and chest muscles. The lightness L* values ​​of the thigh and chest muscles were measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were performed by the same person, and the areas measured were essentially the same.

[0046] (4) Molecular marker-assisted breeding of black-bone chicken muscle blackness Will DCT The dominant GG allele at SNP1 (rs315605008) and the dominant TT allele at SNP2 (rs317953595) serve as important molecular markers for breast muscle, back skin, and breast skin blackness in black-bone chickens, respectively. By selecting individuals with the GG and TT genotypes and eliminating individuals with other genotypes, this approach can aid in the selection of improved breast muscle, back skin, and breast skin.

[0047] Molecular marker-assisted breeding was used to improve the blackness of the skin and muscles of the 6th and 7th generations of the black-bone chicken strain B. The operation is simple and can more quickly improve the blackness of the chest muscles, back skin and chest skin. As shown in Table 6, after two generations of breeding, the chest muscle brightness L*, back skin brightness L* and chest skin brightness L* values ​​were significantly lower than those of the 4th generation. The average L* value of each generation was about 2.0 lower than the previous generation, and about 1 higher than the L* value of the 2nd to 5th generations on average. The L* value was significantly reduced, the coefficient of variation CV was also significantly reduced, the blackness of the thigh leg muscles and skin was also significantly improved, and the uniformity of the blackness was also significantly improved, which accelerated breeding and progress.

[0048] Table 6 Measurement results of the skin and muscle brightness L* values ​​of the thighs of different generations of black-bone chicken strain B

[0049] Age at measurement: 70 days.

[0050] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0051] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0052] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A DCT The application of gene SNP molecular markers in molecular marker-assisted breeding of black-bone chicken muscle and skin blackness is characterized in that: The SNP molecular markers include the following two SNP sites: The SNP1 molecular marker is located at position 146490648 on the positive strand of chromosome 1 and is an A or G polymorphism, numbered rs315605008, with a dominant genotype of GG; The SNP2 molecular marker is located at position 146493883 on the positive strand of chromosome 1. It is a C or T polymorphism, numbered rs317953595, and the dominant genotype is TT. The chickens to be selected for breeding with the advantageous genotype are individuals with higher darker muscles and skin.

2. A breeding method for improving the blackness of the skin and muscles of black-bone chickens, characterized in that: The steps include: (1) Determining the genotype of the chicken to be bred, wherein the genotype is the genotype of the SNP molecular marker according to claim 1; (2) Select individuals with the GG dominant genotype at SNP1 and individuals with the TT dominant genotype at SNP2.

3. The breeding method according to claim 2, characterized in that: In step (1), the method for determining the genotype of the chicken to be bred is: (1.1) Extract the total genomic DNA of the chicken to be tested; (1.2) Amplify the target sequence by PCR using a primer pair having the following sequence: SNP1F: 5'GATTGATGGGCAATGAGTCC 3' SNP1R: 5'CAGTCAGTATGCAGGCTTTCC 3' SNP2F: 5'CTGAACTCACCGATGCTGAA 3' SNP2R: 5'AGGTGTGGCAGAGTTCAAGG 3'; (1.3) After sequencing the PCR amplification product, determine the genotype.

4. The breeding method according to claim 3, wherein The nucleotide sequences of the PCR amplification products are shown in SEQ ID No. 1 and SEQ ID No. 2, and the lengths of the PCR products are 203 bp and 248 bp.

Citation Information

Patent Citations

  • Application of TRPM1 gene SNP (Single Nucleotide Polymorphism) molecular marker in black-bone chicken molecular assisted breeding

    CN116891901A

  • Application of ALDH7A1 gene SNP (Single Nucleotide Polymorphism) molecular marker in black-bone chicken molecular assisted breeding

    CN117004738A

  • Application of EDNRB2 gene SNP (Single Nucleotide Polymorphism) molecular marker in black-bone chicken molecular assisted breeding

    CN117004740A

  • Application of MLANA gene SNP molecular marker in black-bone chicken molecular marker-assisted breeding

    CN120330349A