Application of DCT gene SNP molecular marker in molecular marker assisted breeding of Wucheng chicken
By screening two SNP sites in Silkie chickens using the DCT gene SNP molecular marker, the problem of slow progress in the breeding of black color in Silkie chicken muscles was solved. This enabled molecular marker-assisted breeding in live chickens, improving the speed and accuracy of black color selection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-21
- Publication Date
- 2026-04-14
AI Technical Summary
The breeding of black-boned chicken muscle color has progressed slowly and is inaccurate. Current technology requires visual observation after slaughter, which is costly and results in slow generational genetic progress.
Using DCT gene SNP molecular markers, two SNP sites (SNP1 site GG genotype and SNP2 site TT genotype) of the DCT gene were screened out by time-of-flight mass spectrometry analysis. These sites were used as molecular-assisted breeding markers for the blackness of the breast muscle, back skin, and breast skin of Silkie chickens, enabling early selection of live chickens based on the blackness of their skin and muscle.
This technology enables molecular marker-assisted breeding in live chickens, which accelerates the selection process for black skin and muscle coloration in Silkie chickens, saves costs, and allows for more accurate selection of individuals with superior black coloration.
Smart Images

Figure CN120700162B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker-assisted breeding technology, specifically, to... DCT Application of gene SNP molecular markers in marker-assisted breeding of black-boned chicken black color. Background Technology
[0002] Silkie chickens are characterized by their black skin and black meat, and are highly favored by consumers for their high melanin content and unique nourishing and medicinal value. In the research and development of Silkie chickens, "black skin, black meat, and black bones" have been the main research objectives, with "black skin and black meat" being the most prominent characteristics. Melanin deposition is the main cause of the black color, and consumers often judge the quality of a chicken by the depth of its blackness. Melanin deposition is a complex regulatory system, regulated by multiple genes and signaling pathways. Dopachrome Tautomerase (DCT), also known as TYRP2, is the most critical rate-limiting enzyme in melanin synthesis.
[0003] Studies have shown that the muscle brightness L* value reflects the brightness of the muscle surface; the lower the L* value, the darker the muscle color, the higher the muscle blackness, and the higher the melanin content. This establishes the brightness L* value as a reference indicator for breeding blackness traits. Currently, in the breeding process, Silkie chickens are usually slaughtered first, and then the blackness of the muscles after slaughter is observed visually for selection. Slaughtered Silkie chickens cannot undergo further growth and development or blackness observation, which is costly and results in slow generational genetic progress. Therefore, finding molecular markers that are significantly correlated with skin and muscle blackness, eliminating the need for slaughtering Silkie chickens, and directly using molecular markers for early selection of live chicken skin and muscle blackness, is of great significance for improving the generational selection progress of skin and muscle blackness in Silkie chickens. Summary of the Invention
[0004] To address the slow progress in breeding black-colored muscles in Silkie chickens, this invention provides a... DCT Application of gene SNP molecular markers in marker-assisted breeding of skin and muscle blackness in Silkie chickens. DCT The relevant information about gene SNP molecular markers is as follows:
[0005]
[0006] The screening method for the SNP molecular markers is as follows:
[0007] Genotyping of 60 SNP loci related to melanin deposition genes was performed using the MassARRAY platform based on time-of-flight mass spectrometry, excluding SNP loci without polymorphism. Univariate ANOVA in a general linear model using SPSS 16.0 software was used to analyze the association between polymorphic loci genotypes and flesh-colored lightness L* values. After analysis, SNPs were selected... DCT Two SNP loci of the gene showed polymorphism. The correlation between these SNP markers and traits related to back skin color, chest skin color, thigh skin color, chest muscle brightness (L* value) was analyzed. At SNP1, the GG genotype showed significantly lower L* values for chest muscle, back skin, and chest skin brightness compared to the GA and AA genotypes, indicating that individuals with the GG genotype have higher levels of dark chest muscle, back skin, and chest skin brightness, making it the dominant genotype for these traits. At SNP2, the TT genotype showed significantly lower L* values for chest skin brightness compared to the CT and CC genotypes, indicating that the TT genotype has higher levels of dark chest skin brightness, making it the dominant genotype for this trait. DCT The GG and TT genotypes of the two SNPs can serve as important molecular markers for molecular-assisted breeding of the blackness of the breast muscle, back skin, breast skin, and breast skin of Silkie chickens.
[0008] The nucleotide sequences of the primers for the above SNP molecular markers are as follows:
[0009]
[0010] Specifically, the above DCT The application of gene SNP molecular markers in marker-assisted breeding of black-boned chicken muscle color includes the following steps:
[0011] (1) Extract total DNA from the chicken genome to be tested;
[0012] Preferably, the genomic DNA of the chicken to be tested is obtained by collecting blood from the wing vein of an individual of that breed.
[0013] (2) Method for determining the L* value of skin and muscle brightness: After slaughtering the live chicken, first measure the L* value of the skin on the back, chest and thigh. Then measure the L* value of the skin on the thigh and chest at a depth of 4cm. 2 A 2cm x 2cm section of skin was cut open to expose the thigh and chest muscles. The L* values of the thigh and chest muscles were then measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were performed by the same person, and the measured areas were generally consistent.
[0014] (3) Design primers based on SNP sites, perform PCR amplification, and then perform sequencing verification and genotyping;
[0015] The PCR products were sent to a biotechnology company for sequencing. The resulting sequences were compared with the chicken reference genome to identify polymorphic sites. The nucleotide sequences of the SNP site PCR products are shown below:
[0016] DCT -SNP1 site, rs315605008 (mutation site A / G), PCR product: 203 bp.
[0017] GATTGATGGGCAATGAGTCCTTTGCK(A / G)CTTCCCTACTGGGACTTTGCTACAGGTAGAAACACATGTGATGTGTGCACAGACCAGCTCTTGGAGCACCACGGCCAGACGACCCAGGGCTGATCAGCCTGAACTCCAGATTCTCCCGGTGGCAAATAGTTTGCAACAGGTACGGAAATATCTAGGGAAAGCCTGCATACTGACTG.
[0018] DCT -SNP2 site, rs317953595 (mutation site C / T), PCR product: 248 bp.
[0019] CTGAACTCACCGATGCTGAACCTCCATAATTTGGCTCACTCTTTTCTGAATGGAACCAGTGTTCTCCCTCACGCAGCTGCCAAK(C / T)GATCCCATCTTTGTGGTATGGCTTTTTCCTCCAGCATG AGTGCCGCTGGTTGCATATCCGAGGCAGCTGTCTCACCAGAAATTAGCAGAAATAGAAATGAATTCCCTAGAAACAAATTCTTTAATTACAAGAGGACCGCTCTTTCCTTGAACTCTGCCACACCT.
[0020] Note: K marked in the above sequence is the mutation site, and the bases in parentheses are the mutated bases, which are allele mutations.
[0021] (4) Based on the genotype results, select individuals with superior skin and muscle darkness and eliminate individuals with inferior genotypes with lower darkness.
[0022] The specific method for determining the dominant genotype in individuals is as follows: DCTThe SNP1 (rs315605008) locus has three genotypes: GG, GA, and AA. The GG genotype showed significantly lower L* values for chest muscle, back skin, and chest skin brightness compared to the GA and AA genotypes. P <0.05 indicates that individuals with the GG genotype have higher darker chest muscles, back skin, and chest skin, making it the dominant genotype for darker chest muscles, back skin, and chest skin. At the SNP2 locus, the L* value of chest skin brightness in the TT genotype is significantly lower than that in the CT and CC genotypes (…). P <0.05), indicating that the TT genotype has a higher degree of dark skin color on the chest and is the dominant genotype for dark skin color on the chest.
[0023] Through the above technical solution, the present invention achieves the following beneficial effects:
[0024] Can DCT The GG and TT genotypes of two SNPs can serve as important molecular markers for molecular-assisted breeding of breast muscle, back skin, breast skin, and breast skin darkness in Silkie chickens. By selecting individuals with the GG and TT genotypes and eliminating individuals with other genotypes, the breeding of breast muscle, back skin, and breast skin darkness can be improved, thus accelerating the generational selection progress of these traits. Attached Figure Description
[0025] Figure 1 This is an embodiment of the present invention. DCT Mass spectrometry typing of gene SNP1 (rs315605008);
[0026] Figure 2 This is an embodiment of the present invention. DCT Mass spectrometry genotype of gene SNP2 (rs317953595) locus. Detailed Implementation
[0027] This invention addresses the problems of slow and inaccurate conventional breeding practices for the black color of skin and muscle in Silkie chickens, and provides... DCT The application of gene SNP molecular markers in marker-assisted breeding of skin and muscle blackness in Silkie chickens is illustrated below through examples. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.
[0028] Example 1: Screening for molecular markers significantly associated with the black coloration of Silkie chicken muscle
[0029] 1. Materials and Methods
[0030] Ninety-two randomly selected female Silkie chickens were selected, their leg numbers were recorded, and 1 mL of blood was collected from the subwing vein. The blood was anticoagulated with ACD, mixed thoroughly, and stored at -20 °C for later use. DNA was extracted using the standard phenol-chloroform method. DNA samples from the 192 individuals were sent to a biotechnology company for studies related to melanin in Silkie chickens. DCT The gene sequencing was conducted using the time-of-flight mass spectrometry (TOF-MS) MassARRAY platform to collect data and perform SNP locus genotyping.
[0031] 2. Measurement of skin and muscle lightness L* value
[0032] After slaughtering the live chicken, the L* value of the skin brightness of the back, chest, and thigh was first measured. Then, the skin of the thigh and chest was measured at a depth of 4 cm. 2 A 2cm x 2cm section of skin was cut open to expose the thigh and chest muscles. The L* values of the thigh and chest muscles were then measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were performed by the same person, and the measured areas were generally consistent.
[0033] 3. Genotyping and its correlation with muscle brightness L* value
[0034] 3.1 SNP locus genotyping
[0035] Genotyping of 192 individuals at 60 SNP loci related to melanin deposition genes was performed using the MassARRAY platform based on time-of-flight mass spectrometry, after removing SNP loci without polymorphism. DCT The gene has two polymorphic SNP sites, the information of which is shown in Table 1. Each SNP site has three genotypes, as shown in the mass spectrometry analysis results. Figure 1 and Figure 2 . Figure 1 This is the mass spectrometry typing of SNP1 (rs315605008 A>G), NO call (0), G(24), GA(89), A(79), GG=0.13, GA=0.46, AA=0.41. Figure 2 This is the mass spectrometry typing of SNP2 (rs317953595 C>T), NO call (1), C(39), CT(104), T(48), CC=0.20, CT=0.55, TT=0.25.
[0036] Table 1 DCT SNP locus information
[0037]
[0038] 3.2 DCTGenetic polymorphism analysis of SNP loci
[0039] Haploview 4.1 was used to detect whether two SNP loci were linked and whether they were in Hardy-Weinberg (HW) equilibrium. The genotype frequency, allele frequency, and heterozygosity of the above SNP loci were also calculated. The results are shown in Table 2.
[0040] Table 2 shows that both SNP loci have three genotypes. HW equilibrium analysis was performed. DCT Genes SNP1 and SNP2 are in HW equilibrium ( P >0.05). SNP1 locus Ho=0.464, He=0.459, indicating high genetic diversity; SNP2 locus Ho=0.545, He=0.499, indicating high genetic diversity.
[0041] Table 2 DCT Genetic polymorphisms at SNP1 and SNP2 sites and Hardy-Weinberg equilibrium test
[0042]
[0043] 3.3 Correlation analysis of SNP markers with skin and muscle lightness L* values
[0044] Association analysis between polymorphic locus genotypes and flesh color brightness L* values was performed using univariate ANOVA in a general linear model in SPSS 16.0 software. Fixed factors: different genotypes of the SNP markers; dependent variables: skin color and flesh color brightness L* values. The LSD test was used for multiple comparisons to determine the significance of differences in flesh color brightness L* values among different marker genotypes. P <0.05 indicates a significant difference.
[0045] DCT Correlation analysis of gene SNP markers with skin and muscle brightness L* values revealed... DCT The SNP1 site of the gene was significantly correlated with the brightness L* value of chest muscles, back skin, and chest skin, but not with the brightness L* value of thigh muscles and thigh skin. The results are shown in Table 3. DCT The SNP2 site of the gene was significantly correlated with the brightness L* value of chest skin, but not with the brightness L* values of chest skin, thigh skin, chest muscle, and thigh muscle. The results are shown in Table 4.
[0046] As can be seen from Table 3, DCT The SNP1 (rs315605008) locus has three genotypes: GG, GA, and AA. The GG genotype showed significantly lower L* values for chest muscle, back skin, and chest skin brightness compared to the GA and AA genotypes. P<0.05), indicating that individuals with the GG genotype have higher darker chest muscles, back skin, and chest skin, and are the dominant genotype for darker chest muscles, back skin, and chest skin.
[0047] Table 4 shows that the L* value of chest skin brightness in the TT genotype at SNP2 locus was significantly lower than that in the CT and CC genotypes. P <0.05), indicating that the TT genotype has a higher degree of dark skin color on the chest and is the dominant genotype for dark skin color on the chest.
[0048] In breeding, it can be DCT The GG and TT genotypes of two SNPs in the gene can serve as important molecular markers for molecular-assisted breeding of the blackness of the breast muscle, back skin, and breast skin of Silkie chickens, respectively. By selecting individuals with the GG and TT genotypes and eliminating individuals with other genotypes, we can assist in improving the breeding of breast muscle, back skin, and breast skin, and accelerate the generational selection progress of blackness in these three genotypes.
[0049] Table 3 DCT Association analysis of SNP1 gene locus with skin and muscle lightness L* value traits
[0050] (mean ± standard deviation)
[0051]
[0052] Note: Different lowercase letters in the same column at the same locus indicate significant differences in the L* value of flesh color brightness between different genotypes. P <0.05), the absence of a letter indicates that the difference in flesh color brightness L* values between different genotypes is not significant ( P >0.05).
[0053] Table 4 DCT Association analysis of SNP2 gene locus with skin and muscle brightness L* value traits
[0054] (mean ± standard deviation)
[0055]
[0056] Note: Different lowercase letters in the same column at the same locus indicate significant differences in the L* value of flesh color brightness between different genotypes. P <0.05), the absence of a letter indicates that the difference in flesh color brightness L* values between different genotypes is not significant ( P >0.05).
[0057] Example 2: Molecular marker-assisted breeding of black muscle color in Silkie chickens
[0058] By using molecular marker-assisted breeding based on genes related to the blackness of the skin and muscles of Silkie chickens, the L* value of the muscle brightness of Silkie chicken strain B in the Silkie chicken breeding line was selected to improve the blackness of the skin and muscles of Silkie chickens.
[0059] At 4 weeks of age, genotyping was performed on chickens in the Silkie B breed of hens, retaining individuals with the dominant genotype of higher muscle dark color. The specific plan is as follows:
[0060] (1) At 4 weeks of age, blood was collected from the wing veins of 600 Silkie chickens (half male and half female) using disposable syringes. DNA was extracted using the phenol-chloroform method, and total genomic DNA of the chickens to be tested was extracted. The genomic DNA of the chickens to be tested was designed and synthesized. DCT Primers for gene SNP1 (rs315605008) and SNP2 (rs317953595) sites, and primer sequence information are shown in Table 5.
[0061] Table 5 Primer sequence related information
[0062]
[0063] (2) PCR amplification, electrophoresis and sequencing genotyping: PCR amplification products were analyzed by 1.5% agarose gel electrophoresis and sequenced for genotyping. Genotyping was performed on Silkie chickens, and individuals with the dominant genotypes of higher skin and muscle blackness were retained.
[0064] PCR total reaction volume 50 μL: DNA template 4 μL, dNTP (2 mmol / L) 2 μL, Mg 2+ (3 mmol·L) -1 0.6 μL, 5 μL of 1×PCR reaction buffer, and upstream and downstream primers (10 μmol·L⁻¹) -1 1 μL each of Taq polymerase (1 U·μL) -1 Add 2.5 μL of ultrapure water to a final volume of 50 μL.
[0065] PCR reaction procedure: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min. The PCR amplified target fragment was detected by 1.5% agarose gel electrophoresis.
[0066] The PCR products were sent to a biotechnology company for sequencing. The resulting sequences were compared with the chicken reference genome to identify polymorphic sites. The nucleotide sequences of the SNP site PCR products are shown below:
[0067] DCT -SNP1 site, rs315605008 (mutation site A / G), PCR product: 203 bp.
[0068] GATTGATGGGCAATGAGTCCTTTGCK(A / G)CTTCCCTACTGGGACTTTGCTACAGGTAGAAACACATGTGATGTGTGCACAGACCAGCTCTTGGAGCACCACGGCCAGACGACCCAGGGCTGATCAGCCTGAACTCCAGATTCTCCCGGTGGCAAATAGTTTGCAACAGGTACGGAAATATCTAGGGAAAGCCTGCATACTGACTG.
[0069] DCT -SNP2 site, rs317953595 (mutation site C / T), PCR product: 248 bp.
[0070] CTGAACTCACCGATGCTGAACCTCCATAATTTGGCTCACTCTTTTCTGAATGGAACCAGTGTTCTCCCTCACGCAGCTGCCAAK(C / T)GATCCCATCTTTGTGGTATGGCTTTTTCCTCCAGCAT GAGTGCCGCTGGTTGCATATCCGAGGCAGCTGTCTCACCAGAAATTAGCAGAAATAGAAATGAATTCCCTAGAAACAAATTCTTTAATTACAAGAGGACCGCTCTTTCCTTGAACTCTGCCACACCT
[0071] Note: K marked in the sequence is the mutation site, and the mutated base in parentheses is the allele mutation.
[0072] (3) Method for determining the L* value of skin and muscle brightness: After slaughtering live chickens at 10 weeks of age, first measure the L* value of the skin on the back, chest, and thighs, and then measure the L* value of the skin on the thighs and chest at a depth of 4cm. 2 A 2cm x 2cm section of skin was cut open to expose the thigh and chest muscles. The L* values of the thigh and chest muscles were then measured using a TC.PIIG fully automatic colorimeter. All skin and flesh color measurements were performed by the same person, and the measured areas were generally consistent.
[0073] (4) Molecular marker-assisted breeding of black-boned chicken muscle blackness
[0074] Will DCTThe GG dominant allele at SNP1 (rs315605008) and the TT dominant allele at SNP2 (rs317953595) serve as important molecular markers for molecularly assisted breeding of breast muscle, back skin, and breast skin blackness in Silkie chickens. The method of selecting individuals with the GG and TT genotypes and excluding individuals with other genotypes helps to improve the quality of breast muscle, back skin, and breast skin in selective breeding.
[0075] Molecular marker-assisted breeding was used to improve the skin and muscle blackness of the 6th and 7th generations of Silkie chicken strain B. This method is simple to operate and can more quickly improve the blackness of the breast muscle, back skin, and breast skin. As shown in Table 6, after two generations of selection, the brightness values of breast muscle (L*), back skin (L*), and breast skin (L*) were all significantly lower than those of the 4th generation. On average, the L* value of each generation was about 2.0 lower than the previous generation, and the L* value of each generation was about 1 higher than that of the 2nd to 5th generations. The L* value was significantly reduced, the coefficient of variation (CV) was also significantly reduced, and the blackness of the thigh and leg muscles and skin was significantly improved. The uniformity of blackness was also significantly improved, which accelerated the selection and progress.
[0076] Table 6. Results of L* value determination of thigh skin and muscle brightness in different generations of Silkie chicken strain B
[0077]
[0078] Age determined: 70 days.
[0079] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0080] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.
[0081] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.
Claims
1. A detection method DCT The application of SNP molecular marker reagents in molecular marker-assisted breeding of black-boned chicken muscle and skin blackness is characterized by, The SNP molecular markers include the following two SNP sites: The SNP1 molecular marker is located at the position of base K in SEQ ID No. 1, where K is either A or G polymorphism. The SNP1 molecular marker number is rs315605008, and the dominant genotype is GG. The SNP2 molecular marker is located at the position of base K in SEQ ID No. 2, where K is a C or T polymorphism. The SNP2 molecular marker number is rs317953595, and the dominant genotype is TT. Chickens with the superior genotype are those with higher muscle and skin darker coloration.
2. A breeding method for improving the blackness of the skin and muscles of Silkie chickens, characterized in that, Includes the following steps: (1) Determine the genotype of the chickens to be bred, wherein the genotype is the genotype of the SNP molecular marker as described in claim 1; (2) Select individuals with the dominant genotype GG at SNP1 and individuals with the dominant genotype TT at SNP2.
3. The breeding method according to claim 2, characterized in that, In step (1), the method for determining the genotype of the chickens to be bred is as follows: (1.1) Extract total DNA from the chicken genome to be tested; (1.2) The target sequence was amplified by PCR using primer pairs, the sequences of which are as follows: SNP1F: 5'GATTGATGGGCAATGAGTCC 3' SNP1R: 5'CAGTCAGTATGCAGGCTTTCC 3' SNP2F: 5'CTGAACTCACCGATGCTGAA 3' SNP2R: 5'AGGTGTGGCAGAGTTCAAGG 3'; (1.3) Sequencing the PCR amplification products to determine the genotype.
4. The breeding method according to claim 3, characterized in that, The nucleotide sequences of the PCR amplification products are shown in SEQ ID No. 1 and SEQ ID No. 2, and the lengths of the PCR products are 203 bp and 248 bp, respectively.
Citation Information
Patent Citations
Application of TRPM1 gene SNP (Single Nucleotide Polymorphism) molecular marker in black-bone chicken molecular assisted breeding
CN116891901A
Application of ALDH7A1 gene SNP (Single Nucleotide Polymorphism) molecular marker in black-bone chicken molecular assisted breeding
CN117004738A