Primer of a vps13c gene molecular marker related to porcine eye muscle area trait and application thereof

VPS13C gene molecular markers were screened through genome-wide association analysis, and SNP genotypes in pigs were detected using PCR and Sanger sequencing. This solved the problem of rapid screening of pig eye muscle area, improving breeding efficiency and meat quality.

CN120700165BActive Publication Date: 2026-04-24NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511143204.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-15
Publication Date
2026-04-24
Estimated Expiration
2045-08-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately screen pigs with ideal eye muscle area, affecting breeding efficiency and resource utilization.

Method used

VPS13C gene molecular markers significantly associated with ocular muscle area in pigs were screened through genome-wide association analysis. SNP genotypes in pigs were detected by PCR amplification and Sanger sequencing. Specific primer pairs were designed for genotype identification. Individuals with C/C genotypes were eliminated, while individuals with G/C genotypes were retained to increase ocular muscle area.

Benefits of technology

This technology enables rapid and accurate screening of eye muscle area traits in pigs, improving breeding efficiency and resource utilization, reducing breeding costs, and cultivating pig breeds with tender meat and good taste.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120700165B_ABST
    Figure CN120700165B_ABST
Patent Text Reader

Abstract

The application relates to a primer of a VPS13C gene molecular marker related to a porcine eye muscle area trait and application thereof, and belongs to the technical field of biology. The VPS13C gene molecular marker of the application is located at the 110033015 base of chromosome No. 1 of a porcine reference genome Sscrofa11.1 version 1, the base mutation is G, and the genotype is G / C and C / C. The eye muscle area degree of the G / C genotype porcine is higher than that of the C / C genotype individual. The application amplifies the fragment containing the above-mentioned molecular marker site by using the forward and reverse primers, and carries out Sanger sequencing on the amplification product, so that the genotype of the individual can be quickly and accurately identified; the molecular marker can be used as a genetic marker for porcine breeding, and pigs with appropriate sizes are selected and bred; the eye muscle area of the porcine can be efficiently and accurately detected, and the application has important values for porcine breeding and production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to primers for a molecular marker of the VPS13C gene associated with the porcine eye muscle area trait and their applications, belonging to the field of biotechnology. Background Technology

[0002] Eye muscle area refers to the cross-sectional area of ​​the longissimus dorsi muscle at the last rib of a pig. In pig breeding, lean meat percentage is a crucial economic trait. Selecting pigs with large eye muscle areas for breeding can increase the lean meat yield of offspring. Pigs with large eye muscle areas typically exhibit better growth performance and feed conversion ratios. Because of their high muscle growth efficiency, they can produce more lean meat with the same feed input. This means farmers can reduce feed costs while maintaining pork production. Eye muscle area is also related to meat tenderness; an appropriately sized eye muscle area helps ensure tender pork. If the eye muscle area is too large, the muscle fibers may become coarse, leading to tougher meat; while if the eye muscle area is too small, it may affect the pork's texture and juiciness. By selecting pigs with appropriate eye muscle areas, it is possible to cultivate pig breeds with tender meat and excellent taste.

[0003] Therefore, accurately identifying genotypes associated with the eye muscle area trait after calving using molecular markers and applying them to early breeding selection can accelerate the breeding cycle, reduce time and feeding costs, and improve resource utilization. Summary of the Invention

[0004] The purpose of this invention is to address the deficiencies of existing technologies by proposing a primer for the VPS13C gene molecular marker related to the trait of pig eye muscle area and its application, which can quickly and accurately screen pigs with ideal eye muscle area.

[0005] The VPS13C gene is associated with ocular muscle area in pigs. The protein encoded by the VPS13C gene mediates lipid transfer between membranes at organelle contact sites, playing a crucial role in intracellular lipid distribution and metabolic homeostasis. It transports lipids from the endoplasmic reticulum to lysosomes and other organelles, participating in intracellular lipid transport and metabolism. Therefore, the VPS13C gene may also be associated with ocular muscle area through the regulation of lipid metabolism in pigs.

[0006] This invention measures the eye muscle area of ​​pigs, performs whole-genome SNP genotyping using second-generation sequencing technology, and screens the VPS13C gene molecular marker, which is significantly associated with the eye muscle area trait in pigs, through genome-wide association analysis, providing new gene and molecular marker resources for breeding pigs with the eye muscle area trait.

[0007] The present invention solves the technical problem through the following technical solution: First, it provides a VPS13C gene molecular marker related to the trait of pig eye muscle area. The molecular marker is located at the 110033015th base of pig chromosome 1, with the base mutated to G. The sequence is shown as the 102nd base of SEQ ID NO:3 or SEQ ID NO:4. The nucleotide sequences of the pig DNA-specific primer pairs required for molecular marker detection are shown as SEQ ID NO:1 and SEQ ID NO:2.

[0008] This invention further provides an application of the VPS13C gene molecular marker associated with the porcine eye muscle area trait, including its use in detecting SNP genotypes related to porcine eye muscle area. Specifically, the method for detecting SNP genotypes related to porcine eye muscle area trait using PCR amplification combined with Sanger sequencing includes the following steps:

[0009] The first step involved PCR amplification using DNA-specific primers designed for the VPS13C gene molecular marker, yielding the amplification product. The porcine DNA sample to be tested contained an SNP molecular marker at position 102 of porcine chromosome 1.

[0010] The second step is to perform Sanger sequencing on the PCR products.

[0011] The third step is to determine the SNP molecular marker genotype at position 102 of chromosome 1 of pig based on the sequencing results from the second step.

[0012] The deoxyribonucleotide sequence of the DNA-specific primer pair mentioned in the first step is as follows:

[0013] Upstream primer: 5'- AGTCCAGGCTGCAGAAAGAG -3' (SEQ ID NO: 1)

[0014] Downstream primer: 5'-CAACCACTGACCAAAGACCG-3' (SEQ ID NO: 2)

[0015] The amplification product described in the first step is 502 bp in length and contains the 110033015th base on chromosome 1 of pig.

[0016] The final concentration of the reaction system (25 μl) is:

[0017] 50 ng of pig DNA to be tested

[0018] 2 x Accurate Taq Master Mix 12.5μl

[0019] upstream primer 1 μl

[0020] 1 μl of downstream primer

[0021] Add sterile water to a final volume of 25 μl.

[0022] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 4℃.

[0023] In the third step, the criterion is that the eye muscle area of ​​pigs with the SNP site being G / C is higher than that of individuals with the C / C genotype at all stages.

[0024] This invention uses the VPS13C gene molecular marker to detect the genotype of the pig's eye muscle area trait, finding that G / C genotype pigs have a higher eye muscle area than C / C genotype individuals. Using the genomic DNA of the test pigs as a template, specific primers are used for PCR amplification. The PCR amplification products are then subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotype of this SNP molecular marker, selection of pigs with the eye muscle area trait can be achieved. In breeding, according to breeding objectives, by culling C / C genotype individuals and retaining G / C genotype individuals, the beneficial effects are that this molecular marker can serve as a genetic marker for pig breeding, selecting pigs with moderate eye muscle area; it can efficiently and rapidly identify the pig's eye muscle area trait and improve the uniformity of eye muscle area, providing a scientific basis for early selection in pig breeding, and has significant value for pig breeding.

[0025] Furthermore, the detection method disclosed in this invention is simple and easy to operate, and can be carried out in a laboratory. Attached Figure Description

[0026] Figure 1 These are Sanger sequencing results of PCR amplification products from three genotypes. Detailed Implementation

[0027] The following examples are applicable to the breeding of pigs.

[0028] Example

[0029] In this embodiment, the eye muscle area of ​​500 Large White pigs was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The VPS13C gene molecular marker, which is significantly associated with eye muscle area, was screened through genome-wide association analysis.

[0030] This embodiment uses the following experiments to identify and apply the VPS13C gene molecular marker related to the porcine eye muscle area trait.

[0031] 1. Phenotypic determination and genotypic testing

[0032] (1) Experimental materials and determination of egg weight phenotype

[0033] Five hundred Large White pigs were selected as experimental animals and raised under the same feeding conditions. Throughout the process, they were given free access to food and water. The eye muscle area of ​​the five hundred pigs was recorded as phenotypic data of the pig eye muscle area.

[0034] (2) Extraction of genomic DNA

[0035] ① Take 25 mg of ear tissue from the left and right sides and place it in a centrifuge tube. Add the mixture to a 1.5 ml centrifuge tube, add 400 µl of Buffer Digestion, and vortex to mix. Incubate at 65°C for 1 h until the cells are completely lysed.

[0036] ② Add 20 μL of Proteinase K solution, vortex to mix, and place in a 56°C water bath for digestion overnight.

[0037] ③ Add 200 µl of Buffer PA, mix thoroughly by inverting, and place in a -20°C refrigerator for 5 min.

[0038] ④ Centrifuge at 10,000 rpm for 5 min at room temperature, and transfer the supernatant (500-550 µl) to a new 1.5 ml centrifuge tube.

[0039] ⑤ Add an equal volume of isopropanol, invert 5-8 times to mix thoroughly, and let stand at room temperature for 2-3 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature and discard the supernatant.

[0040] ⑥ Add 1 ml of 75% ethanol, rinse by inversion for 1-3 min, centrifuge at 10,000 rpm for 2 min, and discard the supernatant.

[0041] ⑦ Repeat step 6.

[0042] ⑧ Open the lid and invert at room temperature for 5-10 minutes until the residual ethanol has completely evaporated.

[0043] ⑨ Dissolve the obtained DNA in 50-100 µl of TE buffer. The extracted DNA can be used immediately for the next experiment or stored at -20°C.

[0044] ⑩ Determine the concentration. After measuring the mass and concentration with a spectrophotometer, dilute the concentration to 50 ng / μL and store at -20℃ for later use.

[0045] (3) PCR amplification

[0046] Using the extracted genomic DNA as a template, the fragment containing base 110033015 of chromosome 1 was amplified.

[0047] Upstream primer: 5'- AGTCCAGGCTGCAGAAAGAG -3' (SEQ ID NO: 1)

[0048] Downstream primer: 5'-CAACCACTGACCAAAGACCG-3' (SEQ ID NO: 2)

[0049] The final concentration of the reaction system (25 μl) is:

[0050] DNA to be tested 50 ng

[0051] 2 x Accurate Taq Master Mix 12.5μl

[0052] upstream primer 1 μl

[0053] 1 μl of downstream primer

[0054] Add sterile water to a final volume of 25 μl.

[0055] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; storage at 4℃; 10 μl was used for agarose gel assay, and a single target band of 540 bp was obtained. The amplified product contained the SNP marker at position 110033015 of porcine chromosome 1.

[0056] The amplified product sequence is shown in SEQ ID NO:3

[0057] TCAACAGAACTTCCTCAACAATTTTCAAACTGCCAAAGAAGCTTTGAGCACAGCTACAGTCCAGGCTGCAGAAAGAGCTGCTTCCAGCAT

[0058] GAAAGACTTGGCTGAAAAGAGTTTCCGCCTTTTGATGGATATAAATTTGAAAGCACCAGTCATTATCATTCCTCAGTCTTCAGTATCACC

[0059] TAATGCTGTTATAGCAGATTTGGGTTTAATCAAAGTTGAAAACAAATTTAGCATAGTTTCTATGGACACTTCTCTTCCCCCTGTCATTGA

[0060] CAAAATGGACATCCAACTCACTCAGCTGAAGCTGTCCAGGTATAAATATATAATCTGATTGTGTATTACTTACTTGAAATAGAATTTTCA

[0061] TAGAGTCTTTGCCAGGGATAAAATACTGTCATGATTTATCATTCTTATTTCTTGTTTCTTCTAATTTTGTAAACTTGACCATCGGTCTTT

[0062] GGTCAGTGGTTGATAATGGTGTACCTCATACAATCTGCATTTTGTCTTACTAAATTTACCATTTTTTCATTCTATAAAATTCTCCTATTA

[0063] or as shown in SEQ ID NO:4, TCAACAGAACTTCCTCAACAATTTTCAAACTGCCAAAGAAGCTTTGAGCACAGCTACAGTCCAGGCTGCAGAAAGAGCTGCTTCCAGCAT

[0064] GAAAGACTTGGCTGAAAAGAGTTTCCGCCTTTTGATGGATATAAATTTGAAAGCACCAGTCATTATCATTCCTCAGTCTTCAGTATCACC

[0065] TAATGCTGTTATAGGAGATTTGGGTTTAATCAAAGTTGAAAACAAATTTAGCATAGTTTCTATGGACACTTCTCTTCCCCCTGTCATTGA

[0066] CAAAATGGACATCCAACTCACTCAGCTGAAGCTGTCCAGGTATAAATATATAATCTGATTGTGTATTACTTACTTGAAATAGAATTTTCA

[0067] TAGAGTCTTTGCCAGGGATAAAATACTGTCATGATTTATCATTCTTATTTCTTGTTTCTTCTAATTTTGTAAACTTGACCATCGGTCTTT

[0068] GGTCAGTGGTTGATAATGGTGTACCTCATACAATCTGCATTTTGTCTTACTAAATTTACCATTTTTTCATTCTATAAAATTCTCCTATTA.

[0069] (4) Sanger sequencing and genotyping

[0070] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagrams of different genotypes were obtained as follows: Figure 1 As shown.

[0071] (5) Genotyping and genome-wide association analysis of 60K SNP microarray in the pig genome

[0072] Genotyping of pigs was performed according to the company's standard procedures. The "Zhongxin-1" 50K SNP chip was used to detect SNP genotypes in breeding pigs with ocular muscle area measurement records. Quality control was performed on all SNP marker detection results. Genome-wide association analysis revealed that multiple significant SNPs at the genome level were concentrated on pig chromosome 1.

[0073] 2. Correlation analysis

[0074] Five hundred Large White pigs with clearly recorded ocular muscle area phenotypes were selected, and their ocular muscle area was recorded. Statistical analysis was performed using the ANOVA function in R 4.2 statistical plotting software. Pairwise comparison of means was used to statistically analyze the genotype and average daily weight gain of the experimental pig population. P < 0.05 indicated a significant difference. The results showed that the average ocular muscle area of ​​the G / C genotype individuals was 33.1 cm², higher than the 30.4 cm² of the C / C genotype (P < 0.05). These results indicate a significant correlation between the porcine VPS13C gene molecular marker and the ocular muscle area trait. Based on actual breeding goals, selecting G / C genotype individuals to choose pigs with larger ocular muscle areas can improve the overall ocular muscle area and uniformity, thereby increasing breeding efficiency.

[0075] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. Primers for a VPS13C gene molecular marker associated with porcine eye muscle area traits, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:

2. The molecular marker site is located at base 110033015 on chromosome 1 of the pig reference genome Sscrofa11.1 version, with a base mutation of G, and the genotypes are G / C and C / C.

2. The application of the primers for the VPS13C gene molecular marker related to the porcine eye muscle area trait as described in claim 1, characterized in that: The primers were used to detect SNP genotypes related to porcine ocular muscle area. The detection method included the following steps. The first step is to perform PCR amplification on the DNA sample of the pig to be tested using the SNP primers shown in SEQ ID NO:1-2, and obtain the amplification product containing the base at position 110033015 of chromosome 1 of the pig reference genome Sscrofa11.1 version; The second step is to perform Sanger sequencing on the PCR products. The third step is to determine the SNP molecular marker genotype at position 110033015 on chromosome 1 of the pig reference genome Sscrofa 11.1 based on the sequencing results of the second step. The criterion is that the eye muscle area of ​​pigs with the SNP site being G / C is higher than that of individuals with the C / C genotype at all stages.

3. The application of the primers for the VPS13C gene molecular marker related to the porcine eye muscle area trait as described in claim 2, characterized in that: In the first step, the PCR reaction system is calculated in 25 μl units, and the system is as follows: 50 ng of pig DNA to be tested 2 x Accurate Taq Master Mix 12.5μl upstream primer 1 μl 1 μl of downstream primer Add sterile water to a final volume of 25 μl.

4. The application of the primers for the VPS13C gene molecular marker related to the porcine eye muscle area trait as described in claim 3, characterized in that: The PCR amplification reaction conditions in the first step are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; and storage at 4℃.

Citation Information

Patent Citations

  • SNP molecular marker which is positioned on No.7 porcine chromosome and related to area and thickness of eye muscles and application

    CN110218798A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to eye muscle area of large white pig and application of SNP molecular marker

    CN118460742A