A molecular marker and its use in identifying sheep susceptible to brucellosis
By using genome-wide association analysis and genotyping technology, SNP molecular markers associated with susceptibility to brucellosis in sheep were discovered. Primer pairs and probes were designed, and kits were provided for identification and breeding. This solved the problems of early diagnosis and breeding of brucellosis in sheep, improved breeding efficiency, and reduced antibiotic use and environmental pollution.
Patent Information
- Application Number
- CN202511222845.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2045-08-29
AI Technical Summary
Existing technologies are insufficient to effectively identify and block the spread of brucellosis in sheep, making early diagnosis difficult and late-stage eradication challenging. Furthermore, the frequent use of antibiotics poses a high risk of environmental pollution and drug residues.
Genome-wide association analysis was used to identify SNP molecular markers in the sheep genome that are associated with susceptibility to brucellosis. Primer pairs and probes were designed, and gene chips were used for genotyping. Kits were provided for identification and breeding to screen sheep breeds with low susceptibility to brucellosis.
It enables early prediction and accurate identification of sheep susceptibility to brucellosis, improves breeding efficiency, reduces antibiotic use, protects the environment, develops disease-resistant breeds, and reduces the risk of drug residues.
Smart Images

Figure CN120700167B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker and application thereof in identifying sheep brucellosis susceptibility. BACKGROUND
[0002] Brucellosis is a zoonosis caused by Brucella bacteria that can be transmitted between animals and humans. The disease often manifests clinically as recurrent undulant fever, physical fatigue, and significant reproductive system dysfunction, such as orchitis and epididymitis in male animals, and abortion and endometritis in female animals. As a facultative intracellular parasite, Brucella has a unique immune escape mechanism, which makes the infection process often present in a latent state and chronic development, leading to difficulties in early diagnosis and eradication in the late stage. It is particularly noteworthy that ovine Brucella is the most virulent and contagious among all Brucella; and sheep and goats, as susceptible hosts, are one of the most dangerous sources of human infection, posing a serious threat to the current sheep breeding industry.
[0003] In genomics research, single nucleotide polymorphism (SNP) is the most common type of genetic variation, which is essentially a variation caused by the substitution of a single nucleotide in the genomic DNA sequence. This substitution can be divided into two categories: transition, which is the substitution between the same type of bases (such as between purines G / A or between pyrimidines T / C); and transversion, which is the substitution between different types of bases (such as between purines and pyrimidines). In the breeding practice of livestock and poultry, SNP has been widely used as an efficient genetic marker and applied to genomic analysis. Through the detection of SNP sites, researchers can accurately identify and distinguish the genotypes of animal individuals, thereby providing key information for analyzing the genetic mechanisms of important economic traits such as disease resistance and production performance.
[0004] Therefore, in the sheep population as the main host, it is of great practical significance to excavate molecular markers related to brucellosis susceptibility and apply them to assist in the breeding of disease-resistant sheep. This method not only fundamentally blocks the spread of brucellosis from the genetic level, effectively implementing the advanced prevention and control concept of “preventing human disease from animals” and “moving the control point forward”, but also reduces the use of antibiotics by breeding disease-resistant varieties, thereby reducing the environmental pollution and product drug residue risks caused by the abuse of antibiotics. SUMMARY
[0005] In order to solve the problems existing in the prior art, the present application provides a molecular marker and application thereof in identifying sheep brucellosis susceptibility.
[0006] The present application finds the SNP molecular marker related to the susceptibility of sheep to brucellosis in the sheep genome through whole genome association analysis of the susceptibility of different breeds of sheep to brucellosis, and proves that the SNP molecular marker is significantly related to the susceptibility of sheep to brucellosis through population verification, and can be used for detecting the susceptibility of sheep to brucellosis.
[0007] In a first aspect, the present application provides a molecular marker comprising a nucleic acid of a nucleotide sequence as shown in SEQ ID NO. 1, wherein a polymorphism of C / G exists at position 101.
[0008] The nucleotide sequence as shown in SEQ ID NO. 1:
[0009] AGGTACAGTTATCATCACCATTTCATGATAAGGAGGCTGAGGCTCACAGTGATCAAATAACACAGATCACACACGTCCAGAGTCTTAGACACACTGAAAGSTGAGGCTAGCTGATCCCAGTGCCCATTAACAATGAGGAGTCCCATCCTAGAACTAAGACGTCTCAAGAAATAGCAGAGATGCTGGTCTAGTTGGGGAAA.
[0010] Wherein S represents C or G (according to the international standard IUPAC-IUBMB).
[0011] Specifically, the polymorphic site of the aforementioned molecular marker is located at position 67849582 of chromosome 5 of the reference genome version number Oar_v4.0, and the polymorphism is C / G.
[0012] In a second aspect, the present application provides a primer pair for amplifying the aforementioned molecular marker. The design method of the primer pair of the present application can be the conventional method of the present application, and the skilled person can design primer pairs (including primer pairs or KASP primer combinations) of different lengths for amplifying the aforementioned molecular marker according to the existing primer design rules and primer design software (such as primer).
[0013] Further, the present application provides a probe for amplifying the aforementioned molecular marker. The existing technology has mature technical guidance and means for designing probes for molecular markers, and the probes designed according to the existing technical guidance are within the protection scope of the present application.
[0014] Further, the present application provides a gene chip comprising the probe. The prior art also has mature gene chip design means, which can comprise the aforementioned probe alone, or prepare a gene chip by combining the aforementioned probe with other probes for genotyping or molecular marker assisted breeding.
[0015] In a third aspect, the present application provides a primer pair comprising the nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0016] SEQ ID NO. 2: 5'-GTCCCTCATTTCACTGCATTTG-3';
[0017] SEQ ID NO. 3: 5'-ACATGGTTGGGGTACATGGG-3'.
[0018] The primer combination described above can achieve efficient amplification and genotyping for the aforementioned molecular marker.
[0019] In a fourth aspect, the present application provides a kit comprising the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned gene chip.
[0020] In a fifth aspect, the present application provides the SNP site as a target for use in any of the following:
[0021] (1) predicting or detecting the susceptibility of sheep to brucellosis, or preparing a reagent for predicting or detecting the susceptibility of sheep to brucellosis;
[0022] (2) identifying or breeding sheep breeds with low susceptibility to brucellosis, or preparing a reagent for identifying or breeding sheep breeds with low susceptibility to brucellosis;
[0023] (3) molecular marker assisted breeding of sheep brucellosis susceptibility;
[0024] (4) improvement of sheep breeds related to brucellosis susceptibility;
[0025] (5) improvement of sheep germplasm resources;
[0026] The SNP site is located at position 67849582 of chromosome 5 of the reference genome version number Oar_v4.0, and the polymorphism is C / G.
[0027] The target of the present application includes existing conventional nucleotide detection methods and reagents, such as gene sequencing, primer amplification design, probe targeting detection, etc.
[0028] In a sixth aspect, the present application provides use of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned gene chip, or the aforementioned kit in any one of the following:
[0029] (1) predicting or detecting Brucellosis susceptibility of sheep, or preparing a reagent for predicting or detecting Brucellosis susceptibility of sheep;
[0030] (2) identifying or breeding a sheep breed with low Brucellosis susceptibility, or preparing a reagent for identifying or breeding a sheep breed with low Brucellosis susceptibility;
[0031] (3) molecular marker assisted breeding of Brucellosis susceptibility of sheep;
[0032] (4) improvement of a sheep breed related to Brucellosis susceptibility;
[0033] (5) improvement of a sheep germplasm.
[0034] The improvement of a sheep breed related to Brucellosis susceptibility according to the present application includes: breeding sheep by using the aforementioned molecular marker, for example, selecting an individual with genotype CC in the breeding process.
[0035] In a seventh aspect, the present application provides a method for identifying Brucellosis susceptibility of sheep, comprising:
[0036] detecting polymorphism of the aforementioned molecular marker in a sample of a sheep to be tested, and determining Brucellosis susceptibility of the sheep to be tested according to the genotype detection result.
[0037] Further, the detection method comprises one or more of PCR amplification, gene sequencing, molecular probe, liquid phase capture or mass spectrometry.
[0038] Further, the determination of Brucellosis susceptibility of the sheep to be tested according to the genotype detection result comprises: genotype CC corresponding to low Brucellosis susceptibility, and genotype CG corresponding to high Brucellosis susceptibility.
[0039] Taking the aforementioned primer pair as an example, the amplification result at position 249 corresponds to the polymorphic site, thereby realizing the identification of Brucellosis susceptibility of the sheep to be tested. In fact, in addition to this, the detection of the polymorphism of the molecular marker can also be directly realized by any method of gene sequencing, molecular probe, liquid phase capture or mass spectrometry (all of which are conventional methods in the art).
[0040] In an eighth aspect, the present application provides a method for breeding a sheep breed with low Brucellosis susceptibility, comprising: selecting a sheep individual with genotype CC of the aforementioned molecular marker in the breeding process of sheep, and then performing the subsequent breeding process.
[0041] The brucellosis is brucellosis caused by Brucella infection of sheep.
[0042] The present application has the following beneficial effects:
[0043] The application discloses a molecular marker related to sheep brucellosis susceptibility, which can more accurately detect the susceptibility of sheep to brucellosis, realizes early prediction of the susceptibility of sheep to brucellosis, and is not limited by the age and gender of sheep. The molecular marker provided by the application can be used for detection of the susceptibility of sheep to brucellosis and molecular marker assisted breeding, has important significance for prevention and screening of sheep susceptible to brucellosis, effectively improves breeding efficiency, and has important significance for development and utilization of excellent economic characteristics of sheep excellent breeds and protection and rational utilization of breed resources. BRIEF DESCRIPTION OF DRAWINGS
[0044] In order to more clearly illustrate the technical solutions of the present application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can obtain other drawings according to these drawings without creative labor.
[0045] Figure 1 is the expansion verification result of the SNP molecular marker disclosed in embodiment 2 of the present application in a sheep population, wherein, represents p<0.01. DETAILED DESCRIPTION
[0046] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions of the present application will be described clearly and completely in the following combined with the drawings in the present application. Obviously, the described embodiments are some embodiments of the present application, not all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.
[0047] The experimental methods involved in the following embodiments are all conventional methods in the art if not specifically mentioned, for example, the experimental manual in the art can be referred to, or the conditions suggested in the manufacturer's instruction can be followed.
[0048] The experimental materials and reagents involved in the following embodiments can be obtained from commercial channels if not specifically mentioned.
[0049] Example 1: Screening of SNP molecular marker related to susceptibility of sheep to brucellosis
[0050] In the embodiment, a method is used to develop SNP molecular markers related to the susceptibility of sheep to brucellosis by using whole genome association analysis (GWAS) on a sample of a population of sheep infected with brucellosis, and the specific steps are as follows:
[0051] (1) Blood collection and serological detection.
[0052] Blood samples of 50 Texel sheep raised under the same conditions were collected, and the concentration of brucella antibodies in the sheep serum was detected by using competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA) and fluorescence polarization assay (FPA), respectively. The detection results were used as the resistance index of sheep brucellosis and as the phenotype data for GWAS analysis.
[0053] (2) Total DNA extraction, genome resequencing and quality control.
[0054] The blood DNA samples of the above-mentioned 50 sheep were subjected to whole genome resequencing, and the sequencing depth was 20x. Sequence alignment and quality control were performed on the sequencing data, and the number of effective SNPs after quality control was 22833320.
[0055] (3) Screening of SNP sites related to the susceptibility of sheep to brucellosis by using whole genome association analysis technology.
[0056] The cELISA value was selected as the phenotype, GEMMA (Version 0.95) software was used, and MLM (y=γCov+Xβ+Zα+Wμ+e) was used as the model basis for whole genome association analysis. The iELISA value was selected as the phenotype, GEMMA (Version 0.95) software was used, and MLM (y=γCov+Xβ+Zα+Wμ+e) was used as the model basis for whole genome association analysis. The FPA value was selected as the phenotype, GEMMA (Version 0.95) software was used, and MLM (y=γCov+Xβ+Zα+Wμ+e) was used as the model basis for whole genome association analysis.
[0057] (4) Screening of SNP sites significantly associated with the susceptibility of sheep to brucellosis.
[0058] The top 500 SNPs in the three GWAS results were compared, and finally, the SNP molecular markers significantly related to the susceptibility of sheep to brucellosis were obtained, and the physical position was based on the 5th chromosome of the sheep reference genome Oar_v4.0 at position 67849582.
[0059] The above-mentioned SNP molecular markers correspond to the sequence shown as SEQ ID NO. 1, wherein the polymorphic site is at position 101bp, and the polymorphism is C or G.
[0060] Application of SNP molecular marker associated with susceptibility to ovine brucellosis in Example 2
[0061] In this example, a method was used to validate the SNP molecular marker associated with susceptibility to ovine brucellosis developed in Example 1 in a larger population, as follows:
[0062] (1) Primer design.
[0063] According to the information of sheep genomic DNA sequence, a pair of primers was designed as follows:
[0064] Forward primer F 5'-GTCCCTCATTTCACTGCATTTG-3',
[0065] Reverse primer R 5'-ACATGGTTGGGGTACATGGG-3'.
[0066] for amplifying the nucleotide fragment where the SNP to be tested is located.
[0067] (2) Collecting blood samples of sheep to be tested and identifying serum antibody concentration.
[0068] 135 sheep without vaccination were collected from the breeding farm naturally infected with Brucella, including jugular vein blood of four breeds of Texel sheep, East Friesian sheep, Suffolk sheep and white Suffolk sheep. The serum Brucella antibody concentration was detected by competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA) and fluorescence polarization assay (FPA), respectively.
[0069] (3) Extracting genomic DNA from blood samples of sheep to be tested.
[0070] Solution method was used to extract genomic DNA from blood samples of sheep to be tested.
[0071] (4) Using genotyping technology to extract SNP marker of the tested genome.
[0072] Based on the primer design in this example (1), the SNP molecular marker associated with susceptibility to ovine brucellosis developed in Example 1 was detected by genotyping.
[0073] (5) Analyzing the genotype of the polymorphic site of the SNP molecular marker obtained.
[0074] (6) Comparing whether there is a significant difference in susceptibility between different genotypes.
[0075] The genotypes of the polymorphic sites of the SNP molecular markers of the above-mentioned 135 sheep are detected, and the significance of the mean difference of the different genotypes of the sites in the susceptibility to brucellosis (cELISA value, iELISA value, FPA value) is tested by SPSS one-way ANOVA.
[0076] The results are shown in Table 1. Figure 1 As shown in Table 1, the two genotypes of "CC" and "CG" are distinguished in the detected sheep population, and the iELISA mean of the sheep individuals with the "CC" genotype is significantly lower than that of the sheep individuals with the "CG" genotype, indicating that the susceptibility of the sheep individuals with the "CC" genotype to brucellosis is lower than that of the sheep individuals with the "CG" genotype, and the SNP molecular marker provided by the present application has high accuracy for identifying the susceptibility to brucellosis.
[0077] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. Application of SNP sites as targets in any of the following: (1) Prepare reagents for predicting or detecting susceptibility to brucellosis in sheep; (2) To identify or breed sheep breeds with low susceptibility to brucellosis, or to prepare reagents for identifying or breeding sheep breeds with low susceptibility to brucellosis; (3) Molecular marker-assisted breeding of sheep susceptibility to brucellosis; (4) Sheep breed improvement related to susceptibility to brucellosis; (5) Improvement of sheep germplasm resources; The SNP site is located at position 67849582 on chromosome 5 of the reference genome version Oar_v4.0, and the polymorphism is C / G.
2. The use of molecularly labeled detection reagents, primer pairs, or kits in any of the following: (1) Prepare reagents for predicting or detecting susceptibility to brucellosis in sheep; (2) To identify or breed sheep breeds with low susceptibility to brucellosis, or to prepare reagents for identifying or breeding sheep breeds with low susceptibility to brucellosis; (3) Molecular marker-assisted breeding of sheep susceptibility to brucellosis; (4) Sheep breed improvement related to susceptibility to brucellosis; (5) Improvement of sheep germplasm resources; The molecular marker is a nucleic acid with the nucleotide sequence shown in SEQ ID NO.1, which exhibits polymorphism at position 101, with the polymorphism being C / G; The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; The primer pair is used to amplify the molecular marker; The kit includes the primer pair.
3. A method for breeding sheep breeds with low susceptibility to brucellosis, characterized in that, include: In the process of sheep breeding, sheep individuals with the molecular marker genotype CC as described in claim 2 are selected for subsequent breeding processes.