KASP molecular marker closely linked with pepper fruit length, primer, kit and application
By developing a KASP molecular marker at chromosome 70238018 of pepper, the problems of long cycle and environmental influence in pepper fruit length determination were solved, enabling rapid and accurate screening of early fruit length and improving breeding efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-09
- Publication Date
- 2026-03-13
AI Technical Summary
Traditional breeding methods for determining the length of chili pepper fruits are time-consuming, inefficient, and easily affected by the environment, resulting in poor selection accuracy and repeatability.
We developed a KASP molecular marker closely linked to pepper fruit length, designed primers using the SNP site at chromosome 70238018 on pepper chromosome 3 in the Ca59 1.0 version genome, and performed early genotyping by PCR amplification and fluorescence signal scanning to achieve rapid and accurate screening of fruit length.
Early genotyping allows for rapid screening of target fruit types, reducing the workload of later field measurements, improving selection efficiency and accuracy, and advancing the process of pepper fruit shape breeding.
Smart Images

Figure CN121653288A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of chili pepper breeding, and in particular relates to a KASP molecular marker, primers, kits and applications that are closely linked to the length of chili pepper fruits. Background Technology
[0002] chili( Capsicum annuum L. Chili peppers, belonging to the genus Capsicum in the family Solanaceae, are one of the most important vegetable crops in China. Wild-type chili peppers have small fruits, but through natural selection and domestication, significant differences have emerged in fruit shape, size, and horticultural traits. Fruit length, as an important factor in the appearance quality and yield of chili peppers, directly affects their market classification and planting benefits. Therefore, breeding chili pepper varieties with specific fruit lengths is an important goal of breeding work.
[0003] Fruit length in chili peppers is a typical quantitative trait, controlled by multiple genes and easily affected by the environment, exhibiting continuous variation in hybrid offspring. Traditional breeding methods mainly rely on field phenotypic selection, that is, screening by directly measuring fruit length after the plants have flowered and fruited. This method has obvious drawbacks: (1) long cycle: the entire growth period must be completed before evaluation can be carried out, which seriously slows down the breeding process; (2) low efficiency: a large number of plants need to be measured and recorded in a tedious field, which is a lot of work; (3) limited accuracy: the phenotype is easily affected by factors such as cultivation environment, climate conditions and pests and diseases, which affects the accuracy and repeatability of selection.
[0004] The development of marker-assisted selection (MAG) technology has provided a solution to the aforementioned problems. This technology can predict phenotypes in early stages of crop growth (such as the seedling stage) by detecting DNA markers closely linked to target traits, thereby achieving precise and rapid selection unaffected by environmental factors. Therefore, further in-depth exploration of the core genes regulating pepper fruit length and the development of molecular markers associated with pepper fruit length are of profound significance for revealing the genetic mechanisms regulating pepper fruit shape and advancing the molecular breeding process of peppers. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a KASP molecular marker, primer, kit and application that is closely linked to the length of pepper fruit.
[0006] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:
[0007] A KASP molecular marker closely linked to pepper fruit length, wherein the molecular marker, using the Ca_59_1.0 version gene (Capsicum annuum genome assembly Ca_59_1.0 - NCBI - NLM) as a reference gene, exhibits a single nucleotide polymorphism (SNP) with an A-to-T substitution at position 70238018 on chromosome 3 of pepper, and its flanking nucleotide sequence is shown in SEQ ID No: 1. ACCTTCCGTGCTTGTTCTTCAGCTTAGCAATACGGATTTTCTCTGTTGACATTTCTATTTTCTTTCTCATGTGTTCAAGTGCTGAAGGTTACAGCAAAGCTCATAAATCAGCTGTACAATTCTAAGATACTTATGCATAAATAAGTATCATAGATAAGGCACAGACCTGCTTTCTTAGGGCCAGCTGTAAGTTTTCA[A / T]CTCCATTGACAGATTTGCCAGTTCCTTCTCAACATCACGGATCTTGCAGTAATTTTCATCAATATATCTGACAGGACATACCAGAGAAGAGCAAAATCAGTATACATAGAAAACTTGATTTGAAACGAACTTTAATTTAGTGATAACATGATACAAGAAAATATATGCTTCCAGGACTTCCACAGAATCTCAGGTCCCTT.
[0008] As a general inventive concept, the present invention also provides primers for identifying or screening KASP molecular markers closely linked to pepper fruit length, comprising: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTTAGGGCCAGCTGTAAGTTTCAA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTTAGGGCCAGCTGTAAGTTTCAT-3'; Reverse primer: 5'-AAGATCCGTGATGTTGAGAAGGAA-3'.
[0009] Preferably, the two forward primers are connected to different fluorescent adapter sequences. The 5' end of forward primer 1 is connected to the FAM fluorescent adapter sequence, which is GAAGGTGACCAAGTTCATGCT; the 5' end of forward primer 2 is connected to the HEX fluorescent adapter sequence, which is GAAGGTCGGAGTCAACGGATT.
[0010] As a general inventive concept, the present invention also provides a kit for identifying or screening KASP molecular markers closely linked to pepper fruit length, comprising the primers described above.
[0011] As a general inventive concept, the present invention also provides the application of the primers or kits described above in identifying different length types of pepper fruits or in molecular-assisted breeding for pepper fruit length.
[0012] In the above application, preferably, in the process of identifying different length types of chili pepper fruits, using the Ca_59_1.0 version of chili pepper as the reference gene, when the genotype at 70238018 on chromosome 3 of chili pepper is identified as A:A or A:T, the chili pepper fruit is determined to be a long-fruited single plant; when the genotype at 70238018 on chromosome 3 of chili pepper is identified as T:T, the chili pepper fruit is determined to be a short-fruited single plant.
[0013] The preferred application described above includes the following specific process for determining the length of chili pepper fruits: (1) Extract DNA from the peppers to be tested as a template; (2) Use the primers described above or the kits described above to perform PCR amplification, fluorescence signal scanning and genotyping.
[0014] The above application, preferably, includes the following steps: Using genomic DNA from the sample as a template, PARMS PCR amplification is performed using molecularly labeled amplification primers and a quantitative PCR device. When the fluorescent group and its corresponding fluorescence quencher are close together, the fluorescence emitted by the fluorescent group will be absorbed by the quencher, resulting in the emission of fluorescence at a longer wavelength or the release of heat. In this case, the fluorescence signal of the group cannot be detected within the corresponding wavelength. Once the two are separated, the fluorescence signal can be detected. PARMS uses the PCR principle to detect the amplification signals of FAM and HEX fluorescent primers. When the corresponding allele is amplified, a corresponding fluorescence signal will appear.
[0015] In the above application, preferably, in step (2), if only the FAM blue fluorescence corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected, the genotype at 70238018 on chromosome 3 of pepper is A:A, and the pepper fruit is determined to be a homozygous single plant with long fruit. If only the HEX green fluorescence corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected, the genotype at 70238018 on chromosome 3 of pepper is T:T, and the pepper fruit is determined to be a homozygous single plant with short fruit. If the fluorescence signals corresponding to the forward primers 1 and 2 connected to the fluorescent adapter sequence are detected at the same time, the genotype at 70238018 on chromosome 3 of pepper is A:T, and the pepper fruit is determined to be a heterozygous single plant with long fruit.
[0016] In the above application, preferably, in step (2), the PCR amplification reaction procedure is as follows: pre-denaturation at 94°C for 15 minutes; then 10 cycles of landing PCR: each cycle includes 94°C for 20 seconds, 78°C for 10 seconds, and the annealing temperature is reduced by 0.5°C to 57°C per cycle from 62°C; followed by 35 cycles of conventional PCR: each cycle includes 94°C for 20 seconds, 57°C for 60 seconds; finally, incubation at 37°C for 30 seconds.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention marks the first identification of a single nucleotide polymorphism (SNP) site tightly linked to a major QTL related to fruit length at 70238018 bp on chromosome 3 of chili pepper (reference genome: Ca_59_1.0 version). Based on this site, a KASP molecular marker was developed, along with primers and a kit for this marker. This marker can be used to identify chili pepper fruit length, enabling assisted breeding and effectively addressing the problems of long breeding cycles and susceptibility to environmental influences in conventional breeding methods. Early use of this marker allows for rapid screening of satisfactory plants, effectively reducing planting scale, decreasing the workload of later identification, and improving selection efficiency and accuracy. This is of great significance for studying the formation mechanism of chili pepper fruit length types. Therefore, this invention is of great importance in chili pepper fruit shape breeding practices and in the study of fruit shape changes and regulatory mechanisms. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1The phenotypes of the short-fruited parent DT20 and the long-fruited parent CL17 in this embodiment of the invention are shown.
[0020] Figure 2 This is a statistical analysis of the fruit length of the cultivated breeding population in this embodiment of the invention.
[0021] Figure 3 BSA mapping results for the CL17 and DT20 populations: The horizontal axis represents the chromosome name, the colored dots represent the calculated SNP-index (or ΔSNP-index) values, the black lines represent the fitted SNP-index (or ΔSNP-index) values, the red lines represent the threshold line with a confidence level of 0.99, the blue lines represent the threshold line with a confidence level of 0.95, and the green lines represent the threshold line with a confidence level of 0.90.
[0022] Figure 4 For the fruit length gene localization and mutation site analysis in this embodiment of the invention: A represents the full-length chromosome 3; B represents the preliminary candidate interval located by BSA analysis, and the molecular markers designed within the interval; C represents the genotype and phenotype results of individual plants in the population recombination.
[0023] Figure 5 The following are partial results of genotyping of the molecular markers used in this application in the long-fruited pepper parent 'CL17', the short-fruited pepper parent 'DT20', and the constructed F2 population: Section A indicates that the PCR product is the fluorescence signal corresponding to the forward primer 2, which is a homozygous single plant with short fruit. Section B indicates that the PCR product has two primer fluorescent signals, which is a single plant with long pepper fruit. Section C indicates that the PCR product is the fluorescent signal corresponding to the forward primer 1, and it is a homozygous single plant with long fruit.
[0024] Figure 6 The molecular markers of this application were compared with the genotypes of different peppers in known reference genomes. Detailed Implementation
[0025] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0026] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.
[0027] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0028] Example 1: Obtaining KASP molecular markers linked to the pepper fruit length gene 1. Genetic population construction Using the long-fruited chili pepper 'CL17' and the short-fruited horn pepper 'DT20', both bred through multiple generations of self-pollination and selection by Hunan Xiangyan Seed Industry Co., Ltd., as parental materials, the phenotypes are shown in […]. Figure 1 As shown, the parent materials are deposited at the College of Horticulture, Hunan Agricultural University, and are publicly accessible.
[0029] The long-fruited chili pepper 'CL17' parent and the short-fruited chili pepper 'DT20' parent were crossed to obtain the F1 generation. After self-pollination of the F1 generation, an F2 segregating population containing 312 individual plants was obtained.
[0030] 2. Population phenotypic identification Under normal cultivation conditions, the F2 population and both parents were planted. The fruit length phenotype of the breeding population was investigated. Three fruits from the four lobes of each individual plant at the green-ripe stage were harvested, photographed with a digital camera, and the length and width of the fruits were measured using digital calipers. Phenotypic identification of fruit shape traits was completed, such as... Figure 2 As shown, the phenotypic results conform to a normal distribution, indicating that fruit length is a quantitative trait.
[0031] 3. Preliminary mapping of fruit length gene To locate the gene controlling fruit length, QTL-SEQ (quantitative trait locus sequencing) was used. From the F2 segregating population, 20 individuals with extremely long fruit (average fruit length >18.30 cm) and 20 individuals with extremely short fruit (average fruit length <11.20 cm) were selected, and two near-isogenic DNA pools were constructed for each. Whole-genome resequencing was performed on both parents (DT20 and CL17) and the two DNA pools. The sequencing sequences were aligned to the pepper reference genome using BWA software, and SAM tools were used to identify SNPs (single nucleotide polymorphisms) throughout the genome. Analysis revealed that the average sequencing depths for DT20, CL17, the extremely long fruit pool, and the extremely short fruit pool were 11, 11, 22, and 22, respectively. When the proportion of bases at or above a given depth to the total bases of the reference genome was 1X, all four pools covered more than 96% of the entire genome. SNP loci with multiple genotypes were filtered out, retaining only biselenotype loci; SNP loci with read support less than 4 in the mixed pool were filtered out; SNP loci with homozygous and consistent genotypes in the mixed pool were filtered out; SNP loci with recessive mixed pool genotypes not derived from recessive parents were filtered out; and SNP loci that were not homozygous and inconsistent between the two parents were filtered out. A total of 5,421,035 high-quality, reliable SNP loci were obtained. Plotting was performed with a 1Mb window and a 100kb step size, see [link to plotting]. Figure 3 As shown.
[0032] Since SNPs associated with the target trait are linked to surrounding SNPs on the chromosome, the ΔSNP index should be above 0.5 or close to 1. In genomic regions without trait association, the ΔSNP index shows a random distribution around 0.0. Observing the distribution of ΔSNP index values, based on the distribution of SNP-Index on the genome of the two progeny pools, we selected a region where the SNP-index in one progeny pool is close to 1, and the SNP-index in the other progeny pool is close to 0, with the difference between the two above the 99% confidence line. We found a region (50M-100M) on chromosome 3 as a candidate region.
[0033] 4. Fine mapping and development of KASP (competitive allele-specific PCR) markers (1) Marker development: Within the above candidate regions, a series of KASP molecular markers for fine mapping were designed and synthesized based on the SNP differences between the parents. KASP markers are based on the principle of allele-specific PCR, and competitive amplification is carried out by two allele-specific forward primers with different fluorescent universal adapter sequences at the 5' ends and one universal reverse primer. Finally, the genotype is determined by the fluorescence signal.
[0034] (2) Population Genotyping and Linkage Analysis: Genotyping was performed on the entire F2 population using the developed KASP marker. Linkage analysis was conducted on the genotyping results using JoinMap 4.0 software to construct a linkage map of the target region. Simultaneously, combined with the fruit length phenotypic data of the F2 population, QTL mapping analysis was performed using MapQTL 6.0 software. Ultimately, the major QTL was finely mapped to a narrower interval on chromosome 3, as shown in [reference needed]. Figure 4 As shown.
[0035] (3) Key marker identification: Within the mapping interval, a SNP (C / T) located at 70238018 bp on chromosome 3 of the reference genome (Ca_59_1.0) was found to be most strongly associated with fruit length, explaining the highest phenotypic variation (R²). This site is a C base in the long-fruited parent CL17 and a T base in the short-fruited parent DT20. This SNP was developed into a KASP molecular marker.
[0036] Example 2: Application of KASP molecular markers 1. DNA was extracted from 312 individual strains in the F2 segregating population using the CTAB method (hexadecyltrimethylammonium bromide method). (1) Dithiothreitol (DTT, 0.2%) was added to the CTAB extract; (2) Add two fresh leaves (the size of the centrifuge tube cap) to a 2.0 ml centrifuge tube; grind them thoroughly into powder with liquid nitrogen, add 800-900 µL of CTAB buffer, and mix well; (3) Water bath at 65 ℃ for 30 min, gently invert and shake twice during the process, and then cool to room temperature below 15 ℃ after the water bath; (4) Add 500 chloroform / isoamyl alcohol (24:1) and mix well for 4 min to ensure that the sample is fully mixed with chloroform; (5) Centrifuge at 12,000 rpm for 10 min, take 500 µL of the supernatant, add it to a 1.5 mL centrifuge tube containing 500 µL of isopropanol, and gently invert to mix; let stand in a 4℃ refrigerator for 30 minutes. (6) Centrifuge at 12,000 rpm for 15 min, discard the supernatant, wash the precipitate with 500 μL of 75% alcohol, centrifuge at 12,000 rpm for 5 min, and discard the supernatant; (7) Air-dry the DNA to allow the alcohol to evaporate completely; add 100 µL of pure water (containing 1% RNase) to dissolve the DNA; (8) Remove RNA by water bath at 37 ℃ for 1 h; take DNA for electrophoresis detection. After confirming that the band is intact, use a micro spectrophotometer to determine the DNA concentration. The ratio of 260 / 280 and 260 / 230 should be greater than 1.8. Dilute the DNA to 100 ng and store at -20 ℃ for later use.
[0037] 2. KASP typing detection (1) KASP molecular marker primers were designed targeting the KASP molecular marker sites. The primers were designed by SNPWay (http: / / www.snpway.com / ) and synthesized by Youkang Biotechnology (PAGE purification). See SEQ ID NO:2~4 respectively: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTTAGGGCCAGCTGTAAGTTTCAA' (as shown in SEQ ID No:2); Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTTAGGGCCAGCTGTAAGTTTCAT-3' (as shown in SEQ ID No:3); Reverse primer: 5'-AAGATCCGTGATGTTGAGAAGGAA-3' (as shown in SEQ ID No:4).
[0038] (2) The classification system is shown in Table 1.
[0039] Table 1 Classification System
[0040] Amplification program: pre-denaturation at 94℃ for 15 minutes; then 10 cycles of landing PCR: each cycle consisting of 94℃ for 20 seconds, 78℃ for 10 seconds, with the annealing temperature decreasing by 0.5℃ from 62℃ to 57℃ each cycle; followed by 35 cycles of conventional PCR: each cycle consisting of 94℃ for 20 seconds, 57℃ for 60 seconds; and finally, incubation at 37℃ for 30 seconds.
[0041] (3) Fluorescence signal scanning and genotyping: After PCR, fluorescence scanning was performed. Genotypes were determined based on different fluorescence signals. If only FAM (blue) fluorescence signal is detected, the genotype is A:A (long fruit homozygous).
[0042] If only HEX (green) fluorescence signal is detected, the genotype is T:T (short fruit homozygous).
[0043] If both FAM and HEX fluorescence signals are detected simultaneously, the genotype is A:T (long-fruited heterozygous).
[0044] Fruits longer than 15cm are considered long fruits, and fruits shorter than 13cm are considered short fruits.
[0045] The results were used to phenotypically identify fruit length in some F2 populations and various pepper materials using KASP molecular markers. Some results are shown in Table 2 and 3. Figure 5 As shown in Table 2, the genotype identification results and phenotypic identification results have a high degree of consistency.
[0046] Table 2. Fruit length and genotype of KASP in breeding materials
[0047] KASP molecular markers were aligned to known reference genomes of peppers CM334 (long fruit), Zunla (short fruit), Zhangshugang (short fruit), and Ca59 (long fruit). The alignment results are as follows: Figure 6 As shown, the genotype identification results were consistent with the phenotypic identification results.
[0048] Based on the verification results of Example 2, the KASP molecular marker and primers (or kits containing the primers) of the present invention can be widely used in molecular-assisted breeding of peppers: Early screening: DNA can be extracted from a small number of leaves during the seedling stage (when there are 3-4 true leaves). The molecular markers of this invention can be used for genotyping to predict the fruit length type. There is no need to wait until flowering and fruiting to conduct time-consuming and laborious field phenotypic measurements.
[0049] Backcross breeding: In the backcrossing process of introducing long fruit traits into superior short fruit varieties, this marker can be used to quickly and accurately screen out heterozygous (A:T) or homozygous (A:A) individuals carrying the target C allele in the backcross progeny, which significantly accelerates the breeding process.
[0050] Parental purity identification and hybrid prediction: Used to identify the purity of long-fruited and short-fruited inbred lines. Before creating hybrid combinations, the genotype of the F1 generation can be predicted, thereby predicting fruit length performance.
[0051] In breeding practice, if the breeding goal is to select long-fruited peppers, the molecular markers of this invention can be used in the early stages of the segregating population (such as F2, BC1F1) to screen out individual plants with genotypes A:A or A:T for key cultivation and subsequent selection, while eliminating individual plants with genotypes T:T.
[0052] In summary, this application has achieved molecular marker-assisted selection of pepper fruit length by locating and marking the major gene for fruit length in common peppers, effectively improving the selection efficiency of fruit length traits. This application is of great significance for establishing an efficient molecular system for pepper quality breeding and improving the level of pepper quality breeding.
Claims
1. A KASP molecular marker closely linked to the length of chili pepper fruits, characterized in that, Using the Ca_59_1.0 version gene as a reference gene, a single nucleotide polymorphism (SNP) with an A-to-T substitution occurred at position 70238018 on chromosome 3 of the pepper plant. The flanking nucleotide sequence is as follows: ACCTTCCGTGCTTGTTCTTCAGCTTAGCAATACGGATTTTCTCTGTTGACATTTCTATTTTCTTTCTCATGTGTTCAAGTGCTGAAGGTTACAGCAAAGCTCATAAATCAGCTGTACAATTCTAAGATACTTATGCATAAATAAGTATCATAGATAAGGCACAGACCTGCTTTCTTAGGGCCAGCTGTAAGTTTTCA[A / T]CTCCATTGACAGATTTGCCAGTTCCTTCTCAACATCACGGATCTTGCAGTAATTTTCATCAATATATCTGACAGGACATACCAGAGAAGAGCAAAATCAGTATACATAGAAAACTTGATTTGAAACGAACTTTAATTTAGTGATAACATGATACAAGAAAATATATGCTTCCAGGACTTCCACAGAATCTCAGGTCCCTT.
2. A primer for identifying or screening KASP molecular markers closely linked to pepper fruit length, characterized in that, include: Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCTCTTAGGGCCAGCTGTAAGTTTCAA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTTAGGGCCAGCTGTAAGTTTCAT-3'; Reverse primer: 5'-AAGATCCGTGATGTTGAGAAGGAA-3'.
3. The primer as described in claim 2, characterized in that, The two forward primers are connected to different fluorescent adapter sequences. The 5' end of forward primer 1 is connected to the FAM fluorescent adapter sequence, which is GAAGGTGACCAAGTTCATGCT. The 5' end of forward primer 2 is connected to the HEX fluorescent adapter sequence, which is GAAGGTCGGAGTCAACGGATT.
4. A kit for identifying or screening KASP molecular markers closely linked to pepper fruit length, characterized in that, Includes the primers as described in claim 2 or 3.
5. The use of a primer as described in claim 2 or 3 or a kit as described in claim 4 in identifying the length type of pepper fruit or in molecular-assisted breeding for pepper fruit length.
6. The application as described in claim 5, characterized in that, In identifying the length type of chili pepper fruit, the Ca_59_1.0 version of the chili pepper gene is used as the reference gene. When the genotype at 70238018 on chromosome 3 of the chili pepper is identified as A:A or A:T, the chili pepper fruit is determined to be a long-fruited single plant; when the genotype at 70238018 on chromosome 3 of the chili pepper is identified as T:T, the chili pepper fruit is determined to be a short-fruited single plant.
7. The application as described in claim 5, characterized in that, The specific process for identifying the length type of chili pepper fruits includes: (1) Extract DNA from the peppers to be tested as a template; (2) PCR amplification, fluorescence signal scanning and genotyping are performed using the primers as described in claim 2 or 3 or the kit as described in claim 4.
8. The application as described in claim 7, characterized in that, In step (2), if only FAM blue fluorescence corresponding to the forward primer 1 connected to the fluorescent adapter sequence is detected, the genotype at 70238018 on chromosome 3 of pepper is A:A, and the pepper fruit is determined to be a homozygous single plant with long fruit. If only HEX green fluorescence corresponding to the forward primer 2 connected to the fluorescent adapter sequence is detected, the genotype at 70238018 on chromosome 3 of pepper is T:T, and the pepper fruit is determined to be a homozygous single plant with short fruit. If the fluorescence signals corresponding to the forward primers 1 and 2 connected to the fluorescent adapter sequence are detected at the same time, the genotype at 70238018 on chromosome 3 of pepper is A:T, and the pepper fruit is determined to be a heterozygous single plant with long fruit.
9. The application as described in claim 7, characterized in that, In step (2), the PCR amplification reaction procedure is as follows: pre-denaturation at 94°C for 15 minutes; then 10 cycles of landing PCR: each cycle includes 94°C for 20 seconds, 78°C for 10 seconds, and the annealing temperature is reduced by 0.5°C from 62°C to 57°C per cycle; followed by 35 cycles of conventional PCR: each cycle includes 94°C for 20 seconds, 57°C for 60 seconds; and finally, incubation at 37°C for 30 seconds.
Citation Information
Patent Citations
Molecular marker for pepper fruit length, primer, kit and application
CN117402998A
KASP molecular marker closely linked with pepper fruit length, primer, kit and application
CN118600089A
SNP (Single Nucleotide Polymorphism) molecular marker closely linked with pepper fruit length as well as primer, kit, obtaining method and application of SNP molecular marker
CN120119022A
Molecular marker closely linked with pepper fruit length regulation gene CaFL1 and application thereof
CN120442836A
Molecular marker closely linked to pepper fruit shape gene, primer, kit, and use
WO2026000325A1
Cited By
A KASP molecular marker, primer set, kit, and application related to pepper fruit width
CN122303477A