Primer group, kit and method for detecting rhabdovirus of micropterus salmoides

Abstract

The invention belongs to the technical field of biology, and provides a primer group, a kit and a method for detecting rhabdovirus of micropterus salmoides. The primer group comprises outer primers F3 and B3, inner primers FIP and BIP, and loop primers LF and LB. The kit comprises a reaction solution, and the reaction solution comprises the primer group. The detection method comprises the step of carrying out LAMP detection by using the kit. The designed LAMP special specific primer group is used for identifying a plurality of specific areas of the rhabdovirus target gene, and the target gene can be successfully detected by performing amplification reaction at a constant temperature through strand displacement type DNA polymerase. The detection method disclosed by the invention is strong in specificity, high in sensitivity, convenient and rapid in detection and strong in applicability, and lays a foundation for on-site rapid and accurate detection of micropterus salmoides infection with rhabdovirus.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to a primer set, a kit, and a method for detecting rhabdovirus of largemouth bass. Background Art

[0002] Largemouth bass is a key freshwater commercial fish species in my country. Its delicious meat and lack of intramuscular spines have earned it a deep consumer following, earning it the nickname "the fifth domesticated fish" after silver carp and bighead carp. Its annual aquaculture growth rate ranks among the highest among freshwater aquaculture species in my country. However, frequent diseases during aquaculture have become a major obstacle to the sustainable development of the industry, particularly viral diseases, which pose a serious threat to the healthy cultivation and economic benefits of largemouth bass.

[0003] Largemouth bass rhabdovirus, a major causative agent of viral diseases in sea bass, causes darkening, bending, and rotten fins in infected fish. Dissection reveals an enlarged and congested liver, creating a "speckled liver" appearance. Currently, there are no effective medications or commercial vaccines to treat rhabdovirus infection in largemouth bass, making early detection and diagnosis crucial.

[0004] Molecular detection methods such as polymerase chain reaction (PCR), real-time fluorescence quantitative PCR, and reverse transcriptase real-time PCR are widely used in laboratory settings to detect largemouth bass rhabdoviruses due to their high accuracy and sensitivity. However, these methods require specialized technicians to operate, have long testing cycles, and are expensive, including reagents. These limitations limit their use in the field, such as at hatcheries and ponds. Therefore, there is an urgent need to develop a method that can quickly and accurately detect largemouth bass rhabdoviruses.

[0005] Isothermal amplification technology has emerged, but the recombinase polymerase amplification (RPA) method is expensive, has low amplification efficiency, and poor specificity. Therefore, it is particularly necessary to provide a more efficient, specific, and low-cost method for detecting rhabdoviruses in largemouth bass. Summary of the Invention

[0006] The present disclosure provides a primer set, a kit, and a method for detecting rhabdovirus of largemouth bass, so as to at least solve the above technical problems existing in the prior art.

[0007] Loop-mediated isothermal amplification (LAMP) technology is often used for large-scale and rapid nucleic acid detection due to its advantages such as high amplification efficiency, strong specificity, simple visual detection and low cost. This technology uses 4 primers to identify 6 specific regions on the gene, and at the same time, a DNA polymerase with chain displacement function is used to perform the amplification reaction under constant temperature conditions of 60-65°C. This method does not require thermal denaturation of the template or complex temperature cycles, and has high amplification efficiency and strong specificity. LAMP technology has been successfully applied to the detection of largemouth bass iridescent virus, and how to use this technology to detect largemouth bass rhabdovirus has become an urgent issue. Therefore, the present disclosure proposes the following scheme.

[0008] According to a first aspect of the present disclosure, a primer set for detecting rhabdovirus in largemouth bass is provided, wherein the primer set is used to detect rhabdovirus in the largemouth bass via loop-mediated isothermal amplification (LAMP); the primer set comprises:

[0009] The outer primer F3 has a nucleic acid sequence as shown in SEQ ID NO: 1: GGCTCTTCGCAATTCGGAT;

[0010] The outer primer B3 has a nucleic acid sequence as shown in SEQ ID NO: 2: GCCGTTCTTAGGAGCTTGT;

[0011] The inner primer FIP has a nucleic acid sequence as shown in SEQ ID NO: 3: CCGTATCCATCCATGACGGCTCTTTGTGCGGACAGATCAAGG;

[0012] The inner primer BIP has a nucleic acid sequence as shown in SEQ ID NO:4: AGCAAGAAAAGACAGCACCCGTGAGAGGTGGGAGTGAGGTT;

[0013] Loop primer LF, the nucleic acid sequence of which is shown in SEQ ID NO: 5: CTACGTATCACAAATTGAGC CAAGA;

[0014] The nucleic acid sequence of the loop primer LB is shown in SEQ ID NO: 6: CCGTCGCTTGACTCAATCCC.

[0015] Specifically, when detecting the presence of rhabdovirus in largemouth bass, the LAMP technique rapidly amplifies the target sequence by identifying the specific gene sequence of the rhabdovirus (specifically, the gene sequence corresponding to the G protein region of the rhabdovirus). The nucleic acid sequence of the specific gene of the rhabdovirus is shown in SEQ ID NO:7: GGCTCTTCGCAATTCGGATATGCAGGCGATTTGTGCGGACAGATCAAGGATTTCTTGGCTCAATTTGTGATACGTAGCTGAGCCGTCATGGATGGATACGGTCAGCTCTCCATCACACATTGGAACACTAGCAAGAAAAGACAGCACCCGTCCGTCGCTTGACTCAATCCCGTACCACTCTCCGGACTTAAACCTCACTCCCACCTCTCCGCACATTGACATCTTACAAGCTCCTAAGAACGGC. The above primer set is designed based on this specific gene sequence.

[0016] According to a second aspect of the present disclosure, a kit for detecting rhabdovirus in largemouth bass is provided, wherein the kit is used for detecting rhabdovirus in the largemouth bass via LAMP; the kit comprises a reaction solution, and the reaction solution comprises the above-mentioned primer set.

[0017] In one embodiment, the reaction solution further comprises a buffer, Bst DNA polymerase, fluorescent dye Evagreen and water.

[0018] In one embodiment, the concentration of each reagent in the reaction solution is as follows: the concentration of the outer primer F3 and the outer primer B3 are both 8-12 μM, the concentration of the inner primer FIP and the inner primer BIP are both 95-105 μM, the concentration of the loop primer LF and the loop primer LB are both 95-105 μM, the buffer is 2× buffer, and the concentration of the Bst DNA polymerase is 7.5-8.5 U / μL.

[0019] In a preferred embodiment, the concentration of each reagent in the reaction solution is as follows: the concentration of the outer primer F3 and the outer primer B3 is both 10 μM, the concentration of the inner primer FIP and the inner primer BIP is both 100 μM, the concentration of the loop primer LF and the loop primer LB is both 100 μM, the buffer is 2× buffer, and the concentration of the Bst DNA polymerase is 8 U / μL.

[0020] In a preferred embodiment, the reaction solution is: 0.5 μL outer primer F3, 0.5 μL outer primer B3, 0.4 μL inner primer FIP, 0.4 μL inner primer BIP, 0.2 μL loop primer LF, 0.2 μL loop primer LB, 12.5 μL 2× buffer, 1 μL BstDNA polymerase, 1.25 μL fluorescent dye Eva green, and water is added to make the total system 25 μL.

[0021] According to a third aspect of the present disclosure, a method for detecting rhabdovirus in largemouth bass is provided, comprising the following steps: performing LAMP detection using the above-mentioned kit.

[0022] In one embodiment, the temperature of the LAMP detection is 60-65°C.

[0023] According to an embodiment of the present disclosure, there are at least the following beneficial effects:

[0024] The present invention utilizes a designed LAMP-specific primer set to identify multiple specific regions of the target gene of the rhabdovirus, and performs an amplification reaction at a constant temperature (60-65°C) by a chain displacement DNA polymerase, which can successfully detect the target gene. Compared with traditional PCR, LAMP does not require complex temperature cycles and only requires a simple constant temperature device to complete the amplification. The accumulation of amplified products can be directly observed by fluorescence or colorimetry without the need for electrophoresis or other complex subsequent detection methods. It is particularly suitable for on-site detection and large-scale screening applications, and provides an efficient and convenient solution for the rapid detection of pathogens in aquaculture.

[0025] Currently, there is no dedicated primer combination for LAMP of rhabdovirus of largemouth bass. The present disclosure lays a foundation for the rapid and accurate on-site detection of largemouth bass infected with rhabdovirus.

[0026] It should be understood that the contents described in this section are not intended to identify the key or important features of the embodiments of the present disclosure, nor are they intended to limit the scope of the present disclosure. Other features of the present disclosure will become readily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The above and other objects, features and advantages of the exemplary embodiments of the present disclosure will become readily understood by reading the detailed description below with reference to the accompanying drawings, in which several embodiments of the present disclosure are shown by way of example and not limitation, wherein:

[0028] In the drawings, the same or corresponding reference numerals denote the same or corresponding parts.

[0029] Figure 1The results of loop-mediated isothermal amplification of multiple pathogens in Example 3 of the present disclosure are shown; wherein, NC-negative target; MSRV-largemouth bass rhabdovirus; AH-Aeromonas hydrophila; ISKNV-infectious spleen and kidney necrosis virus; LMBV-largemouth bass iridovirus; DIV1-decapod iridovirus 1; WSSV-white spot syndrome virus; EHP-shrimp enterocytosis;

[0030] Figure 2 The results of loop-mediated isothermal amplification of templates with different dilution concentrations in Example 4 of the present disclosure are shown; wherein, NC-negative target; the unit of target concentration is copies / μL;

[0031] Figure 3 A graph showing the relationship between the LAMP amplification threshold time and the target concentration in Example 4 of the present disclosure is shown;

[0032] Figure 4 The results of LAMP detection using a portable nucleic acid amplification instrument in Example 5 of the present disclosure are shown; wherein the target concentrations of tubes A to H are 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 Amplification results of copies / μL and NC; Amplification results of NC-negative targets;

[0033] Figure 5 The visualization result of LAMP performed by a portable nucleic acid amplification instrument in Example 6 of the present disclosure is shown; wherein the concentrations of the amplified products from left to right are 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 copies / μL, NC; NC-negative control. DETAILED DESCRIPTION

[0034] To make the purposes, features, and advantages of the present disclosure more apparent and understandable, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present disclosure, not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present disclosure without creative work shall fall within the scope of protection of the present disclosure.

[0035] Example 1

[0036] In this example, a primer set for detecting rhabdovirus of largemouth bass via LAMP was designed and synthesized.

[0037] Based on the gene sequences of rhabdoviruses published by NCBI (National Center for Biotechnology), the rhabdovirus G protein region (the nucleic acid sequence of which is shown in SEQ ID NO: 7: GGCTCTTCGCAATTCGGATATGCAGG CGATTTGTGCGGACAGATCAAGGATTTCTTGGCTCAATTTGTGATACGTAGCTGAGCCGTCATGGATGGATACGGTCAGCTCTCCATCACACATTGGAACACTAGCAAGAAAAGACAGCACCCGTCCGTCGCTTGACTCAATCCCGTACCACTCTCCGGACTTAAACCTCACTCCCACCTCTCCGCACATTGACATCTTACAAGCTCCTAAGAACGGC) was selected and imported into the software PrimerExplorer V5 to design a primer set for loop-mediated isothermal amplification of the pathogen. The primer set includes:

[0038] The outer primer F3 has a nucleic acid sequence as shown in SEQ ID NO: 1: GGCTCTTCGCAATTCGGAT;

[0039] The outer primer B3 has a nucleic acid sequence as shown in SEQ ID NO: 2: GCCGTTCTTAGGAGCTTGT;

[0040] The inner primer FIP has a nucleic acid sequence as shown in SEQ ID NO: 3: CCGTATCCATCCATGACGGCTCTTTGTGCGGACAGATCAAGG;

[0041] The inner primer BIP has a nucleic acid sequence as shown in SEQ ID NO:4: AGCAAGAAAAGACAGCACCCGTGAGAGGTGGGAGTGAGGTT;

[0042] Loop primer LF, the nucleic acid sequence of which is shown in SEQ ID NO: 5: CTACGTATCACAAATTG AGCCAAGA;

[0043] The nucleic acid sequence of the loop primer LB is shown in SEQ ID NO: 6: CCGTCGCTTGACTCAATCCC.

[0044] Example 2

[0045] This example provides a kit for detecting rhabdovirus in largemouth bass using LAMP to achieve rapid detection of rhabdovirus. The kit includes a reaction solution, which includes the primer set designed in Example 1.

[0046] The kit specifically includes the following components: 0.5 μL outer primer F3 (10 μM), 0.5 μL outer primer B3 (10 μM), 0.4 μL inner primer FIP (100 μM), 0.4 μL inner primer BIP (100 μM), 0.2 μL loop primer LF (100 μM), 0.2 μL loop primer LB (100 μM), 12.5 μL 2× buffer, 1 μL Bst DNA polymerase (8 U / μL), 1.25 μL fluorescent dye Eva green, 2 μL test template, and the remainder is made up to 25 μL with ddH2O. This kit is used for rapid isothermal amplification detection of largemouth bass rhabdovirus.

[0047] Example 3

[0048] In this example, the kit provided in Example 2 was used to perform loop-mediated isothermal amplification on various pathogens to verify the specificity of the kit.

[0049] Plasmid DNA of largemouth bass rhabdovirus (MSRV), Aeromonas hydrophila (AH), infectious spleen and kidney necrosis virus (ISKNV), largemouth bass iriditis virus (LMBV), decapod iriditis virus 1 (DIV1), white spot syndrome virus (WSSV), and enterohepatocytosis (EHP) were used as detection templates, and ddH2O was set as a negative control. Loop-mediated isothermal amplification was performed at 65°C. The results are as follows: Figure 1 shown. Figure 1 The results showed that, except for the largemouth bass rhabdovirus, which had a clear exponential amplification curve, no other templates showed any amplification. This indicates that the loop-mediated isothermal amplification primer set and kit provided by the present disclosure have the ability to specifically detect largemouth bass rhabdovirus and can accurately detect the presence of this pathogen.

[0050] Example 4

[0051] This example tests the sensitivity and repeatability of the kit provided in Example 2.

[0052] Based on the primer set in the kit of Example 2, a recombinant plasmid of largemouth bass rhabdovirus was prepared. The amplified product of the above primers was prepared into a recombinant plasmid, and the plasmid was gradiently diluted (10 4 , 10 3 , 10 2 , 10 1The diluted plasmid was used as a template and loop-mediated isothermal amplification was performed using the kit and the corresponding amplification procedure of Example 2. At the same time, a negative control group with ddH2O as the template was set up. The results are shown in Figure 2. Figure 2 shown. Figure 2 It shows that when the plasmid dilution concentration of the test sample is 10 2 At concentrations of 500 copies / μL and above, a clear exponential amplification curve can be observed, and the three replicates of each concentration of the target all showed clear exponential amplification, while the negative control showed no amplification. In addition, the relationship between the LAMP amplification threshold time and the target concentration was tested, and the results were as follows: Figure 3 As shown. It can be seen that the minimum detection sensitivity of the loop-mediated isothermal amplification system established in the present disclosure for largemouth bass rhabdovirus can reach 10 2 copies / μL, and the system has good reproducibility.

[0053] Example 5

[0054] This example tests the portability of the kit provided in Example 2.

[0055] The above examples were all performed on a traditional nucleic acid amplification instrument, which is not conducive to on-site detection. Therefore, in this example, the above kit and the corresponding amplification system were tested on a portable nucleic acid amplification instrument. 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 copies / μL), ddH2O was used as negative control, and LAMP was performed on a portable nucleic acid amplification instrument. The results were as follows Figure 4 shown. Figure 4 Display, except G hole (10 1 With the exception of 100 copies / μL, all others showed significant exponential amplification, consistent with the results of conventional nucleic acid amplification instruments. This indicates that the kit and corresponding loop-mediated isothermal amplification system provided by the present disclosure can be used for on-site nucleic acid detection.

[0056] Example 6

[0057] This example tests the degree of visualization when performing LAMP using the kit provided in Example 2.

[0058] In order to meet the needs of different users, the amplified product of Example 5 was placed in a visual portable nucleic acid amplification instrument for observation. The results are as follows: Figure 5 shown. Figure 5 The positive amplification product (10 7 , 10 6, 10 5 , 10 4 , 10 3 , 10 2 copies / μL) showed bright and visible green fluorescence under the excitation of 480nm excitation light.

[0059] In summary, the primer set, kit, and visualization detection method for loop-mediated isothermal amplification for detecting largemouth bass rhabdovirus provided by the present disclosure have the advantages of strong specificity, high sensitivity, convenient and rapid detection, and strong applicability.

[0060] It should be understood that the various forms of the processes shown above can be used to reorder, add, or delete steps. For example, the steps described in this disclosure can be performed in parallel, sequentially, or in a different order, as long as the desired results of the technical solutions of this disclosure can be achieved, and this document is not limited here.

[0061] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. Throughout the present disclosure, "plurality" means two or more, unless otherwise specifically defined.

[0062] The above description is merely a specific embodiment of the present disclosure, but the scope of protection of the present disclosure is not limited thereto. Any changes or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in this disclosure should be included in the scope of protection of the present disclosure. Therefore, the scope of protection of the present disclosure should be based on the scope of protection of the claims.

Claims

1. A primer set for detecting rhabdovirus of largemouth bass, characterized in that: The primer set is used to detect rhabdovirus in the largemouth bass via LAMP; the primer set includes: The outer primer F3 has a nucleic acid sequence as shown in SEQ ID NO: 1: GGCTCTTCGCAATTCGGAT; The outer primer B3 has a nucleic acid sequence as shown in SEQ ID NO: 2: GCCGTTCTTAGGAGCTTGT; The inner primer FIP has a nucleic acid sequence as shown in SEQ ID NO: 3: CCGTATCCATCCATGACGGCTCTTTGTGCGGACAGATCAAGG; The inner primer BIP has a nucleic acid sequence as shown in SEQ ID NO:4: AGCAAGAAAAGACAGCACCCGTGAGAGGTGGGAGTGAGGTT; Loop primer LF, the nucleic acid sequence of which is shown in SEQ ID NO: 5: CTACGTATCACAAATTGAGC CAAGA; The nucleic acid sequence of the loop primer LB is shown in SEQ ID NO: 6: CCGTCGCTTGACTCAATCCC.

2. A kit for detecting rhabdovirus of largemouth bass, characterized in that: The kit is used for detecting rhabdovirus in largemouth bass via LAMP; the kit comprises a reaction solution, and the reaction solution comprises the primer set according to claim 1.

3. The kit according to claim 2, wherein The reaction solution also includes a buffer, Bst DNA polymerase, fluorescent dye Eva green and water.

4. The kit according to claim 3, wherein The concentrations of the reagents in the reaction solution are as follows: the concentrations of the outer primers F3 and B3 are both 8 to 12 μM, the concentrations of the inner primers FIP and BIP are both 95 to 105 μM, the concentrations of the loop primers LF and LB are both 95 to 105 μM, the buffer is 2× buffer, and the concentration of the Bst DNA polymerase is 7.5 to 8.5 U / μL.

5. The kit according to claim 4, characterized in that The concentrations of each reagent in the reaction solution are as follows: the concentrations of the outer primer F3 and the outer primer B3 are both 10 μM, the concentrations of the inner primer FIP and the inner primer BIP are both 100 μM, the concentrations of the loop primer LF and the loop primer LB are both 100 μM, the buffer is 2× buffer, and the concentration of the BstDNA polymerase is 8 U / μL.

6. The kit according to claim 4, characterized in that The reaction solution comprises: 0.5 μL outer primer F3, 0.5 μL outer primer B3, 0.4 μL inner primer FIP, 0.4 μL inner primer BIP, 0.2 μL loop primer LF, 0.2 μL loop primer LB, 12.5 μL 2× buffer, 1 μL Bst DNA polymerase, 1.25 μL fluorescent dye Eva green, and water is used to make the total system 25 μL.

7. A method for detecting rhabdovirus in largemouth bass, characterized in that: The method comprises the following steps: performing LAMP detection using the kit according to any one of claims 2 to 6.

8. The method according to claim 7, characterized in that The temperature of the LAMP detection is 60-65°C.

Images