TsRNA markers for diagnosing assessment of sepsis cardiomyopathy, kits and applications thereof
By detecting the expression level of tsRNA-3023b, an effective diagnostic tool and assessment method for septic cardiomyopathy is provided, which solves the problem of lack of accurate diagnosis in existing technologies and realizes efficient disease identification and potential treatment methods.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-12
- Publication Date
- 2026-04-10
AI Technical Summary
Current technologies lack accurate diagnostic and assessment methods for septic cardiomyopathy, and new biomarkers are urgently needed to improve the effectiveness of diagnosis and treatment.
Using tsRNA-3023b as a novel biomarker, its expression level was detected by RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms. Kits and primers were developed for diagnosis, screening, disease assessment, and differentiation of septic cardiomyopathy.
tsRNA-3023b is significantly upregulated in patients with septic cardiomyopathy, exhibiting good diagnostic efficacy and accuracy in predicting mortality. It can reflect the severity of the disease and may serve as a potential therapeutic target to reduce cardiomyocyte damage.
Smart Images

Figure CN120719008B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a marker for diagnosing sepsis cardiomyopathy, in particular a tsRNA marker, and also relates to a kit for detecting the tsRNA marker and application thereof, and belongs to the field of medical molecular diagnosis. BACKGROUND
[0002] Sepsis is a life-threatening multi-organ dysfunction triggered by the host's immune response to infection. Despite significant advances in intensive care and life support technology, the hospitalization rate for sepsis has exceeded that for myocardial infarction and stroke in Western countries. According to existing epidemiological studies, the hospital mortality rate for patients with severe sepsis is as high as 25-30%, and the hospitalization rate and mortality rate are increasing by 8.2% and 5.6% per year, respectively. Sepsis cardiomyopathy is a common complication of sepsis, and about 70% of sepsis patients will develop this condition. Once cardiac dysfunction occurs, it will have an adverse effect on tissue perfusion, leading to rapid deterioration of the patient's condition and a mortality rate of up to 50-60%. The characteristics of sepsis cardiomyopathy include systolic and diastolic dysfunction of the left and / or right ventricles, decreased oxygen delivery capacity, reduced left ventricular ejection fraction (LVEF), and primary myocardial cell damage. Recent studies have shown that the pathogenesis of sepsis cardiomyopathy involves circulating mediators, molecular changes, mitochondrial dysfunction, and cell death. However, current treatment strategies for these mechanisms are not ideal, and the underlying mechanisms of sepsis-induced myocardial damage have not been fully elucidated.
[0003] With the advancement of sequencing technology, tRNA-derived small RNAs (tsRNAs) have gradually attracted attention. TsRNAs are a class of small non-coding RNAs with a length of about 13-48 nanometers, which are produced by precise processing of the 5' or 3' end of mature tRNA or pre-tRNA, and their abundance is second only to miRNA. From bacteria to humans, tsRNAs show high conservation in the evolutionary process. TsRNAs have various functions, including gene expression regulation, translation inhibition, and virus infection-related processes. Previous studies have reported that tsRNAs are involved in the onset and development of cardiovascular system diseases, but their role in sepsis cardiomyopathy and whether they can serve as new diagnostic markers remain to be further explored.
[0004] Currently, there is a lack of accurate assessment tests and laboratory methods for the development of sepsis cardiomyopathy in clinical practice, and new biomarkers are urgently needed. With the increasing maturity of tsRNA detection methods, tsRNAs are expected to become a new biomarker for the diagnosis and evaluation of sepsis cardiomyopathy, providing new possibilities for clinical diagnosis and treatment. SUMMARY
[0005] The primary technical problem to be solved by the present application is to provide a new application of a tsRNA marker, which can be used in the preparation of a substance for diagnosing, screening, assessing the condition of, and distinguishing sepsis cardiomyopathy.
[0006] Another technical problem to be solved by the present application is to provide a kit for detecting a new tsRNA marker, which can be used for diagnosing, screening, assessing the condition of, and distinguishing sepsis cardiomyopathy.
[0007] Still another technical problem to be solved by the present application is to provide a primer for detecting a new tsRNA marker, which can be used for diagnosing, screening, assessing the condition of, and distinguishing sepsis cardiomyopathy.
[0008] To achieve the above technical purposes, the present application adopts the following technical solutions:
[0009] According to a first aspect of an embodiment of the present application, there is provided an application of a substance for detecting a tsRNA marker, including one or more of the following applications:
[0010] A1) an application in the preparation of a product for diagnosing sepsis cardiomyopathy;
[0011] A2) an application in the preparation of a product for screening sepsis cardiomyopathy;
[0012] A3) an application in the preparation of a product for treating sepsis cardiomyopathy;
[0013] A4) an application in the preparation of a product for assessing the condition of sepsis cardiomyopathy;
[0014] A5) an application in the preparation of a product for distinguishing sepsis cardiomyopathy from other diseases;
[0015] The tsRNA marker is tsRNA-3023b, and the nucleotide sequence is shown in SEQ ID No. 1.
[0016] The "product" described above can be a product for diagnosing sepsis cardiomyopathy by detecting the expression level of tsRNA-3023b through RT-PCR, real-time quantitative PCR, in situ hybridization, a chip, or a high-throughput sequencing platform.
[0017] In the above application, the expression of tsRNA-3023b in the plasma sample of a patient with sepsis cardiomyopathy is significantly up-regulated; the expression level of tsRNA-3023b in healthy people is significantly lower than that in patients with sepsis cardiomyopathy.
[0018] More preferably, the substance is a reagent for detecting the expression amount of tsRNA-3023b, or a reagent specifically recognizing tsRNA-3023b, or a reagent for detecting the content of tsRNA-3023b.
[0019] More preferably, the substance is a substance for detecting tsRNA-3023b, specifically a), b) or c) as follows
[0020] a) a primer for detecting or specifically recognizing tsRNA-3023b;
[0021] b) a reagent set containing the a);
[0022] c) a kit containing the a) or the b).
[0023] More preferably, the primer is an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3.
[0024] According to a second aspect of the embodiments of the present application, a kit for detecting a tsRNA marker is provided, which comprises one or more of the following applications:
[0025] A1) use in the preparation of a product for diagnosing sepsis cardiomyopathy;
[0026] A2) use in the preparation of a product for screening sepsis cardiomyopathy;
[0027] A3) use in the preparation of a product for treating sepsis cardiomyopathy;
[0028] A4) use in the preparation of a product for assessing the condition of sepsis cardiomyopathy;
[0029] A5) use in the preparation of a product for differentiating sepsis cardiomyopathy from other diseases;
[0030] The tsRNA marker is tsRNA-3023b, the nucleotide sequence of which is shown in SEQ ID No. 1; the kit comprises a reagent for detecting or specifically recognizing tsRNA-3023b, or a reagent for detecting the expression amount of tsRNA-3023b.
[0031] Using the kit provided by the present application, the expression of the tsRNA-3023b characteristic gene sequence shown in SEQ ID No. 1 in the peripheral blood of the subject can be detected, and then the probability of sepsis cardiomyopathy of the subject can be determined according to the information of up-regulation or down-regulation of the gene expression, thereby realizing the diagnosis of sepsis cardiomyopathy.
[0032] The kit provided by the present application can comprise appropriate packaging and instructions for use in the methods disclosed herein. The detection kit provided by the present application is a nucleic acid detection kit, which comprises reagents required for RNA extraction and real-time fluorescent quantitative PCR (qRT-PCR). The kit can further comprise appropriate buffers and polymerases, and can also comprise control primers and / or probes.
[0033] More preferably, the reagent for detecting or specifically recognizing tsRNA-3023b is a specific primer, and the specific primer is an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3.
[0034] According to a third aspect of the embodiments of the present application, a primer for detecting a tsRNA marker is provided, and the primer comprises one or more of the following applications:
[0035] A1) an application in the preparation of a product for diagnosing sepsis cardiomyopathy;
[0036] A2) an application in the preparation of a product for screening sepsis cardiomyopathy;
[0037] A3) an application in the preparation of a product for treating sepsis cardiomyopathy;
[0038] A4) an application in the preparation of a product for assessing the condition of sepsis cardiomyopathy;
[0039] A5) an application in the preparation of a product for differentiating sepsis cardiomyopathy from other diseases;
[0040] The primer is a primer for detecting the expression level of tsRNA-3023b or specifically recognizing tsRNA-3023b.
[0041] More preferably, the primer is an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3.
[0042] Compared with the prior art, the present application has the following technical effects:
[0043] (1) The present application provides a new biomarker tsRNA-3023b, which can be used for the diagnosis of sepsis cardiomyopathy. Clinical verification tests show that the expression level of tsRNA-3023b in the plasma of sepsis cardiomyopathy patients is significantly higher than that of healthy controls, which indicates that tsRNA-3023b is a potential biomarker that can effectively identify sepsis cardiomyopathy patients.
[0044] (2) Further analysis shows that the efficiency of tsRNA-3023b in diagnosing sepsis cardiomyopathy patients is verified by ROC curve, which shows excellent sensitivity and specificity, which proves that tsRNA-3023b has good diagnostic efficiency. In addition, compared with traditional cardiac troponin I (cTnI), tsRNA-3023b shows higher accuracy in predicting the 28-day mortality rate of sepsis cardiomyopathy patients, which suggests that it may have greater value in clinical application.
[0045] (3) In clinical experiments, it was found that the expression of creatine kinase isoenzyme (CK-MB) and interleukin 6 (IL-6) in the plasma of patients was positively correlated with the expression of tsRNA-3023b. CK-MB is a marker of myocardial cell damage, while IL-6 reflects the inflammatory response of myocardial cells and the whole body. The combined detection of the two can reflect the severity of sepsis cardiomyopathy, and the correlation of the expression level of tsRNA-3023b with these indicators shows that the level in the plasma can effectively reflect the severity of the disease.
[0046] (4) In in vitro cell experiments, the expression changes of tsRNA-3023b were verified by AC16 myocardial cell models treated with lipopolysaccharide (LPS). The results showed that after simulating sepsis stimulation, the expression of tsRNA-3023b in myocardial cells increased significantly, which provided a cell molecular basis for the marker as a diagnostic tool.
[0047] (5) Finally, the cell verification experiment showed that knocking down tsRNA-3023b could reduce the expression levels of CK-MB and IL-6, and reduce the damage of sepsis myocardial cells. In addition, the relationship between the expression of tsRNA-3023b and the proportion of myocardial cell death after LPS treatment showed that LPS induction could cause the expression of tsRNA-3023b to increase and the number of cell death to increase, and after knocking down tsRNA-3023b, the proportion of myocardial cell death decreased. This shows that tsRNA-3023b is not only an effective diagnostic marker, but also a potential therapeutic target for sepsis cardiomyopathy. BRIEF DESCRIPTION OF DRAWINGS
[0048] Figure 1 Volcano plot of tsRNA expression difference in LPS-induced AC16 myocardial cells, sepsis cardiomyopathy cell model and normal control obtained by sequencing;
[0049] Figure 2 Determination of tsRNA-3023b content in the plasma of sepsis cardiomyopathy patients and normal controls by qRT-PCR method;
[0050] Figure 3 ROC curve of tsRNA-3023b for diagnosing sepsis cardiomyopathy patients;
[0051] Figure 4 ROC curve of tsRNA-3023b and cTnI for predicting the 28-day mortality rate of sepsis cardiomyopathy patients in the external verification cohort;
[0052] Figure 5A Relationship between CK-MB and tsRNA-3023b expression in patients;
[0053] Figure 5B The relationship between IL-6 and tsRNA-3023b expression levels in patients;
[0054] Figure 6 The relationship between the proportion of dead cardiomyocytes induced by LPS and the expression level of tsRNA-3023b;
[0055] Figure 7A The graph shows the expression level of tsRNA-3023b after transfection of AC16 cardiomyocytes with small interfering RNA (siRNA) of tsRNA-3023b.
[0056] Figure 7B The graph shows the expression levels of messenger RNA (mRNA) after AC16 cardiomyocytes were transfected with tsRNA-3023b siRNA.
[0057] Figure 8A The expression of CM-MB in AC16 cardiomyocytes induced by LPS after siRNA knockdown of tsRNA-3023b;
[0058] Figure 8B The expression of IL-6 in AC16 cardiomyocytes induced by LPS after siRNA knockdown of tsRNA-3023b;
[0059] Figure 9 The changes in the proportion of cardiomyocyte death in tsRNA-3023b knockdown and control group AC16 cardiomyocytes after LPS treatment. Detailed Implementation
[0060] The present invention is further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0061] First, 3 cases of LPS-induced AC16 cardiomyocytes and 3 cases of normal control cells were selected to extract total RNA and send to Guangzhou Epigenetic Company for tsRNA sequencing. The tsRNA with significant difference in expression (Fold change≥2.0, P value<0.05) was screened, and the content of the top 10 tsRNA in the patient's plasma was determined by qRT-PCR. The first one with significant increase was used for subsequent experiments. Then the inventors used in vitro experimental cell level to verify the relationship between the expression of tsRNA-3023b and sepsis cardiomyopathy again. The specific data are as follows.
[0062] Example 1 Screening of tsRNA markers of sepsis cardiomyopathy and correlation study
[0063] 1. Clinical samples:
[0064] Sepsis and septic shock patients admitted to the General Hospital of the People's Liberation Army in 2020-2023 were collected. According to whether sepsis cardiomyopathy occurred, they were divided into non-sepsis cardiomyopathy group (50 cases) and sepsis cardiomyopathy group (50 cases).
[0065] Another external validation cohort (2022-2023) was selected from Fuwai Hospital: non-sepsis cardiomyopathy group (45 cases) and sepsis cardiomyopathy group (44 cases). Blood samples and related test results were collected. The diagnostic criteria for sepsis cardiomyopathy: PiCCO monitoring of patients with left ventricular stroke volume index decreased (indicating decreased myocardial contractility) and excluding possible coronary artery obstruction.
[0066] Inclusion criteria: ①Comply with the 2016 definition and diagnostic criteria of sepsis 3.0 jointly issued by the American College of Critical Care Medicine and the European College of Critical Care Medicine: sepsis-related sequential organ failure score acute change≥2 points; ②Sepsis shock diagnostic criteria: persistent hypotension in sepsis patients after adequate fluid resuscitation, requiring vasopressor to maintain mean arterial pressure≥65mmHg and serum lactate level≥2mmol / L.
[0067] Exclusion criteria: ①Age less than 18 years old or more than 70 years old; ②Complicated with acute myocardial infarction, myocarditis, cardiomyopathy, valvular heart disease, cardiopulmonary resuscitation, electric defibrillation and electric cardioversion, and postoperative heart surgery; ③Pregnancy, lactation, tumor, extensive burns, human immunodeficiency virus (HIV) infection, long-term use of immunosuppressants; ④Length of stay in ICU<24h; ⑤Clinical data not collected within 6h after admission; ⑥Giving up treatment or automatic discharge.
[0068] 2. Plasma extraction:
[0069] Peripheral blood of human was collected by EDTA anticoagulation blood collection tube, centrifuged at 2500g for 15min, and the upper layer plasma was taken into 2ml sterile tube and stored in -80℃ refrigerator.
[0070] 3. RNA extraction and qRT-PCR:
[0071] 3.1. RNA extraction
[0072] Total RNA was extracted from plasma using RNA simple Total RNA Kit (DP419, TIANGEN). Add 1 ml TRIZOL Reagent to the plasma and add chloroform 200 uL, shake for 20 s, stand at room temperature for 10 min: 13000 rpm, 4°C centrifugation for 15 min. Carefully aspirate the supernatant, add isopropanol 800 u1, mix gently up and down, stand at -20°C for 1 h, 13000 rpm, 4°C centrifugation for 15 min, discard the supernatant. Add 1 ml 75% ethanol, gently wash the precipitate, remove the supernatant after 4°C centrifugation at 13000 rpm for 5 min, and blow dry. Add appropriate amount of enzyme-free water, promote dissolution at 65°C for 10 min to detect the OD value and concentration of RNA, and store at -80°C for standby.
[0073] 3.2. Reverse transcription of RNA to synthesize cDNA
[0074] 500 ng of RNA was reverse transcribed to cDNA using a reverse transcription kit (Takara RR037A). 3.3. Reverse transcription of tsRNA:
[0075] Operation on ice, each reaction system 20 uL, as follows:
[0076] Table 1
[0077]
[0078] 3.4. Reverse transcription of mRNA:
[0079] Operation on ice, each reaction system 20 uL, as follows:
[0080] Table 2
[0081]
[0082] The reaction procedure is as follows: 37°C for 45 min, 85°C for 5 min, and 4°C for maintenance.
[0083] (5) qRT-PCR
[0084] According to the tsRNA primer design principle, tsRNA primer sequences were designed. The cDNA obtained by reverse transcription was diluted according to 1:10, and the following qRT-PCR reaction was carried out.
[0085] Operation on ice, each reaction system 20 uL, as follows:
[0086] Table 3
[0087]
[0088] The reaction solution was mixed and the Real-time PCR instrument reaction program was as follows:
[0089] Stage 1: 95℃ 2min;
[0090] Stage 2: Cycle 35, 94℃ 5s, 60℃ 1min;
[0091] Stage 3: 95℃ 15s, 60℃ 1min, 95℃ 5s;
[0092] The relative level of each mRNA was quantified by GAPDH, and expressed as a relative ratio.
[0093] 4. tsRNA sequencing analysis:
[0094] After extracting total RNA from 3 cases of LPS-induced AC16 myocardial cells and 3 cases of normal control cells, the total RNA was sent to Guangzhou Epigenomics Company for tsRNA sequencing. The tsRNA with significant difference in expression (Fold change≥2.0, P<0.05) was screened, and the content of the top 10 tsRNA in the patient's plasma was determined by qRT-PCR. The first one with significant increase was selected for subsequent experiments. Figure 1 The volcano plot of the tsRNA expression difference between the LPS-induced myocardial cells AC16 and the normal control obtained by sequencing is shown in Table 4. The top 10 up-regulated tsRNA obtained by sequencing is shown in Table 4. The tsRNA with the highest expression was selected for subsequent experiments.
[0095] Table 4 Top 10 up-regulated tsRNA obtained by sequencing data
[0096]
[0097] 5. ROC curve drawing:
[0098] The receiver operator characteristic curve (ROC) is a curve obtained by plotting the true positive rate and the false positive rate. It can be used to reflect the relationship between sensitivity and specificity. It is with sensitivity as the vertical coordinate, 1-specificity as the horizontal coordinate, and according to the measurement value of the test group and the control group, a series of cutoff values are calculated, the given points are connected into a line, and the curve is the ROC curve. GraphPad Prism software is used to draw the ROC curve. The ROC curve reflects the diagnostic performance of the marker for the disease.
[0099] 6. Statistical Analysis:
[0100] For normally distributed variables, t-tests and ANOVA were used; for non-normally distributed variables, Mann-Whitney U tests and Kruskal-Wallis tests were used. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism software (9.1.0). Biological replicates were displayed as single data points superimposed on the bar chart. P < 0.05 was considered statistically significant.
[0101] 7. Experimental Results:
[0102] like Figure 2 As shown, the tsRNA-3023b level in the plasma of patients with septic cardiomyopathy was determined using qRT-PCR. The results showed that the expression level of tsRNA-3023b in the plasma of patients with septic cardiomyopathy was significantly higher than that in healthy controls, indicating that tsRNA-3023b is a potential biomarker for septic cardiomyopathy.
[0103] like Figure 3 The ROC curve of tsRNA-3023b in diagnosing patients with septic cardiomyopathy is shown in the figure; it indicates that tsRNA-3023b has good sensitivity and specificity, demonstrating its good diagnostic efficacy.
[0104] cTnI, as a myocardial-specific biomarker, plays a significant role in predicting mortality in patients with severe acute respiratory distress syndrome (SIC). Studies have shown that patients with elevated cTnI levels upon ICU admission have significantly increased mortality, and the degree of elevation is positively correlated with prognosis. Even in critically ill patients without cardiac disease, elevated cTnI indicates a poor prognosis. Dynamic monitoring shows that patients with persistently elevated or high cTnI levels have a worse prognosis. Particularly in critically ill patients with sepsis, acute respiratory distress syndrome, and other conditions, elevated cTnI often indicates myocardial damage, and these patients have a poor prognosis. Furthermore, combining cTnI with other indicators such as lactate and BNP can further improve predictive accuracy. However, it is important to note that elevated cTnI levels can be influenced by various factors, and the results should be interpreted in conjunction with a comprehensive assessment of the specific clinical circumstances.
[0105] like Figure 4As shown, the external validation queue verifies the diagnostic performance of tsRNA-3023b, and the AUC curve analysis shows that the new biomarker tsRNA-3023b and the traditional marker cTnI both show good predictive value, and the area under the ROC curve (AUC) is 0.9180 and 0.8588, respectively. Compared with cTnI, tsRNA-3023b has higher prediction accuracy, suggesting that it may become a potential new marker for predicting the 28-day mortality rate of patients with sepsis cardiomyopathy.
[0106] Example 2 Relationship between CM-MB, IL-6 and expression amount of tsRNA-3023b
[0107] 1. Research background:
[0108] CK-MB is an important myocardial enzyme index. It has a high content in myocardial cells, especially in myocardium, which mainly contains CK-MB, generally accounting for 14% to 42% of total CK, and is the main diagnostic indicator of acute myocardial infarction. The increase of CK-MB can reflect the degree of myocardial cell damage, and its change is earlier than that of total creatine kinase activity, so it plays an important role in the early diagnosis of acute myocardial infarction. The increase of CK-MB can be used as one of the diagnostic criteria for acute myocardial infarction, and generally the increase of creatine kinase isoenzyme CK-MB more than 3 times is clinically significant. In the process of acute myocardial infarction, CK-MB generally begins to rise 3 to 6 hours after the onset, reaches a peak at 12 to 24 hours, and returns to normal in 2 to 3 days. In addition, the increase of CK-MB can also be seen in myocarditis, cardiac surgery, pericarditis, muscular dystrophy, polymyositis, muscle atrophy, crush injury, etc., and even intramuscular injection may cause its increase. The normal value range of CK-MB detected by immunosuppression method is 0 to 25 U / L, and the increase indicates the presence of myocardial damage. Therefore, the detection of CK-MB is of great significance for the diagnosis and treatment of myocardial related diseases.
[0109] IL-6 is an inflammatory factor that rapidly produces in the process of acute inflammatory reaction in surgical operation, stress reaction, brain death, tumor occurrence and other conditions. As an infection marker, IL-6 has a wide application in auxiliary diagnosis, efficacy observation and prognosis. The increase of IL-6 is positively correlated with the severity of the disease, and the increase reflects the severity of the disease, especially when the whole body is infected, which is more obvious, indicating that the patient has a high risk of sepsis. Under normal circumstances, the IL-6 level of normal people should be less than 7 pg / mL.
[0110] 2. Experimental method:
[0111] CK-MB and IL-6 determination: CK-MB and IL-6 determination kit (ZC-34224) and (ZC-32446) were used to determine the plasma or cell supernatant. According to the first each well was added with standard or sample 100ul, the kit was balanced at room temperature for 30min, then the required strip was taken out from the aluminum foil bag, the remaining strip was sealed with a self-sealing bag and put back at 4℃. The standard wells were added with different concentrations of standard 50ul. The sample wells were added with 50ul of sample to be tested; the blank wells were not added. Except for the blank wells, 100ul of horseradish peroxidase (HRP) labeled detection antibody was added to each well of the standard and sample wells, the reaction wells were sealed with sealing film, and incubated at 37℃ in water bath or incubator for 60min. Discard the liquid, pat dry on the blotting paper, add full of washing solution (350ul) to each well, stand for 1min, shake off the washing solution, pat dry on the blotting paper, repeat the plate washing for 5 times (also can use plate washer). Add 50ul of substrate A and B to each well, incubate at 37℃ for 15min. Add 50ul of stop solution to each well, and measure the OD value of each well at 450nm within 15min.
[0112] 3. Experimental results:
[0113] As shown in Figure 5A and Figure 5B , the expression levels of CM-MB, IL-6 and tsRNA-3023b of myocardial cells have good positive correlation, and these results show that the level of tsRNA-3023b in plasma can reflect the severity of septic cardiomyopathy, and can be used for risk and condition assessment of septic cardiomyopathy.
[0114] Example 3 In vitro experimental cell level verification of relationship between expression amount of tsRNA-3023b and sepsis cardiomyopathy Figure 6
[0115] 1. Cell culture:
[0116] Human myocardial cell line (AC16) was purchased from Wuhan Punsai Company, and the cells were cultured in RPMI-1640 medium + 10% fetal bovine serum, and cultured in a 5% carbon dioxide incubator at 37℃.
[0117] siRNA knockdown method: siRNA was ordered from Thermo Fisher Company, and according to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was determined by qRT-PCR after induction for 24h.
[0118] 2. Preparation of septic cardiomyopathy cell model:
[0119] The cultured AC16 myocardial cells were exposed to 10 mM LPS for cell induction treatment. LPS is a component of the outer wall of the cell wall of Gram-negative bacteria, which is a substance composed of lipids and polysaccharides (glycolipids). After 24 hours of LPS induction of myocardial cells, similar injury pathological changes can occur in physiological and biochemical myocardial cells with septic cardiomyopathy. This method is internationally recognized as a cell model of septic cardiomyopathy. The levels of tsRNA in the cells and CK-MB and IL-6 in the cell supernatant were compared with those in the myocardial cells of the control group.
[0120] 3. The qRT-PCR method is the same as in Example 1.
[0121] 4. Plasma CK-MB and IL-6 are the same as in Example 2.
[0122] 5. Cell death rate determination
[0123] The cell death rate was determined using the Protein Technology Cell Live / Dead Staining Kit (PF00007). 2 μM Calcein AM and 4.5 μM PI staining working solution were taken out and allowed to recover to room temperature. 30 μL Calcein AM and 4.5 μL PI staining working solution were mixed with 10 ml PBS or other serum-free buffer or culture medium, and vortexed to mix well. The cells were washed thoroughly with PBS buffer for 2-3 times to completely remove the residual esterase activity. The PBS solution was aspirated and a sufficient amount of Calcein AM / PI staining working solution was added. Incubate at room temperature for 15-20 minutes in the dark. Observe the positive cells under a fluorescence microscope.
[0124] 6. Experimental results:
[0125] As shown in Figure 7A , the expression level of tsRNA-3023b in LPS-induced AC16 myocardial cells has a good correlation with the death rate of myocardial cells, indicating that tsRNA-3023b has good diagnostic efficiency.
[0126] Figure 7B After transfecting AC16 myocardial cells with siRNA of tsRNA-3023b, the expression of tsRNA-3023b was reduced, Figure 8A which shows that the total amount of mRNA is unchanged after tsRNA-3023b knockdown; indicating that the transfection is successful, and the subsequent experiments are completed on this basis.
[0127] Figure 8B and Figure 9After transfecting AC16 interstellar cells with siRNA of tsRNA-3023b, the expression of two sepsis cardiomyopathy-related cell damage markers (CK-MB is a myocardial cell damage marker, and IL-6 is a myocardial cell inflammation marker) in AC16 cells was detected. It can be seen that after knocking down tsRNA-3023b, the expression of CK-MB and IL-6 is reduced, indicating that knocking down tsRNA-3023b can reduce the damage of sepsis myocardial cells, and tsRNA-3023b can be used as a therapeutic target for sepsis cardiomyopathy.
[0128] Example 4 Sequences, primers and kit compositions involved in the present application In order to knock down tsRNA-3023b and control group AC16 interstellar cells after LPS treatment, the relationship between the expression amount of tsRNA-3023b and the proportion of myocardial cell death, the results show that LPS induction can cause the expression of tsRNA-3023b to increase and the cell death to increase, and the proportion of myocardial cell death is reduced after knocking down tsRNA-3023b. This is the basis for tsRNA-3023b as a therapeutic target for sepsis cardiomyopathy.
[0129] The above implementation results show that tsRNA-3023b has a significant correlation with sepsis cardiomyopathy, and is a new biological marker for sepsis cardiomyopathy; the ROC curve shows that tsRNA-3023b has good ability to diagnose sepsis cardiomyopathy patients; tsRNA-3023b is up-regulated in myocardial cells treated with LPS induction reagent; it is indicated that tsRNA-3023b may be involved in the action of LPS on myocardial cell damage.
[0130] In summary, tsRNA-3023b is expected to become a new diagnostic biomarker and therapeutic target for sepsis cardiomyopathy.
[0131]
[0132] The sepsis cardiomyopathy marker tsRNA-3023b provided by the application has a nucleotide sequence shown as SEQ ID No. 1, is derived from a tRFdb database, and is numbered 3023b.
[0133] SEQ ID No. 1: TCGATCCCGGGTTTCGGCACCA
[0134] The primer pair for specifically recognizing tsRNA-3023b provided by the application includes an upstream primer shown as SEQ ID No. 2 and a downstream primer shown as SEQ ID No. 3:
[0135] SEQ ID No. 2: TTTCGATCCCGGGTTTCG
[0136] SEQ ID No. 3:
[0137] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGTGC
[0138] The kit provided by the application comprises:
[0139] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primer, RNase-free water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primer (F+R) (10 μM), ROX Reference dye (50x).
Claims
1. Use of a reagent for detecting the expression amount of a tsRNA marker, characterized in that One or more of the following applications: A1) use in the preparation of a product for diagnosing sepsis cardiomyopathy; A2) use in the preparation of a product for screening sepsis cardiomyopathy; A3) use in the preparation of a product for assessing the condition of sepsis cardiomyopathy; The tsRNA marker is tsRNA-3023b, and the nucleotide sequence is shown as SEQ ID No.
1.
2. The use of claim 1, wherein: The product is a product for diagnosing sepsis cardiomyopathy by detecting the expression level of tsRNA-3023b through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.
3. The use of claim 1, wherein: The reagent is a reagent for detecting the expression of tsRNA-3023b, or a reagent for specifically recognizing tsRNA-3023b, or a reagent for detecting the content of tsRNA-3023b.
4. The use according to claim 1, characterized in that The reagent is a reagent for detecting tsRNA-3023b, specifically a), b) or c) as follows: a) primers for detecting or specifically recognizing tsRNA-3023b; b) a reagent set containing the a) reagent; c) a kit containing the a) or b) reagent.
5. The use of claim 4, wherein: The primers are the upstream primer shown as SEQ ID No. 2 and the downstream primer shown as SEQ ID No.
3.
6. Use of a kit for detecting tsRNA markers, characterized in that One or more of the following applications: A1) use in the preparation of a product for diagnosing sepsis cardiomyopathy; A2) use in the preparation of a product for screening sepsis cardiomyopathy; A3) use in the preparation of a product for treating sepsis cardiomyopathy; A4) use in the preparation of a product for assessing the condition of sepsis cardiomyopathy; A5) use in the preparation of a product for differentiating sepsis cardiomyopathy from other diseases; The tsRNA marker is tsRNA-3023b, and the nucleotide sequence is shown as SEQ ID No. 1; the kit comprises a reagent for detecting or specifically recognizing tsRNA-3023b, or a reagent for detecting the expression of tsRNA-3023b.
7. The use of the kit of claim 6, wherein: The reagent for detecting or specifically recognizing tsRNA-3023b is a specific primer, and the specific primer is an upstream primer shown as SEQ ID No. 2 and a downstream primer shown as SEQ ID No.
3.
8. Use of primers for detecting tsRNA markers, characterized in that One or more of the following applications: A1) use in the preparation of a product for diagnosing sepsis cardiomyopathy; A2) use in the preparation of a product for screening sepsis cardiomyopathy; A3) use in the preparation of a product for treating sepsis cardiomyopathy; A4) use in the preparation of a product for assessing the condition of sepsis cardiomyopathy; A5) use in the preparation of a product for differentiating sepsis cardiomyopathy from other diseases; The primers are primers for detecting the expression of tsRNA-3023b or specifically recognizing tsRNA-3023b, and the tsRNA marker is tsRNA-3023b, and the nucleotide sequence is shown as SEQ ID No.
1.
9. The primer for use according to claim 8, wherein: the primer is an upstream primer of SEQ ID No. 2 and a downstream primer of SEQ ID No.
3.
Citation Information
Patent Citations
Methods of diagnosis, prognosis and treatment of cardiovascular disease
CA2390820A1
Biomarker related to sepsis and application thereof
CN117965718A