Use of N-(4-(N-phenylethylsulfamoyl)phenyl)-2,2-diphenylacetamide for the preparation of a medicament for the treatment of nervous system diseases

By targeting SLC11A2 with N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide compounds, the neuronal damage caused by Alzheimer's disease is improved, which solves the problems of poor targeting and large side effects of existing drugs and achieves safe and effective neuroprotective effects.

CN120732872BActive Publication Date: 2025-11-11广州市老人院(加挂广州市第二老人院和广州市老年医院牌子)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511186835.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-25
Publication Date
2025-11-11
Estimated Expiration
2045-08-25

AI Technical Summary

Technical Problem

Existing drugs for treating neurological diseases suffer from problems such as poor targeting, significant side effects, and limited therapeutic efficacy. In particular, there is a lack of drugs that target SLC11A2 to treat or improve nerve cell damage caused by Alzheimer's disease.

Method used

Using N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide as the active ingredient, this study aimed to improve nerve cell damage by targeting SLC11A2. The screening process included CRISPR whole-genome KO library construction, virtual screening, and network pharmacology analysis. Compounds HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 were identified as effective drugs.

Benefits of technology

These compounds can effectively inhibit the expression of SLC11A2, reduce iron metabolism disorders caused by Aβ1-42 deposition, significantly improve neuronal damage, and have few toxic side effects, providing a safe and effective neuroprotective strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120732872B_ABST
    Figure CN120732872B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of drug development technology, specifically relating to the application of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the preparation of drugs for treating nervous system diseases. The purpose of this invention is to provide a drug with low toxicity and side effects that can target SLC11A2 to treat or improve nerve cell damage. The technical solution of this invention is the application of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the preparation of drugs for treating nervous system diseases. This invention demonstrates that the compound N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide has low toxicity and side effects, and can protect or improve nerve cell damage by targeting SLC11A2; providing a new option for preparing drugs to treat or improve nerve cell damage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of drug development technology, specifically relating to the application of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the preparation of drugs for treating nervous system diseases. Background Technology

[0002] Neurological diseases, such as Alzheimer's disease, Parkinson's disease, stroke, and traumatic brain injury, are closely related to neuronal death and dysfunction. As highly differentiated terminal cells, nerve cells have limited regenerative capacity, and their damage and death often lead to irreversible neurological deficits. Therefore, developing effective neuroprotective strategies is of great significance for the prevention and treatment of neurological diseases. In recent years, with the deepening research into the mechanisms of neuronal death, a variety of potential neuroprotective targets have been discovered, such as inhibiting excitatory amino acid toxicity, reducing oxidative stress, inhibiting apoptosis, and promoting the secretion of neurotrophic factors. Based on these targets, researchers have developed various neuroprotective strategies, including drug intervention, gene therapy, cell therapy, and physical therapy. Although many neuroprotective strategies have entered clinical trials, they still face many challenges, such as poor drug targeting, significant side effects, and limited therapeutic efficacy. Therefore, developing safer, more effective, and more targeted neuroprotective technologies remains a key focus and challenge of current research.

[0003] While current medications for treating nerve cell damage have some efficacy, they still have many drawbacks. For example, sodium ganglioside injection may induce allergic reactions such as rashes, chills, and high fever; some sedative-hypnotic drugs can lead to drug dependence with long-term, high-dose use; patients taking donepezil long-term may experience a gradual decrease in efficacy, along with side effects such as excessive mental excitement, mood swings, gastrointestinal discomfort, and liver damage; and rivastigmine use may cause gastrointestinal reactions and liver damage. Some nerve cell damage treatments, especially biological inhibitors or high-end drugs, are expensive and their use is severely limited, further restricting their clinical application in treating diseases. Summary of the Invention

[0004] The purpose of this invention is to provide a drug with minimal toxicity and side effects that can target SLC11A2 to treat or improve nerve cell damage.

[0005] The technical solution of this invention is the application of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the preparation of drugs for treating nervous system diseases; the structural formula of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide is as follows: .

[0006] The neurological disease mentioned above is caused by Aβ deposition.

[0007] Furthermore, the neurological disease is Alzheimer's disease.

[0008] Specifically, the concentration of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the drug is 5-50 μM.

[0009] Preferably, the concentration of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the drug is 10~20 μM.

[0010] The present invention also provides a medicament for treating nervous system diseases, comprising N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide.

[0011] The neurological disease mentioned above is caused by Aβ deposition.

[0012] Furthermore, the neurological disease is Alzheimer's disease.

[0013] Specifically, the concentration of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the drug is 5-50 μM.

[0014] Preferably, the concentration of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the drug is 10~20 μM.

[0015] This invention also provides the application of gene SLC11A2 as a detection target in the preparation of reagent kits for the diagnosis or prognosis evaluation of nerve cell injury.

[0016] The nerve cell damage is caused by Aβ deposition.

[0017] The nerve cell damage mentioned above is caused by Alzheimer's disease.

[0018] Specifically, the kit contains primers for amplifying the gene or antibodies for detecting the protein encoded by the gene.

[0019] The beneficial effects of this invention: This invention, through preliminary experiments, screened out a large number of substances related to Aβ. 1-42 This invention identifies proteins associated with SY5Y cell damage and uses SLC11A2 as a target for subsequent drug screening. It also provides a detection target for assessing or predicting neural cell damage. Through a series of network pharmacology studies, compounds HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 were screened. Cellular experiments revealed that these compounds can improve the condition caused by Aβ. 1-42The induced changes in SY5Y cell activity improved neuronal cell damage. This may be because HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 inhibited SLC11A2 expression, thereby improving iron metabolism disorders and reducing Aβ. 1-42 This is caused by deposition. The present invention also experimentally demonstrates that HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 have few toxic side effects and can protect or improve nerve cell damage by targeting SLC11A2. The present invention provides a new option for preparing treatments or improving nerve cell damage. Attached Figure Description

[0020] Figure 1 To analyze the viability of SH-SY5Y cells for CCK8, the viability of the control group NC was 100%.

[0021] Figure 2 The images show the validation of the KO library cell lines. In the images, A shows the q-PCR detection of sgRNA plasmid transfection; B shows the DNA electrophoresis detection of sgRNA plasmid integration.

[0022] Figure 3 For Aβ 1-42 Figure showing the enrichment of SH-SY5Y cells.

[0023] Figure 4 This is a CRISPR library screening diagram, showing the key negative regulatory targets for neural cell survival discovered during the screening. Specifically, Figure A is a heatmap showing significantly upregulated sgRNAs; Figure B is a heatmap showing the corresponding sgRNAs for each top target gene; and Figure C shows the log2 FC values ​​of each differentially expressed gene and the corrected values ​​for all sgRNAs. P The volcano plot of the value, after correction, P < 0.1.

[0024] Figure 5 Figure A shows the in vitro validation of the candidate target. Figure B shows the KO efficiency of the candidate target detected by q-PCR; Figure CK8 assay shows the effect of CCK8 on the inhibition of Aβ by the candidate target. 1-42 The effect of induced SH-SY5Y cell survival.

[0025] Figure 6 This is a flowchart of the virtual screening process based on molecular docking.

[0026] Figure 7 The chemical structure is N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide.

[0027] Figure 8This is a Venn diagram showing AD-related genes from the GeneCards and DisGeNET databases. Orange: AD-related genes from the GeneCards database; Green: AD-related genes from the DisGeNET database.

[0028] Figure 9 Venn diagram for analyzing small molecule compounds and disease-related genes. Green: Number of genes related to small molecule compounds; Blue: Disease-related genes.

[0029] Figure 10 Compounds HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 are used to target Aβ. 1-42 Effect of treatment on SLC11A2 mRNA expression level in SY5Y cells ( (±s, n=3) plot; compared with the blank group, *** P < 0.001; compared with the model group, ## P < 0.01, ### P < 0.001.

[0030] Figure 11 This is a diagram illustrating the KEGG pathway.

[0031] Figure 12 This is a GO analysis plot. The vertical axis represents the number of genes enriched in each biological function. The horizontal axis represents the three parts into which gene function is divided: biological process (BP), cellular component (CC), and molecular function (MF). The three parts involve the following functions: biological process (protein phosphorylation, signal transduction, protein autophosphorylation, chromatin remodeling, positive regulation of cell population proliferation, intracellular signal transduction, negative regulation of apoptosis, positive regulation of the transcription of the epidermal growth factor receptor signaling pathway by RNA polymerase II, insulin-like growth factor receptor signaling pathway), cellular component (plasma membrane, cytosol, cytoplasm, membrane, nucleoplasm, extracellular body, extracellular region, mitochondria, glutamatergic synapse), and molecular function (protein binding, ATP binding, protein serine / threonine kinase activation, protein kinase activation, histone H3Y41 kinase activity, H2AXY142 kinase activity, protein tyrosine kinase activity, metal ion binding).

[0032] Figure 13 This is a network diagram of "component-target-disease"; orange-red represents targets, and blue represents screened drugs.

[0033] Figure 14This is a visualization of molecular docking. Light blue helical structure: SLC11A2 protein structure; green: small molecules; dark blue: amino acid binding sites; yellow: small molecules.

[0034] Figure 15 For different drugs to affect Aβ 1-42 The effect of treatment on the viability of SY5Y cells (±s, n=3) is shown in the figure. Compared with the control group, ** P < 0.01, *** P < 0.001 compared with the model group # P < 0.05 ## P < 0.01, ### P < 0.001.

[0035] Figure 16 The figure shows the effect of different drug concentrations on the viability of SY5Y cells (±s, n=3). Compared with the control group, * P < 0.05 ** P < 0.01, *** P < 0.001. Detailed Implementation

[0036] Most neurodegenerative diseases exhibit similar pathological features, with neuronal death being particularly destructive. However, the regulatory mechanisms governing neuronal death and axonal regeneration in neurodegenerative diseases remain poorly understood. An imbalance in the production and degradation mechanisms of Aβ (β-amyloid) in the brain is currently a widely accepted pathogenesis of Alzheimer's disease. Aggregated Aβ is toxic to neurons, causing necrosis and apoptosis. Identifying Aβ-damage-responsive targets and systematically analyzing the mechanisms by which Aβ deposition damages neurons can provide new insights for the development of neuroprotective therapeutic strategies.

[0037] CRISPR library screening technology is a screening technology based on the CRISPR / Cas9 system. It designs and constructs sgRNA libraries targeting all known genes of a species or certain gene groups of interest. It enables the simultaneous knockout or activation of different genes in the same tube cell and performs functional screening through methods such as drug treatment modeling to discover genes related to the screened phenotype.

[0038] This invention uses a CRISPR whole-genome KO library to construct a stable cell line, and utilizes Aβ... 1-42 (Aβ) 1-42It is a key variant of Aβ, playing a central role in the development and progression of Alzheimer's disease (AD) due to its unique structure and pathological characteristics. This variant was used in subsequent experiments for modeling. A neurotoxic injury SH-SY5Y cell model was induced, and surviving cells were screened for library sequencing. Analysis was conducted to identify negative regulatory targets for neuronal cell survival, providing research targets for subsequent screening of drugs with neuroprotective effects.

[0039] After extensive screening experiments, SLC11A2 was ultimately identified as a potential target for treating or improving neuronal cell damage. SLC11A2, also known as Divalent cation transporter 1 (DMT1), NRAMP 2, or Solute carrierfamily 11 member 2, is a proton-coupled metal ion cotransporter. It primarily transports Cd(2+), Fe(2+), Co(2+), and Mn(2+), and secondarily transports divalent metal cations such as Zn(2+), Ni(2+), and VO(2+). It is crucial for maintaining iron homeostasis, regulating intestinal Fe(2+) absorption, transporting TF-related endosome Fe(2+), and promoting the entry of Fe(2+) and Mn(2+) into mitochondria. SLC11A2 is associated with various diseases; for example, iron metabolism disorders and neuronal ferroptosis in Alzheimer's disease (AD) may be related to abnormal expression or function of SLC11A2. The study also found that knocking out the SLC11A2 gene can reverse neuronal structural and functional damage and cognitive and behavioral abnormalities caused by Aβ, but there are currently no drugs that target SLC11A2 to treat or improve neuronal damage.

[0040] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0041] Example 1 Aβ 1-42 Exploration of toxic and damaging concentrations in SH-SY5Y cells

[0042] SH-SY5Y cells (Wuhan Pronosai Biotechnology) in logarithmic growth phase were harvested and the cell concentration was adjusted to 1×10⁻⁶. 5 Inoculate 100 μL / well into 96-well plates at a concentration of 1 / mL and incubate at 37°C with 5% CO2 for 12 h. Then, use Aβ. 1-42 (Beyotime Biotechnology) established a damage model through treatment. The culture medium was changed to final concentrations of 5 μM, 10 μM, 15 μM, 20 μM, and 40 μM Aβ. 1-42100 μL of solution per well. The normal control group and the zeroing well were replaced with serum-free medium. Each group had 5 replicates. Incubate in an incubator for 24 h.

[0043] CCK8 method for detecting Aβ 1-42 To assess cell viability, 20 μL of CCK8 solution (Beyotime, C0039) was added to each well; the culture plate was incubated in an incubator for 2 hours; and the absorbance at 450 nm was measured using a microplate reader (Thermo, Multiskoun GO).

[0044] The results are as follows Figure 1 As shown: Aβ 1-42 The cytotoxic damage to SH-SY5Y cells showed a certain concentration-dependent effect, and Aβ... 1-42 Increasing concentration gradients (5 μM, 10 μM, 15 μM, 20 μM, 40 μM) inhibited cell survival, with statistically significant differences compared to the normal control group (NC) (P < 0.05). The survival rates were 68.14%, 59.86%, 42.12%, 31.04%, and 28.3%, respectively. (20 μM Aβ) 1-42 The damage was significant and stable, therefore 20 μM Aβ was used. 1-42 The modeling condition was established by acting on SH-SY5Y cells for 24 hours.

[0045] Example 2: Construction of CRISPR full-genome KO library cell lines

[0046] (1) Cell plating: Plating 7×10 cells one day in advance 7 293T cells were placed in 15cm dishes and 10mL of DMEM medium containing 10% FBS was added. Before transfection, ensure that the cells reached approximately 90% confluence.

[0047] (2) Mixing plasmids: Take 22.5 μg of CRISPR KO library plasmids (including GECKOA and GECKOB plasmids, Zhongyuan Biotechnology), and 7.5 μg of pCMV-VSV-G, 7.5 μg of pMDLg pRRE, and 7.5 μg of pRSV-Rev lentiviral packaging plasmids (Jierui Biotechnology), and mix with 0.6 mL of FBS-free DMEM. Then add 90 μL of polyethyleneimine to the plasmid mixture, vortex briefly, and incubate for 15 min.

[0048] (3) Cell infection: Add the transfection reagent and mixed plasmid to 293T cells, change the medium after 6 hours, and then put them back into a 37°C, 5% CO2 incubator.

[0049] (4) Virus collection and concentration: Virus solution was collected 48 h and 72 h after transfection and centrifuged at 4000 rpm for 5 min at room temperature. The virus was concentrated to 0.2 mL by PEG precipitation and the lentivirus titer was detected by PCR. The virus was stored at -80℃.

[0050] (5) Determine the drug screening concentration: Set up a gradient concentration of puromycin, and use the lowest drug concentration that causes all SH-SY5Y cells to die in 7-10 days as the subsequent drug screening concentration.

[0051] (6) Cell infection and drug screening: One day before infection, SH-SY5Y cells were seeded into 15 cm dishes, and virus supernatant and 10 μg polybrene were added. The cells were then screened with puromycin to obtain stable cell lines.

[0052] DNA was extracted from SH-SY5Y wt cells, SH-SY5Y control group cells, and KO library cells. Primers for the KO library backbone vector were designed, and PCR amplification was performed to identify whether the KO library sgRNA was successfully transfected into cells. The specific steps are as follows:

[0053] DNA extraction: The HiPure Tissue DNA Mini Kit (Meiji Biotechnology) was used to extract Day0 SH-SY5Y whole gene knockout library cell lines and Aβ. 1-42 DNA from SH-SY5Y cells that survived the treatment was analyzed, and the DNA concentration was determined.

[0054] The amplification system was as follows: ddH2O 50µL, DNA 100ng, Primer (10µM) 2.5µL, 2×Phanta MaxMaster Mix 25µL. The amplification program was as follows: pre-denaturation 95℃ for 60s; denaturation 95℃ for 10s, annealing 56 / 60℃ for 10s, extension 72℃ for 30s, 20 cycles; 72℃ for 1min; 12℃. The primer sequences were: KO seq-F (SEQ ID No.1): TCTTTGTGGAAAGGACGAAACACCG; KO seq-R (SEQ ID No.2): ACCTTCTCTAGGCACCGGAT.

[0055] Electrophoresis and gel recovery: PCR products were recovered using the HiPure Gel Pure DNA Mini Kit after electrophoresis for sgRNA library sequencing. The PCR product (209 bp) sequence (SEQ ID No. 3) is as follows:

[0056] TCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTTTTGGATCCTAGGTCTTGAAAGGAG.

[0057] sgRNA library sequencing: High-throughput sequencing was performed using the HiSeq 2500 platform to analyze sgRNA reads from each group of samples.

[0058] like Figure 2 As shown in Figure A, compared with the control group (SH-SY5Y), the expression level of sgRNA mRNA in the cells of the experimental groups (SH-SY5-NC, SH-SY5Y-KO) was significantly increased (P < 0.001), indicating that the KO library transfection was successful. Figure 2 Figure B shows that SH-SY5-NC and SH-SY5Y-KO library cells have a very strong target band (209bp), while SH-SY5Y cells (negative control) have no obvious band, indicating that the sgRNA plasmid has been integrated into the DNA of SH-SY5Y cells.

[0059] Example 3 Aβ 1-42 Treatment of SH-SY5Y stable cell lines

[0060] Using the above-mentioned 20 μM concentration of Aβ 1-42 For processing SH-SY5Ywt and knockout library cell lines, since the CRISPR whole-gene KO libraries A (GECKOA) and B (GECKOB) contain 65,383 and 58,028 sgRNAs respectively, targeting and knocking out 19,050 genes, the number of cells processed per batch should be approximately 3 × 10⁻⁶ to ensure library coverage. 7 That is, the library coverage is greater than 200. Take a picture 24 hours after processing, such as... Figure 3 As shown. Genomic DNA was extracted from surviving cells, amplified by PCR, and the product was recovered for sgRNA library sequencing.

[0061] Example 4: Screening and Validation of Negative Regulatory Targets for Nerve Cell Survival

[0062] Bioinformatics analysis of control group library and Aβ 1-42Sequencing data of sgRNA libraries from surviving SH-SY5Y cells after treatment were used to screen for candidate negative regulatory targets of neural cell survival. Aβ was analyzed using Deseq_R. 1-42 The study addressed significantly upregulated sgRNAs in SH-SY5Y knockout library cell lines. Results showed 427 significantly upregulated sgRNAs in surviving cells. Figure 4 (Corrected P value < 0.1), where SLC11A2 was significantly overexpressed in surviving cells (log2FC > 10).

[0063] The candidate target KO plasmid was synthesized, packaged with lentivirus, and then used to infect the SH-SY5Y cell line (see Example 2 for the method). The knockout efficiency of the candidate target was detected by q-PCR; CCK8 assay was performed to determine whether inhibiting the expression of the candidate target could promote Aβ. 1-42 Induced SH-SY5Y cell survival, thereby exerting a neuroprotective effect. Figure 5 As shown in A, the expression levels of all candidate target genes were significantly reduced after transformation with the KO plasmid. The CCK8 experimental results showed ( Figure 5 (B in the text) Knocking out SLC11A2 can significantly promote Aβ. 1-42 The induced survival of SH-SY5Y cells indicates that knockdown of the candidate target gene has a neuroprotective effect.

[0064] The primers used for q-PCR are as follows: upstream primer F for amplifying β-actin (product length 185 bp): TGGCACCAGCACAATGAA (SEQ ID No. 4) and downstream primer R: CTAAGTCATAGTCCGCCTAGAAGCA (SEQ ID No. 5); upstream primer F for amplifying SLC11A2 (product length 195 bp): AATGGACTAGGCTGGCGGAT (SEQ ID No. 6) and downstream primer R: GGACATGCCCAGTGCAATCA (SEQ ID No. 7). The qPCR reaction program was: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, for 40 cycles.

[0065] Example 5: Initial screening of drugs targeting SLC11A2

[0066] SLC11A2 selectively transports divalent metal cations, including Fe(2+), which is crucial for maintaining iron homeostasis in the body. Furthermore, SLC11A2 is widely expressed in cells throughout the body, exhibiting diverse and important functions. SLC11A2 knockout can improve Aβ-induced iron metabolism disorders and neuronal ferroptosis, further supporting the important role of SLC11A2 in neuronal injury. Therefore, this invention focuses on SLC11A2 to screen for drugs that target and inhibit this gene to treat neuronal injury.

[0067] 1. Virtual Filtering

[0068] For SLC11A2, virtual screening was performed using the MCE 50K Diversity Library database and the Natural Product Library Plus database. Based on the docking scores, five components were then selected from each database for further research. The virtual screening software was Schrödinger Maestro 12.8, and the screening process was as follows: Figure 6 As shown.

[0069] After screening, the five components obtained are: (E)-N-benzyl-2-(4-((2-fluorobenzyl)oxy)benzylidene)hydrazine-1-thiocarboxamide (HY-Q42044), N-(4-(N-phenethylsulfamoyl)phenyl)-2,2-diphenylacetamide (HY-Q42678), and (E)-N-benzyl-2-((5-(phenylthio)furan-2-yl)methylene)hydrazine-1-thiocarboxamide (HY-Q42044). l)methylene)hydrazinecarbothioamide, HY-Q42034, 2-fluoro-N-(2-(4-methyl-2-(m-tolyl)thiazol-5-yl)ethyl)benzenesulfonamide, HY-Q31735, 1-((4-cyclohexylphenyl)sulfonyl)-N-(4-fluorobenzyl)-4-methylpiperidine-4-carboxamide, HY-Q02007. The structure of N-(4-(N-phenethylsulfamoyl)phenyl)-2,2-diphenylacetamide (HY-Q42678) is as follows: Figure 7 As shown.

[0070] 2. Network pharmacology analysis

[0071] The selected drug components in Smiles format were imported into the SwissTargetPrediction database (http: / / swisstargetprediction.ch) for target prediction, and all targets with a probability greater than 0 were selected. After integration, 376 targets with a probability greater than 0 were identified (Table 1), and after deduplication, there were a total of 254 potential targets.

[0072] Table 1. Compound-related genes

[0073] .

[0074] Alzheimer's disease is a common neurological disorder. Therefore, using "Alzheimer's disease" as the keyword, we searched for disease-related targets in the GeneCards database (https: / / www.genecards.org) and the DisGeNET database (http: / / www.disgenet.org / ), and then integrated the obtained targets. 26,108 Alzheimer's-related genes were found in the GeneCards database, and 3,397 in the DisGeNET database. After integrating the two databases, 26,266 Alzheimer's-related genes were identified. Figure 8 ).

[0075] The obtained compound-related genes and disease-related genes were uploaded to the Bioinformatics platform (http: / / www.bioinformatics.com.cn) to create a Venn diagram. Figure 9 The intersection of the two is taken, which means that there are 232 identical genes between the drug target and the disease-related genes.

[0076] Further KEGG and GO enrichment analyses were performed on 232 targets at the intersection of disease and compound using the DAVID database (https: / / davidbioinformatics.nih.gov / ). The top 20 pathways by KEGG count were plotted using the MicroBio platform. In the GO analysis, the top 20 terms by count for related genes in biological processes, cellular components, and molecular functions were analyzed. In the KEGG enrichment analysis (… Figure 11 The study found that related genes mainly clustered in cancer pathways, MAPK signaling pathways, neuroactive ligand-receptor interactions, PI3K-AKT signaling pathways, calcium signaling pathways, and RAS signaling pathways. In GO analysis (… Figure 12 In this study, the relevant genes mainly involve protein phosphorylation, signal transduction, chromatin remodeling, plasma membrane, solute, protein binding, and ATP binding.

[0077] To better illustrate the relationships between the various targets, a PPI protein interaction network was constructed using Cytoscape 3.7.1. Protein interaction analysis revealed that the drug's therapeutic mechanism is complex, involving synergistic effects among multiple targets rather than relying on a single target. The active pharmaceutical ingredient and its target were imported into Cytoscape 3.7.1 to construct a "component-target" network diagram. Furthermore, the Merge tool in Cytoscape 3.7.1 was used to merge the "component-target" network with the PPI protein interaction network, resulting in a "component-target-disease" network diagram. Figure 13 As shown, orange-red represents the target site, and blue represents the screened drug; the darker the target site's color, the higher its degree value, indicating that the target site is more important. The figure contains 5 screened active ingredients, 232 nodes, and 4174 edges.

[0078] Enter the name of the small molecule compound into the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov) to retrieve relevant information and download it in SDF format. Download the 3D structure (AF-P49281-F1) of Human SLC11A2 from the Alphafold website for later use. After obtaining the small molecule ligand and protein receptor, process them. First, use Chem 3D to optimize the mechanical structure of the small molecule and save it in mol 2 format. Then, use AutDocktools to process the ligand roots and rotation bonds in the above mol 2 file and output it as a PDBQT file. Using Pymol software, remove the water molecule, small molecule ligand, and repeating structure from the protein receptor, save it in PBD format, open it with AutDocktools, calculate the charge, add atoms, and determine the docking region. Create a configuration file and perform molecular docking. Then, use Pymol and the Protein-Ligand Interaction Profiler database (https: / / plip-tool.biotec.tu-dresden.de / plip-web / plip / index) to visualize the docking results. After processing the SLC11A2 protein structure, the docking cassette was determined to be (-7.622, 7.685, -7.309). Based on docking scores from highest to lowest, the results were: HY-Q42044 (-10.394), HY-Q42678 (-10.004), HY-Q42034 (-9.667), HY-Q31735 (-9.665), and HY-Q02007 (-9.627). The pose with the highest docking score was selected for visualization. Figure 14 ).

[0079] Example 6: Effects of different drugs on Aβ 1-42Effects of treatment on the viability of SY5Y cells

[0080] Weigh 1 mg of each of the aforementioned 5 compounds (Dongru Biotechnology) and place them into separate EP tubes. Prepare a 1 mM stock solution using DMSO:DMEM / F12 medium at a ratio of 1:100. The original stock solution of the synthesized drug was 10 mM, which was diluted to 1 mM using DMEM / F12 medium at a ratio of 1:9 for later use.

[0081] The experiment included a control group (CON), a model group (MOD), a 10 μM drug treatment group, and a 20 μM drug treatment group. SY5Y cells in the logarithmic growth phase were digested, centrifuged, and mixed with an appropriate amount of culture medium. Cell counts were performed, and cells were seeded at 10⁵ cells per well into 96-well plates. After 24 hours of cell attachment, the old culture medium was removed. For the control group, 100 μL of complete culture medium without antibiotics was added to each well. For the model group, 100 μL of 20 μM Aβ was added to each well. 1-42 In the 10 μM drug administration group, 100 μL of 20 μM Aβ solution was added to each well. 1-42 Mixed with a 10 μM drug solution, 100 μL of 20 μM Aβ was added to each well in the 20 μM dosing group. 1-42 After incubating with a 20 μM drug solution for 24 h, the old culture medium was removed, and fresh culture medium containing CCK-8 was added. After incubation for 2 h, the absorbance was measured at 450 nm, and cell viability was calculated. The effects of different drugs on Aβ were observed. 1-42 The effect of treatment on the survival rate of SY5Y cells.

[0082] The results are as follows Figure 15 As shown, compared with the control group, the cell survival rate of the model group was significantly decreased (P < 0.01, P < 0.001), indicating that 20 μM Aβ... 1-42 The modeling effect of damaging SY5Y cells for 24 hours was significant; compared with the model group, the cell survival rate of the low and high dose groups of different drugs was significantly increased (P<0.05, P<0.01, P<0.001), indicating that the drugs selected by virtual screening have a significant effect on Aβ. 1-42 It has a significant protective effect against cell damage. Further research will be conducted on components such as HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007.

[0083] Example 7: Effects of different drug concentrations on the viability of SY5Y cells

[0084] To determine the safe dosing range and optimal concentration of each drug on SY5Y cells, 1mM stock solutions of the four drugs were diluted with complete medium (without antibiotics) to prepare 5μM, 10μM, 25μM, 50μM, and 100μM solutions, respectively. After digestion and centrifugation of SY5Y cells in the logarithmic growth phase, appropriate amounts of medium were added and mixed thoroughly. Cells were counted, and then divided into 10 wells. 5 Cells were seeded into 96-well plates and cultured for 24 hours. After cell attachment, the appropriate concentration of drug was added, and the plates were placed in a cell culture incubator for 24 hours. The old culture medium was removed, and fresh culture medium containing CCK-8 was added. After incubation for 2 hours, the absorbance was measured at 450 nm, and cell viability was calculated. The effect of different drug concentrations on the activity of SY5Y cells was determined, and an appropriate drug concentration was selected.

[0085] The results are as follows Figure 16 As shown, each drug was administered at concentrations of 5 μM, 10 μM, 25 μM, 50 μM, and 100 μM, with different concentrations producing toxicity to SY5Y cells. The concentrations of HY-Q42044 (5–50 μM), HY-Q42678 (5–50 μM), HY-Q42034 (5–25 μM), HY-Q31735 (5–50 μM), and HY-Q02007 (5–10 μM) showed no significant toxicity to SY5Y cells.

[0086] Example 8: Inhibitory effects of different drugs on SLC11A2

[0087] 1. Cell treatment

[0088] After digesting and centrifuging SY5Y cells in the logarithmic growth phase, add complete culture medium and mix well. Count the cells and then divide into groups of 10 cells per well. 6 Cells were seeded into 6-well plates and set up as a blank control group (CON), a model group (MOD), and drug treatment groups of HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007.

[0089] After culturing for 24 hours and allowing the cells to adhere, 2 mL of complete culture medium without antibiotics (i.e., DMEM / F12 medium containing 15 v / v% FBS) was added to each well of the control group; 2 mL of 20 μM Aβ from Example 2 was added to each well of the model group. 1-42 The HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 drug treatment groups were treated with the corresponding drugs. Cells from each group were then placed in a cell culture incubator and cultured for another 24 hours.

[0090] 3. RNA extraction and reverse transcription

[0091] After culturing, remove the old culture medium, add 500 μL of Trizol to each well, repeatedly pipet and let stand at room temperature for 5 min, add 300 μL of chloroform substitute to each well, shake for 15 s, let stand at room temperature for 5 min, centrifuge at 12000 rpm for 15 min at 4 °C, collect the upper aqueous phase, add 0.5 volume of isopropanol, vortex for 15 s, let stand at room temperature for 10 min, centrifuge at 12000 rpm for 15 min at 4 °C, discard the supernatant, wash the RNA precipitate with 1 mL of 75% ethanol, add 75% ethanol, centrifuge at 7500 rpm for 5 min at 4 °C, repeat the washing three times, evaporate to dryness at room temperature for 30 min, add 20 μL of enzyme-free water to dissolve the RNA, and detect the RNA concentration using a spectrophotometer.

[0092] The extracted RNA was reverse transcribed using a reverse transcription reagent (Aikerui Biotechnology) at a concentration of 300 ng. The resulting cDNA was stored at -20℃.

[0093] 3. qPCR detection of SLC11A2 mRNA expression level

[0094] The cDNA obtained in the previous step was diluted at a ratio of cDNA:enzyme-free water = 1:2, mixed well, and used as a template for qPCR detection. qPCR primers as shown in SEQ ID Nos. 4-7 were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The qPCR reaction system was as follows: 2×SYBR Green Rro Taq HS Premix, 5 μL; primer F (10 μM), 0.2 μL; primer R (10 μM), 0.2 μL; template, 1 μL; enzyme-free water, 3.6 μL. The qPCR reaction program was as follows: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, 40 cycles.

[0095] like Figure 10 As shown, compared with the CON group, the SLC11A2 mRNA expression level in the MOD group was significantly increased (P < 0.001); compared with the MOD group, the SLC11A2 mRNA expression level in the HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 groups was significantly decreased (P < 0.001). This demonstrates that HY-Q42044, HY-Q42678, HY-Q42034, HY-Q31735, and HY-Q02007 can inhibit SLC11A2 mRNA expression and are inhibitors targeting SLC11A2.

[0096] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. The use of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the preparation of drugs for treating nervous system diseases, wherein the nervous system disease is Alzheimer's disease, and the structure of the compound N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide is as follows: .

2. The application according to claim 1, characterized in that: The concentration of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the drug is 5–50 μM.

3. The application according to claim 2, characterized in that: The concentration of N-(4-(N-phenylethylaminosulfonyl)phenyl)-2,2-diphenylacetamide in the drug is 10~20 μM.

Citation Information

Patent Citations

  • Application of small molecule compound in preparation of products for treating nervous system diseases

    CN120324449A

  • Novel n-sulphanilamide derivative of pyrimidin-4(1H)-one, having cerebroprotective activity for treating chronic traumatic encephalopathy

    RU2711613C1