The application of the reagent for detecting LSH in the preparation of a preparation for diagnosing chronic obstructive pulmonary disease and the application of the reagent for overexpressing LSH in the preparation of a drug for treating chronic obstructive pulmonary disease

Abstract

The application discloses application of a reagent for detecting LSH in preparation of a preparation for diagnosing chronic obstructive pulmonary disease and application of a reagent for overexpressing LSH in preparation of a medicine for treating chronic obstructive pulmonary disease. The application finds that the protein expression of LSH in a smoking chronic obstructive pulmonary disease patient is lower than that in a healthy person and a simple smoker for the first time through Western blotting and RT-qPCR detection. Therefore, the application provides a possibility for LSH as a detection marker for chronic obstructive pulmonary disease. The application improves the obstructive ventilation dysfunction of a model mouse and the function disorder of large and small airways, reduces the degree of pulmonary emphysema, reduces the airway inflammation level and inhibits small airway remodeling through LSH overexpression adeno-associated virus, and further analysis of inflammatory cells in the lung finds that the overexpression can reduce the proportion of pulmonary interstitial macrophages. The application provides a promising new way for the treatment of chronic obstructive pulmonary disease.

Description

Technical Field

[0001] This invention belongs to the field of gene diagnosis and treatment technology for COPD, specifically involving the application of reagents for detecting LSH in the preparation of COPD diagnostic agents and the application of reagents for overexpressing LSH in the preparation of drugs for treating COPD. Background Technology

[0002] Current treatments for COPD are not ideal. Existing drug therapies primarily target symptoms with limited effectiveness, and due to the lack of a cure, no drug can currently reverse the disease's progression. Therefore, exploring the pathogenesis and therapeutic targets of COPD is urgently needed. COPD can be understood as the final result of the accumulation of gene-environment interactions encountered by an individual throughout their life. Smoking-induced epigenetic events cause potentially reversible changes in the genome, interfering with gene expression. Analyzing the reversible genetic modifications related to gene-environment interactions based on epigenetic regulation can help elucidate the trajectory of lung function in the disease, aiming to achieve scientific prevention and control of COPD.

[0003] Currently, some COPD diagnostic markers have been published. For example, patent application CN116445607A discloses a COPD screening marker KRT15 and a kit. KRT15 is an acidic keratin that was first discovered in hair follicle stem cells. Studies have found that it is related to the stemness of cells, can mark pluripotent stem cells, and participate in the repair and regeneration of various tissue epithelial injuries, such as esophageal epithelium, gastric epithelium, and ureteral epithelium.

[0004] Lymphocyte-specific DNA helicase LSH is an SNF2-like chromatin remodeling ATPase. Its gene is located in the 10q23-24 region on human chromosomes (sequence shown in NM_001289067.2:135-2789) and in the 19C3-D1 region on mouse chromosomes (sequence shown in NM_008234.3:104-2569). This gene encodes an 838-amino acid helicase belonging to the SNF2 protein family. It plays multiple roles in epigenetic regulation, including nucleosome remodeling, histone modification, and de novo DNA methylation or maintenance of DNA methylation. Initially thought to be a lymphocyte-specific helicase involved in regulating the expansion and survival of lymphocyte lineages, subsequent studies have shown that it is universally expressed in cells and tissues. Currently, no direct association between LSH and COPD has been found. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide the application of reagents for detecting LSH in the preparation of diagnostic agents for COPD and the application of reagents for overexpressing LSH in the preparation of drugs for treating COPD. This invention provides a new approach for the diagnosis and treatment of COPD and has excellent application prospects.

[0006] In order to achieve the above-mentioned invention objectives.

[0007] This invention provides the application of reagents that overexpress LSH in the preparation of drugs for treating COPD.

[0008] The reagent for overexpressing LSH includes: AAV-LSH adeno-associated virus capable of overexpressing LSH.

[0009] This invention provides a therapeutic agent for COPD, comprising a reagent that overexpresses LSH.

[0010] The reagent for overexpressing LSH includes: AAV-LSH adeno-associated virus capable of overexpressing LSH.

[0011] This invention provides the application of reagents for detecting LSH in the preparation of diagnostic agents for COPD.

[0012] The reagents for detecting LSH include: Western blot detection reagents or PCR detection reagents, wherein the primer sequences are as follows:

[0013] F:GATTTTGGATCGAATGCTGCCAG;

[0014] R:ATGGACCCATCAAGCCTGCTGA.

[0015] This invention provides a diagnostic preparation for COPD, including a reagent for detecting LSH.

[0016] The reagents for detecting LSH include: Western blot detection reagents or PCR detection reagents, wherein the primer sequences are as follows:

[0017] F:GATTTTGGATCGAATGCTGCCAG;

[0018] R:ATGGACCCATCAAGCCTGCTGA.

[0019] This invention is the first to discover, through Western blotting and RT-qPCR, that LSH protein expression is decreased in COPD patients who smoke compared to healthy individuals and smokers only. Consistent with human lung tissue, both the protein expression level and mRNA of LSH were significantly lower in COPD model mice exposed to tobacco smoke (CS) compared to the control group, with statistically significant differences. Therefore, this provides a possibility for LSH as a marker for COPD detection.

[0020] This invention improves obstructive ventilatory dysfunction and large and small airway dysfunction, reduces emphysema, lowers airway inflammation levels, and inhibits small airway remodeling in a mouse model by overexpressing adeno-associated virus (LAS) with LSH. Further analysis of inflammatory cells in the lungs revealed that LSH overexpression reduces the proportion of interstitial macrophages. This provides a promising new approach for the treatment of COPD. Attached Figure Description

[0021] Figure 1 : Protein and mRNA expression levels of LSH in human lung tissue;

[0022] in Figure 1 A shows the expression level of LSH protein in human lung tissue as detected by Western blot and the corresponding bar chart; Figure 1 B is a bar chart showing the expression level of LSH mRNA in human lung tissue; NS: lung tissue of non-smokers and non-COPD patients; HS: lung tissue of smokers and non-COPD patients; COPD: lung tissue of smokers and COPD patients. .

[0023] Figure 2 : Expression level of LSH in mouse lung tissue;

[0024] in Figure 2 A represents the LSH protein expression level in mouse lung tissue and the corresponding bar chart; Figure 2 B is a bar chart showing the expression level of mRNA in mouse lung tissue; Air: lung tissue of control mice (n=6); CS: lung tissue of smoked mice (n=6). , .

[0025] Figure 3 Flowchart of LSH overexpression intervention in CS exposure-induced COPD mice and the effect of virus overexpression;

[0026] in Figure 3 A is a diagram of the CS mouse overexpression intervention model; Figure 3 B represents the detection of LSH mRNA levels by RT-qPCR. Figure 3 C represents the LSH protein level detected by Western blotting. Figure 3 D represents the expression level of Flag as detected by immunofluorescence. , .

[0027] Figure 4 Analysis of ventilation function in mice;

[0028] in Figure 4 A represents the forced vital capacity (FVC) of CS mice treated with LSH overexpression virus. Figure 4 B represents the ratio of FEV to FVC in CS mice 50ms after LSH overexpression virus intervention; Figure 4 C represents the ratio of FEV to FVC in CS mice 100ms after LSH overexpression virus intervention; Figure 4 D represents the ratio of FEV to FVC in CS mice 200ms after LSH overexpression virus intervention; , , , .

[0029] Figure 5 Analysis of expiratory flow rate in mice;

[0030] , .

[0031] Figure 6 Effects of tracheal titration of AAV-LSH adeno-associated virus on pulmonary emphysema and airway inflammation in COPD mice;

[0032] in Figure 6 A is an HE staining assay used to observe the effect of LSH overexpression on CS mice; Figure 6 B represents the result of assessing the degree of emphysema using the mean alveolar lining index (MLI). Figure 6 C represents the alveolar destruction index (DI) as an assessment of the degree of emphysema; Figure 6 D represents the quantitative analysis of airway wall thickness;

[0033] , , , .

[0034] Figure 7 PAS staining was used to observe the effects of LSH overexpression on different COPD mouse models.

[0035] Figure 8 Masson staining was used to observe the effects of LSH overexpression on different COPD mouse models. Detailed Implementation

[0036] The present invention will be further illustrated below with reference to embodiments, but not in a way that limits the invention.

[0037] Example 1: Expression levels of LSH molecules in lung tissues of COPD patients and mice:

[0038] NS: Lung tissue from non-smokers without COPD; HS: Lung tissue from smokers without COPD; COPD: Lung tissue from smokers with COPD. Human lung tissue samples were collected from patients undergoing lung surgery for benign lesions such as pulmonary nodules at the Department of Thoracic Surgery, Xiangya Second Hospital, Central South University, between 2022 and 2024. Lung tissue samples were required to be fresh post-operatively and at least 5 cm from the primary lesion. Immediately after obtaining the lung tissue, it was placed on ice and aliquoted using sterile instruments. A portion was preserved in fixative (4% paraformaldehyde) for tissue embedding in paraffin blocks, while the remaining portion was aliquoted into appropriate sizes, placed in cryovials, and stored long-term in liquid nitrogen. Inclusion criteria for COPD patients followed the Global Chronic Obstructive Lung Disease Initiative, including respiratory symptoms, risk factors, and persistent airflow limitation, specifically a forced expiratory volume in one second (FEV1) / forced vital capacity (FVC) ratio <0.7 after bronchodilator use. This study was approved by the Medical Ethics Committee of Xiangya Second Hospital, Central South University (No. 2022100), and informed consent was obtained from all participants. A total of 27 human lung tissue samples were collected, including 9 non-smokers without COPD, 9 smokers without COPD, and 9 smokers with COPD. Three lung tissue samples from each group were randomly selected for the WB protein detection illustration, and nine samples from each group were used to detect LSH mRNA levels in human lung tissue.

[0039] 1. Experimental Methods:

[0040] Western blot (WB) detection: After protein extraction, a separating gel of appropriate concentration (usually 10% separating gel) is prepared according to the molecular weight of the target protein. The sample is added to the gel wells, and the process is carried out by electrophoresis-transfer-blocking-antibody incubation followed by color development. The expression level of the target protein is semi-quantitatively analyzed based on the brightness and position of the bands.

[0041] RT-qPCR: RNA is extracted from tissue blocks and reverse transcribed, followed by a reverse transcription reaction on a PCR instrument.

[0042] .

[0043] The human LSH sequence is shown in SEQ ID NO.2, and the mouse LSH sequence is shown in SEQ ID NO.3.

[0044] 2. Experimental Results:

[0045] Figure 1 The expression levels of LSH protein and mRNA in human lung tissue. Figure 2The results show the expression levels of LSH protein and mRNA in mouse lung tissue. The results indicate that LSH protein expression is lower in COPD patients who smoke compared to healthy individuals and smokers only. Consistent with human lung tissue, both the protein and mRNA expression levels of LSH in CS-exposed COPD model mice were significantly lower than in the control group, and the differences were statistically significant.

[0046] Example 2: Expression of AAV-LSH adeno-associated virus in lung tissue of a mouse model of COPD after tracheal titration intervention:

[0047] 1. Experimental Method:

[0048] AAV-LSH adeno-associated virus (the constructed vector sequence is shown in SEQ ID NO.1) was constructed and validated by Jikai Gene Company.

[0049] Establishment of COPD mouse model: 6-8 week old C57BL / 6 mice were acclimatized and then placed in a full-body smoke exposure chamber twice daily for 50 minutes at fixed time intervals to induce COPD, mimicking natural human smoking habits. The average particulate matter concentration in the mice's environment was ensured to be no less than 500 mg / m³. 3 Total particulate matter (TPM) was continuously fumigated for 24 weeks, 5 days a week. The main factors requiring continuous monitoring during fumigation were: 1) ensuring the carbon dioxide (CO2) concentration in the exposure chamber did not exceed 0.5%; 2) ensuring the oxygen (O2) concentration was not less than 20%; and 3) ensuring the carbon monoxide (CO) concentration in the exposure chamber was 288 ± 74 ppm. Successful model establishment was often validated through pulmonary function and lung tissue pathology, including the obstructive ventilatory dysfunction, emphysema, and airway remodeling abnormalities commonly observed in COPD model mice.

[0050] Fourteen weeks after the smoke-induced modeling process, control virus (empty vector virus) and low-dose overexpressing virus (10) were administered to the patients, respectively. 11 vgAAV-LSH) and high-dose overexpression of the virus (5x10) 11 vg AAV-LSH) was delivered to mice via tracheal titration, followed by 10 weeks of fumigation. After the last fumigation, mice were subjected to relevant functional experiments and specimen collection at 48-hour intervals.

[0051] The efficiency of AAV-LSH overexpression was verified by a combination of RT-qPCR, Western blotting, and immunofluorescence assays.

[0052] 2. Experimental Results:

[0053] Figure 3A is a schematic diagram of the entire experimental process for constructing smoked mice and then titrating them via tracheal intubation to overexpress adeno-associated virus. Figure 3 B represents the RT-qPCR experiment used to verify the efficiency of AAV-LSH overexpression. Figure 3 C represents the Western blotting experiment used to verify the efficiency of AAV-LSH overexpression. Figure 3 D is an immunofluorescence assay to verify whether AAV-LSH adeno-associated virus can successfully infect lung tissue. Figure 3 Results B showed that LSH RNA levels decreased in CS-exposed mice, while AAV-LSH overexpression effectively increased LSH RNA levels in mouse lung tissue. Figure 3 Results C showed that LSH protein levels decreased in CS-exposed mice, while AAV-LSH overexpression effectively improved LSH protein levels in mouse lung tissue. Immunofluorescence targeting the viral flag tag also demonstrated successful lung tissue infection using this method. These results indicate that intratracheal titration of AAV-LSH adeno-associated virus can effectively reverse the low LSH expression in the lungs of model mice.

[0054] Example 3: Effects of tracheal titration of AAV-LSH adeno-associated virus on lung function in COPD mice:

[0055] 1. Experimental Method:

[0056] Mouse lung function testing: Mice were anesthetized intraperitoneally with tribromoethanol, then placed in a supine position and fixed on a dissection table. A tracheotomy was performed in the midline of the neck to expose the trachea, and an endotracheal tube was inserted to a depth of approximately 0.5-1 cm. The endotracheal tube interface was connected to a plethysmography device. On the real-time sampling page, TB mode was selected for sampling. The experiment was started, and once the waveform showed no abnormalities, the experiment record was clicked. Recording was stopped after 30 seconds. Then, the sampling was switched to FEV mode, and the experiment start was also initiated. Each FEV mode test consisted of 8 forced exhalations. After the set number of respiratory counts was completed, the sampling was canceled, the experiment was closed, and the TB mode was switched back for continuous ventilation. (The instrument used was the Invasive Animal Lung Function Testing and Analysis System of Shanghai Tawang Intelligent Technology Co., Ltd., product model: PFT).

[0057] 2. Experimental Results:

[0058] Figure 4 A represents forced vital capacity (FVC). Figure 4 BD represents mice with FEV1 and FEV2 respectively. 50 / FVC、FEV 100 / FVC and FEV 200 / FVC is the ratio of forced expiratory volume (FEV) to FVC at time points of 50ms, 100ms, and 200ms. Figure 5 Maximum mid-expiratory flow (MMEF). FVC is a key indicator for assessing restrictive ventilatory dysfunction in humans, while the 1-second rate (FEV1 / FVC) is an important parameter for assessing obstructive ventilatory dysfunction in humans. Based on the difference in lung volume between mice and humans, the FEV1 / FVC ratio is often observed at 50 milliseconds, 100 milliseconds, or 200 milliseconds to indicate whether experimental mice have obstructive ventilatory dysfunction. COPD is a disease primarily characterized by obstructive ventilatory dysfunction. Figure 4 AD results showed that LSH overexpression in lung tissue did not effectively improve FVC in this study. However, different concentrations of overexpressed virus could improve the forced expiratory volume (FEV) / FVC ratio in mice at 50ms, 100ms, and 200ms, indicating that LSH overexpression is highly effective in improving COPD. Furthermore, small airway dysfunction is also a characteristic change in COPD. Figure 5 The maximum mid-expiratory flow rate was measured, which is the most sensitive indicator for detecting small airway lesions. The results showed that overexpression of LSH could significantly improve small airway dysfunction in smoked mice.

[0059] Example 4: Effects of tracheal titration of AAV-LSH adeno-associated virus on pulmonary emphysema and airway inflammation in COPD mice:

[0060] 1. Experimental Method:

[0061] HE staining: After dewaxing and hydrating paraffin sections of mouse lung tissue, stain them in hematoxylin solution for 5-10 minutes until the cell nuclei turn blue. After staining, rinse the sections in tap water for several minutes to remove excess hematoxylin stain, then proceed with differentiation and blue reversion. Finally, rinse the sections in distilled water. Hematoxylin-stained sections are then stained in eosin solution for 3-5 minutes until the cytoplasm turns red. After staining, rinse the sections in distilled water for a few seconds to remove excess eosin stain. The eosin-stained sections are then dehydrated, cleared, and mounted. After the resin dries, the sections are ready for microscopic observation. Under the microscope, the cell nuclei appear blue and the cytoplasm appears red. By observing cell morphology and tissue structure, pathological changes in the tissue can be analyzed. The Mean Lining Index (MLI) and Destruction Index (DI) are used to assess the degree of emphysema, and airway wall thickness is assessed to determine the degree of airway inflammation.

[0062] PAS staining: Following the same procedure as HE staining, dewax paraffin sections sequentially with xylene, then hydrate them with a gradient of alcohols to distilled water. Immerse the hydrated sections in a 0.5%-1% periodic acid solution for 5-10 min to oxidize the ethylene glycol groups of polysaccharides in the tissue to dialdehyde groups. After oxidation, rinse the sections 2-3 times in distilled water for 3-5 min each time to remove the periodic acid. Stain the oxidized sections in Schiff's reagent for 15-30 min. The colorless fuchsin in Schiff's reagent combines with the aldehyde groups produced by polysaccharide oxidation to form a purplish-red compound, giving the polysaccharides a purplish-red color. After staining, immerse the sections directly in a sulfurous acid solution 3 times for 1-2 min each time to remove unbound Schiff's reagent. Stain the Schiff-stained sections in hematoxylin staining solution for 3-5 min to stain the cell nuclei, then differentiate them using hydrochloric acid-alcohol as in HE staining, followed by rinsing with tap water to restore blue color. Following the same HE staining procedure, the sections were sequentially dehydrated with graded alcohols, cleared with xylene, and finally mounted with neutral resin. Under a microscope, polysaccharides appeared purplish-red, and cell nuclei appeared blue. The number of purplish-red stained cells was used to determine the number of goblet cells in the airway epithelium, reflecting the degree of airway inflammation.

[0063] 2. Experimental Results:

[0064] Figure 6 A shows the HE staining results of mouse lung tissue. Figure 6 BC is a quantitative analysis of emphysema. Figure 6 D represents the quantitative analysis of airway wall thickness, calculated as epithelial cell area divided by the diameter of the epithelial basement membrane. Results showed that smoke inhalation induced severe emphysema, and LSH overexpression of the virus improved emphysema in mice even at lower viral titers. Furthermore, airway wall thickness was significantly increased in CS mice compared to the control group, and LSH overexpression significantly improved this airway wall thickening. Figure 7 The changes in the number of goblet cells in the peripheral airway epithelium of mouse lung tissue were observed by PAS staining. The results showed that the number of PAS-positive cells in the small airway epithelium of CS mice was significantly increased. In CS mice that were overexpressed with different concentrations of LSH virus at the same time, these PAS-positive cells were almost invisible. This suggests that LSH overexpression helps to improve the abnormal pathological features of goblet metaplasia in the small airway epithelium of CS mice.

[0065] Example 5: Effect of tracheal titration of AAV-LSH adeno-associated virus on small airway remodeling in COPD mice:

[0066] 1. Experimental Method:

[0067] Masson staining: Paraffin sections of mouse lung tissue were gradually hydrated from xylene to distilled water. The sections were then immersed in hematoxylin staining solution for 5-10 minutes until the cell nuclei turned blue. They were then rinsed with tap water for several minutes to remove excess hematoxylin, followed by differentiation with 1% hydrochloric acid alcohol for a few seconds, and then rinsed with tap water to restore the blue color. The restored blue sections were then stained with Ponceau S and Acid Fuchsin.

[0068] 2. Experimental Results:

[0069] Figure 8 Masson staining was used to examine the degree of peri-airway collagen deposition. Increased peri-airway collagen deposition was observed in CS mice compared to the control group, but significantly reduced peri-airway collagen deposition was observed in treatment groups with different concentrations of LSH-overexpressing virus. These results suggest that LSH overexpression may help improve the abnormal pathological changes in small airway remodeling in smoked mice.

Claims

1. Use of an agent that overexpresses LSH for the preparation of a medicament for the treatment of chronic obstructive pulmonary disease, characterized in that, The reagent for overexpressing LSH is an AAV-LSH adeno-associated virus capable of overexpressing LSH.

2. Use of the reagent for detecting LSH in the preparation of a preparation for diagnosing chronic obstructive pulmonary disease.

3. Use according to claim 2, characterized in that, The reagent for detecting LSH comprises a Western blot detection reagent or a qPCR detection reagent, and the primer sequence of the qPCR detection reagent is as follows: F: GATTTTGGATCGAATGCTGCCAG; R: ATGGACCCATCAAGCCTGCTGA.

Images