Compositions for improving nrf2 activation and methods of use thereof
By combining phytochemical ingredients such as rosemary, ginger, and luteolin to synergistically activate the Nrf2 pathway, the problem of limited activation effect of a single agent in existing technologies is solved, and significant Nrf2 activation and gene expression are achieved, alleviating inflammation and oxidative stress, improving health and preventing aging.
Patent Information
- Application Number
- CN202510745791.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2016-06-28
- Filing Date
- 2016-09-02
- Publication Date
- 2025-10-10
AI Technical Summary
Existing technologies have not been able to effectively activate the Nrf2 cell signaling pathway, and it is difficult to achieve synergistic activation through a single agent. In addition, the therapeutic effects of direct antioxidant vitamins or supplements are limited and cannot effectively relieve inflammation and oxidative stress.
By combining phytochemicals such as rosemary, ginger, luteolin and silymarin, the Nrf2 pathway is synergistically activated, acting on different control points to increase the expression of Nrf2-dependent genes, including Keap1 oxidation, Nrf2 phosphorylation, Fyn phosphorylation and SESN2/SQSTM1/ULK1 autophagy, forming a synergistic effect.
Significant Nrf2 activation and gene expression were achieved, reducing inflammation and oxidative stress, improving overall health and well-being, and preventing aging issues related to proteostasis, showing a stronger effect than single agents.
Smart Images

Figure BDA0005435945640000111 
Figure BDA0005435945640000131 
Figure BDA0005435945640000141
Abstract
Description
[0001] This application is a divisional application of the application with international application number PCT / US2016 / 050292, Chinese application number 201680050947.0, application date September 2, 2016, and invention name “Compositions for improving NRF2 activation and methods of use thereof”.
[0002] Related applications
[0003] This application claims priority to U.S. patent application 62 / 214,175 filed September 3, 2015 and U.S. patent application 62 / 355,810 filed June 28, 2016, the entire contents of which are hereby incorporated by reference into this application. Background Art
[0004] I. Technical Field
[0005] The present disclosure relates to methods and compositions for preventing or treating certain health conditions. More specifically, the present disclosure relates to compositions and methods for preventing or treating certain health conditions associated with inflammation and / or oxidative stress.
[0006] II. Description of the Prior Art
[0007] Nuclear factor-erythroid 2-related factor 2 (Nrf2) is a transcription factor regulated by Kelch-like ECH-associated protein 1 (Keap1). Nrf2 regulates the gene expression of phase II detoxification enzymes and antioxidant enzymes of various cell protections through a reinforcing subsequence known as the antioxidant response element (ARE) (Maher and Yamamoto 2010, Satoh, Moriguchi et al. 2010). Related to oxidative stress, ARE is a promoter element found in many antioxidant enzymes including superoxide dismutase (SOD), peroxide reductase, thioredoxin, catalase, glutathione peroxidase and heme oxygenase-1 (HO-1). Nrf2 plays a key role in the ARE-driven cellular defense system against oxidative stress. See, Kensler, Wakabayashi et al. 2010; Hybertson and Gao 2014, Bocci and Valacchi 2015, Huang, Li et al. 2015, Johnson and Johnson 2015, Moon and Giaccia 2015, Petiwala and Johnson 2015, Sekhar and Freeman 2015, Suzuki and Yamamoto 2015. Summary of the Invention
[0008] The disclosed means advances the art by providing combinations of agents that activate the Nrf2 cellular signaling pathway. In one embodiment, the combination of agents can activate the Nrf2 pathway more effectively than a single agent. In another embodiment, the combination of agents can synergistically activate the Nrf2 pathway.
[0009] In one embodiment, combinations of more than one ingredient are disclosed herein. In one aspect, each ingredient can contain one or more phytochemicals. In another aspect, the phytochemicals can be found in rosemary (Rosmarinus officinalis), ginger (Zingiber officinale), genistein (from Sophora japonica), milk thistle (Silybum marianum), and Bacopa (Bacopa monnieri). In another aspect, the phytochemical components are carnosic acid, gingerol, genistein, silymarin, and bacopa saponins, which can be found in rosemary, ginger, genistein, milk thistle, and Bacopa, respectively. In another aspect, the disclosed compositions induce ARE-regulated antioxidant genes through an Nrf2-dependent pathway.
[0010] In another embodiment, specific combinations of rosemary, Withania, and genistein (referred to herein as PB125), rosemary, ginger, genistein, and silymarin (referred to herein as PB127), and rosemary, ginger, genistein, silymarin, and Bacopa (referred to herein as PB129) are disclosed. In another embodiment, the combination of agents can result in synergistic Nrf2 activation, greater than the sum of their individual Nrf2 activation contributions. The active agents or combinations of agents can be candidates for possible drug development. See, e.g., Koehn and Carter 2005, Lee 2010.
[0011] In another embodiment, the disclosed compositions can contain rosemary (carnosic acid), ginger (6-gingerol and 6-shogaol), Withania (withaferin A), milk thistle (silymarin), Bacopa (bacopa saponins), and genistein.
[0012] In one aspect, the compositions can be administered orally, for example, in the form of tablets, capsules, soft gels, syrups, aqueous solutions or suspensions, alcoholic extracts, or powders. In another aspect, the synergistic compositions can be administered in the form of an aerosol, for example, in the form of a fine aerosol mist or powder that is inhaled and partially deposited in the respiratory tract of the lungs. In another aspect, the disclosed compositions can be administered by topical administration, for example, to the skin by administration in the form of a lotion, gel, ointment, aqueous spray, or to the skin or wounds in a bandage.
[0013] In another embodiment, the disclosed composition can contain a combination of rosemary extract (specified at 5 to 10% carnosic acid), ginger extract (specified at 1-10% 6- gingerol and / or 10-25% 6-shogaol), and luteolin (specified at 95-98% luteolin) in a mass ratio of 10:5:1, respectively. This formula is also referred to as PB123 in the present disclosure.
[0014] In another embodiment, the disclosed composition can contain a combination of rosemary extract (specified at 5 to 10% carnosic acid), Kalmegh extract (specified at 1-3% pycnolannin A), and luteolin (specified at 95-98% luteolin) in a mass ratio of 30:10:4, respectively. This formula is also referred to as PB125 in the present disclosure.
[0015] In another embodiment, the disclosed composition can contain a combination of rosemary extract (specified at 5 to 10% carnosic acid), ginger extract (specified at 1-10% 6- gingerol and / or 10-25% 6-shogaol), luteolin (specified at 90-100% luteolin), and silybum extract (specified at 50-90% silymarin) in a mass ratio of 10:5:1:30, respectively. This formula is also referred to as PB127 in the present disclosure.
[0016] In another embodiment, the disclosed composition can contain a combination of rosemary extract (specified at 5 to 10% carnosic acid), ginger extract (specified at 1-10% 6- gingerol and / or 10-25% 6-shogaol), luteolin (specified at 90-100% luteolin), silybum extract (specified at 50-90% silymarin), and bacopa extract (specified at 10-60% bacopaside) in a mass ratio of 10:5:1:30:48, respectively. This formula is also referred to as PB129 in the present disclosure.
[0017] In another embodiment, the disclosed composition can contain a combination of rosemary extract (specified at 5 to 10% carnosic acid), ginger extract (specified at 1-10% 6- gingerol and / or 10-25% 6-shogaol), luteolin (specified at 90-100% luteolin), and bacopa extract (specified at 10-60% bacopaside) in a mass ratio of 10:5:1:48, respectively. This formula is also referred to as PB131 in the present disclosure.
[0018] In another embodiment, PB123 can be administered at 10 to 1000 mg per day when administered orally to humans. For example, it can be administered as a pill, softgel, or capsule to induce Nrf2 activation and / or reduce inflammation and oxidative stress, and / or to improve overall health and well-being.
[0019] In another embodiment, PB123 can be administered at 10 to 1000 mg / day when orally administered to humans to improve proteostasis, and / or prevent aging-related problems associated with proteostasis and / or autophagy in humans.
[0020] In another embodiment, PB125 or PB127 or PB129 or PB131 can be administered orally to humans at 10 to 1000 mg / day. For example, it can be administered as a pill, soft gel, or capsule to induce Nrf2 activation and / or reduce inflammation and oxidative stress, and / or to improve overall health and well-being.
[0021] In another embodiment, PB125 or PB127 or PB129 or PB131 can be administered at 10 to 1000 mg / day when orally administered to humans to improve protein homeostasis and / or prevent aging-related problems associated with protein homeostasis and / or autophagy in humans. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Nrf2 activation pathway and control points are shown.
[0023] Figure 2 The "shutdown pathway" - Fyn-dependent inactivation of nuclear Nrf2 - is shown.
[0024] Figure 3 A "positive feedback loop" is shown - Keap1 degradation through Nrf2-induced gene products.
[0025] Figure 4 Shown is Nrf2 activation induced by PB123, PB125, PB127, PB129, and PB131 in transfected breast cancer cell lines.
[0026] Figure 5 Shown is Nrf2 activation induced by PB123, PB125, PB127, PB129, and PB131 in transfected hepatoma cell lines.
[0027] Figures 6A-6C Shown in HepG2 (human liver, Figure 6A ), MCF7 (human breast, Figure 6B ) and A172 (human brain, Figure 6C ) Synergistic effect of Nrf2 activation induced by PB129 in cancer cell lines.
[0028] Figures 7A-7C Shown in HepG2 (human liver, Figure 7A ), MCF7 (human breast, Figure 7B ) and A172 (human brain, Figure 7C ) Synergistic effect of Nrf2 activation induced by PB127 in cancer cell lines.
[0029] Figure 8 Shown is the increase in HMOX1 gene expression in mouse liver in vivo.
[0030] Figure 9 Shown are hepatic catalytic enzyme activities induced by PB125 in the presence of a meal.
[0031] Figure 10 Shown is an overlay of relative light units (RLU) observed with added luciferin in stably transfected HepG2 (human liver), AREc32 (human breast), MCF7 (human breast), A549 (human lung), 293T (human kidney), and A172 (human brain) cancer cell lines following induction of ARE-driven luciferase gene expression by treatment with PB125. Strong Nrf2 activation was observed in liver, kidney, and breast cell lines with 5, 10, 15, 20, and 25 micrograms of PB125 per mL of culture medium.
[0032] Figure 11 PB125 was shown to reduce LPS-induced expression of inflammatory genes.
[0033] Figure 12 PB125 was shown to reduce LPS-induced expression of IL-6.
[0034] Figure 13 Shown is higher GCLM gene expression due to administration of PB125. DETAILED DESCRIPTION
[0035] The Nrf2 / ARE pathway has been implicated in the control of oxidative stress (Eggler, Gay et al. 2008, Cho and Kleeberger 2010, Huang, Li et al. 2015, Johnson and Johnson 2015). Certain agents and combinations of such agents (e.g., PB125) that target the Nrf2 / ARE pathway may have beneficial effects on cell function and survival. In one embodiment, these agents and combinations thereof may alleviate inflammatory responses and oxidative stress and may have beneficial effects on health and well-being.
[0036] Previous studies have not demonstrated the therapeutic potential of direct antioxidants or supplements (such as vitamins C and E, carotenoids, N-acetyl cysteine) and other compounds that stoichiometrically react with reactive oxygen species (ROS) such as superoxide and hydrogen peroxide. Here, improved antioxidant defense is demonstrated by using Nrf2-activating combinations (Koehn 2006, Eggler, Gay et al. 2008, Boutten, Goven et al. 2010, Cho and Kleeberger 2010).
[0037] In the present disclosure, multiple agents are combined in a novel way, i.e. by acting at different control points in the Nrf2 activation pathway. Figure 1 The Nrf2 activation pathway and control points A, B, C, D and E are shown, at which low concentrations of agents acting at those control points together act to influence desired Nrf2-dependent gene expression by combinations such as PB125, PB127 and PB129. In the basal state, Nrf2 is sequestered and kept inactive by Kelch-like ECH-associated protein 1 (Keap1) that targets Nrf2 for polyubiquitination and degradation by the proteasome. A. Nrf2 activation involves oxidation of specific thiol residues of Keap1, which releases Nrf2 from Keap1. B. Nrf2 phosphorylation can act in targeting it for nuclear import. C. Nrf2 translocation into the nucleus enables Nrf2 to bind to promoters containing antioxidant response elements (AREs), triggering programmed transcription of cytoprotection. D. Inactive cytosolic Fyn can be phosphorylated by GSK3B, and this now active p-Fyn translocates to the nucleus, where it can phosphorylate Nrf2 at a second site leading to nuclear export and degradation. E. A "positive feedback loop" involves the Nrf2-induced gene products SESN2, SQSTM1 and ULK1. SESN2, SQSTM1 and ULK1 cooperate to activate autophagy of Keap1, releasing more Nrf2, which induces more of these gene products, tending to maintain Nrf2 activation once this positive feedback loop has been triggered.
[0038] In addition in the present disclosure, the combination of agents produces unexpectedly high levels of Nrf2 activation compared to levels predicted based on prior art and also based on levels tested for Nrf2 activation properties of each agent alone and levels predicted based on adding them together. Nrf2 activation by combinations of agents shows a synergistic effect. See, e.g., Figures 6 and 7.
[0039] One embodiment of the present disclosure comprises a combination of therapeutic agents - such as in the PB125, PB127, and PB129 combination - that act on Nrf2 activation by engaging different specific control points such that the combination of agents synergistically activates the Nrf2 pathway. Thus, novel combinations of agents that act on different control points in the Nrf2 signaling pathway to increase the expression of Nrf2-dependent genes are novel.
[0040] As examples, several embodiments of the present disclosure are listed below:
[0041] Item 1. A composition comprising two or more phytochemical ingredients selected from the group consisting of carnosin, carnosic acid, shogaol, gingerol, luteolin and withaferin A, wherein the one or more phytochemical ingredients are present in the composition in an amount effective to activate the nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway.
[0042] Item 2. The composition of Item 1, wherein when administered to a mammal, the two or more phytochemicals exert their effects on at least two different control points of the Nrf2 activation pathway, the control points being selected from the group consisting of control points A, B, C, D, and E. In one embodiment, at least one of the phytochemicals exerts its effects on one control point while at least one other phytochemical exerts its effects on a different control point of the Nrf2 activation pathway, such as in Figure 1 Described in.
[0043] Item 3. The composition according to any one of the preceding items, wherein the two or more phytochemical ingredients have a synergistic effect on Nrf2 activation when administered to a mammal.
[0044] Item 4. The composition according to any one of the preceding items, wherein the composition comprises at least two ingredients selected from the group consisting of rosemary, ginger, luteolin and ashwagandha.
[0045] Item 5. The composition according to any one of the preceding items, wherein the composition further comprises one or more phytochemical ingredients selected from the group consisting of Silybum marianum and Bacopa monnieri.
[0046] Item 6. A composition according to any one of the preceding items, wherein the composition comprises rosemary extract, ginger extract, and luteolin, wherein the rosemary extract is specified at 5-10% carnosol, the ginger extract is specified at 10-20% 6-shogaol, and the luteolin is specified at 95-99% luteolin, wherein the ratio between the rosemary extract, ginger extract, and luteolin in the composition is approximately 10:5:1 (w / w).
[0047] Item 7. A composition according to any one of the preceding items, wherein the composition comprises rosemary extract, ashwagandha extract, and luteolin, wherein the rosemary extract is specified at 5-10% carnosol, the ashwagandha extract is specified at 1-3% withaferin A, and the luteolin is specified at 95-99% luteolin, wherein the ratio between the rosemary extract, ashwagandha extract, and luteolin in the composition is approximately 30:10:4 (w / w).
[0048] Item 8. The composition according to any one of the preceding items, wherein the composition comprises rosemary extract, ginger extract and luteolin, and wherein the ratio between the rosemary extract, ginger extract and luteolin is approximately 10:5:1 (w / w).
[0049] Item 9. The composition according to any one of the preceding items, wherein the composition comprises rosemary extract, ashwagandha extract and luteolin, and the ratio between the rosemary extract, ashwagandha extract and luteolin is approximately 30:10:4 (w / w).
[0050] Item 10. The composition according to any one of the preceding items, wherein the composition comprises rosemary extract, ginger extract, luteolin and milk thistle extract, and the ratio between the rosemary extract, ginger extract, luteolin and milk thistle extract is approximately 10:5:1:30 (w / w).
[0051] Item 11. A composition according to any one of the preceding items, wherein the composition comprises rosemary extract, ginger extract, luteolin, milk thistle extract and Bacopa monnieri extract, and the ratio between the rosemary extract, ginger extract, luteolin, milk thistle extract and Bacopa monnieri extract is approximately 10:5:1:30:48 (w / w).
[0052] Item 12. The composition according to any one of the preceding items, wherein the composition comprises rosemary extract, ginger extract, luteolin and Bacopa monnieri extract, and the ratio between the rosemary extract, ginger extract, luteolin and Bacopa monnieri extract is approximately 10:5:1:48 (w / w).
[0053] Item 13. The composition according to any one of the preceding items, wherein the composition is used to prevent and / or treat a disease or condition selected from the group consisting of oxidative stress, detoxification, inflammation, cancer, or related diseases or conditions.
[0054] Item 14. The composition according to any one of the preceding items, wherein the composition is used as a nutritional supplement.
[0055] Item 15. The composition according to any one of the preceding items, wherein the composition is in the form of a tablet, a capsule, a soft gel, a liquid, an emulsion, a gel, a powder, an ointment or an aerosol.
[0056] Item 16. A method for treating and / or preventing a disease or condition, comprising the following steps: administering a composition to a mammal, wherein the composition comprises one or more phytochemicals selected from the group consisting of carnosin, carnosic acid, shogaol, gingerol, luteolin and withaferin A, wherein the one or more phytochemicals are present in the composition in an amount effective to activate the Nrf2 (NF-E2-related factor 2) pathway.
[0057] Item 17. The method according to any one of the preceding items, wherein the composition comprises rosemary extract, ashwagandha extract, and luteolin, wherein the rosemary extract is specified at 5-10% carnosol, the ashwagandha extract is specified at 1-3% withaferin A, and the luteolin is specified at 95-99% luteolin, and the ratio between the rosemary extract, ashwagandha extract, and luteolin is approximately 30:10:4 (w / w).
[0058] Item 18. The method of Item 17, wherein the composition comprises rosemary extract, ginger extract, and luteolin, wherein the rosemary extract is specified at 5-10% carnosol, the ginger extract is specified at 10-20% 6-shogaol, and the luteolin is specified at 95-99% luteolin, and the ratio between the rosemary extract, ginger extract, and luteolin is approximately 10:5:1 (w / w).
[0059] Item 19. The method according to any one of Items 17-18, wherein the composition is orally administered to a human at 10-1000 mg / day.
[0060] Item 20. A method according to any one of Items 17-19, wherein the composition comprises at least two phytochemical ingredients selected from the group consisting of carnosin, carnosic acid, shogaol, gingerol, luteolin and withaferin A, wherein the at least two phytochemical ingredients exert their effects on at least two different control points of the Nrf2 activation pathway, and the control points are selected from the group consisting of control points A, B, C, D and E.
[0061] Those skilled in the art will readily appreciate that the compositions and methods described herein may be modified and suitable equivalents may be substituted without departing from the scope of the embodiments disclosed herein. Having now described certain embodiments in detail, the present invention will be more clearly understood with reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting.
[0062] Examples
[0063] Example 1 Effects on the Nrf2 pathway
[0064] Different agents, PB123, PB125, PB127, PB129, and PB131, each showed strong and potent Nrf2 activation, as demonstrated in vitro by using these combinations to treat cell lines that had been stably transfected with a promoter / reporter construct containing an inserted known Nrf2-binding antioxidant response element to drive production of a readily detectable luciferase gene such that Nrf2 activation resulted in luciferase production detected by luciferin-dependent chemiluminescence. Figure 4 and 5 As shown in , potent Nrf2 activation was induced by the combination of PB123, PB125, PB127, PB129 and PB131 in transfected cancer cell lines independent of tissue type (breast and liver cell data shown).
[0065] These control points include (but are not limited to) control point A: release of Nrf2 from binding and inhibition by Keap1; control point B: action on Nrf2 by enzymes such as kinases that phosphorylate and activate Nrf2; control point C: activation of other transcription factors that modify the gene expression profile; control point D: action on mechanisms such as Fyn that control Nrf2 export from the nucleus; and control point E: degradation of Keap1 and mTOR inhibition by SESN2 / SQSTM1 / ULK1. Figure 1. For example, the PB125 combination including rosemary (carnosol), ashwagandha (withaferin A), and luteolin acts at multiple control points in the Nrf2 activation pathway. In HepG2 cells stably transfected with an ARE-driven luciferase reporter gene, we inhibited Fyn (with 5 μg / ml salacatinib; AZD0530, which is a Src family kinase inhibitor (Kaufman, Salazar et al. 2015)) and showed that inhibition of Fyn increased Nrf2 activation caused by another dietary supplement Nrf2 activator (Protandim) by up to 9-fold. In contrast, Fyn inhibition did not additionally increase PB125-induced Nrf2 activation, determining that while other dietary Nrf2 activators (such as Protandim) allow the "shutdown pathway" to remain active, PB125 appears to block the pathway, permitting Nrf2 activation by smaller amounts of the PB125 dietary supplement combination.
[0066] By acting on more than one control point, the combination of reagents (such as PB123 or PB125) together with the related combination (such as PB127, PB129 or PB131) based on the core Nrf2 activator triplet in PB123 or PB125 produces improved Nrf2 activation and gene regulation response, and is carried out with a lower dose than predicted based on the known properties of the activating agent in the combination and based on the teachings of the prior art. The active ingredients in PB123, 125, PB127, PB129 and PB131 work together in a synergistic manner, thereby for the amount of combined component Nrf2 activation and Nrf2-dependent gene expression based on the sum of its single activity to Nrf2 higher (Figures 6 and 7) even in different cell types at the same concentration. One of the unexpected findings is that a relatively small amount of luteolin added to other ingredients produces an expected increase greater than Nrf2 activation and gene regulation.
[0067] The combination of rosemary (6.7% carnosol), ashwagandha (1% withaferin A), and luteolin (98% luteolin) in PB125 (at 30:10:4 rosemary:ashwagandha:luteolin) increased Nrf2-dependent gene expression in mice fed PB125 added to their chow for 35 days. Figure 8 and 9 .
[0068] The PB125 phytochemical composition was standardized with rosemary extract (specified at 6% carnosol), ashwagandha extract (specified at 1% withaferin A), and luteolin (specified at 98% purity), so that 100 ppm equated to 6.83×10-5 mg rosemary extract, 2.27×10-5 mg ashwagandha extract, and 9.43×10-6 mg luteolin per gram of diet. In the rat diet, PB125 activated the Nrf2 pathway (e.g., increased hmox1 gene expression in rat liver) and increased catalytic enzyme activity. Rats tolerated the PB125 dose well, as evidenced by no changes in weight stability, consistent food intake, and no significant GI distress or behavioral changes compared to the control diet. The 100 ppm PB125 diet produced a significant increase in liver hmox1 gene expression in rats (measured after 35 days of diet consumption) ( Figure 8 ).
[0069] The individual ingredients in PB125, PB127, and PB129 have a long history of human consumption and have demonstrated safety in human and animal studies (Saller, Meier et al. 2001, Roodenrys, Booth et al. 2002, Aggarwal, Takada et al. 2004, Boon and Wong 2004, Anadon, Martinez-Larranaga et al. 2008, Zick, Djuric et al. 2008, Johnson 2011, Chandrasekhar, Kapoor et al. 2012, Theoharides, Asadi et al. 2012, Taliou, Zintzaras et al. 2013, Zhang, Gan et al. 2013, Gonzalez-Vallinas, Reglero et al. 2015, Kumar, Srivastava et al. 2015, Nabavi, Braidy et al. 2015, Petiwala and Johnson 2015). Rosemary, ashwagandha, ginger, milk thistle, bacopa monnieri, and luteolin have been extensively studied in a variety of diseases and have a broad record of safe use (Mishra, Singh et al. 2000, Roodenrys, Booth et al. 2002, Aggarwal, Takada et al. 2004, Boon and Wong 2004). Rosemary (Rosemary / Rosmarinus officinalis) is a common seaweed herb widely consumed in foods as a spice and flavoring. Additionally, rosemary has a long history of use in traditional treatments for a variety of ailments [1], with emphasis on anti-inflammatory (Emami, Ali-Beig et al. 2013), antioxidant (Klancnik, Guzej et al. 2009, Raskovic, Milanovic et al. 2014, Ortuno, Serrano et al. 2015), and antimicrobial benefits (Del Campo, Amiot et al. 2000, Bozin, Mimica-Dukic et al. 2007). Ashwagandha (Withania somnifera, also known as Indian winter cherry or Indian ginseng) is a member of the Solanaceae family of flowering plants. It has been used for centuries in traditional South Asian treatments, with historical and current emphasis on immunomodulatory (Khan, Subramaneyaan et al. 2015), anti-tumor (Rai, Jogee et al. 2016), neurological (Raghavan and Shah 2015), anti-inflammatory (Kumar, Srivastava et al. 2015), antioxidant (Priyandoko, Ishii et al. 2011), and other benefits (Wankhede, Langade et al. 2015).Ginger has a long history of safe use for pain, Gl and aging-related conditions with evidence of benefits against oxidative stress (Wang, Zhang et al. 2014, Lakhan, Ford et al. 2015, Wilson 2015). Silymarin has good safety profile even in those with cirrhosis and even at much higher doses than used in PB127 or PB129 (up to 900 mg per day) (Saller, Meier et al. 2001, Jacobs, Dennehy et al. 2002). Bacopa monnieri has been proven safe at doses higher than used in PB129 in a study of memory loss in humans and animal studies have not demonstrated any adverse toxicity of any of its components (Mishra, Singh et al. 2000, Roodenrys, Booth et al. 2002). Luteolin is a bioflavonoid flavonoid commonly consumed in the human diet from a variety of food sources (e.g. onions, tea, apples, kale, olives, celery, spinach, oranges, mallow, etc.) resulting in a normal typical dietary intake of approximately 1 mg / day from food sources (Chun, Chung et al. 2007, Seelinger, Merfort et al. 2008, Jun, Shin et al. 2015, Kim, Park et al. 2015, Nabavi, Braidy et al. 2015). Luteolin is often used as a dietary supplement with an emphasis on its antioxidant (Sun, Sun et al. 2012), neuroprotective (Xu, Wang et al. 2014) and anti-inflammatory benefits (Seelinger, Merfort et al. 2008, Taliou, Zintzaras et al. 2013, Paredes-Gonzalez, Fuentes et al. 2015).
[0070] As an example of the properties of PB125, we cultured cell lines stably transfected with a construct driven by a luciferase gene that copies the ARE Nrf2-binding sequence in its promoter region (referred to as a promoter-reporter construct) (Simmons, Fan et al. 2011, Shukla, Huang et al. 2012). Briefly, stably transfected cell types HepG2 (human liver), AREc32 (human breast), MCF7 (human breast), A549 (human lung), 293T (human kidney), and A172 (human brain) were seeded at low density in 24-well plates and incubated at 37°C with 10% CO2. After 24 hours, various concentrations of PB125 were added to the cells. After an additional 18 hours of incubation, the cells were lysed in wells containing 100 μl of lysis buffer containing 3.5 mM sodium pyrophosphate to stabilize light output by luciferase. A 20 μl aliquot of the cell lysate was added to a cuvette, placed in a BD Monolight 3010 luminometer for background luminescence, and then 50 μl of 1 mM luciferin was injected into the tube. Relative light units were measured for each sample integrated for 10 seconds. The liver, breast, brain, and kidney cell types tested were shown by ( Figure 10 ) Nrf2 gene activation and luciferase expression treated with PB100-series combinations.
[0071] As an example of the cellular protection mechanism induced by PB125 treatment, we examined gene upregulation in cells treated with PB125. Briefly, cultured HepG2 hepatocytes were treated with PB125 at a concentration of 8 microgram / milliliter for 18 hours, after which total RNA was extracted from the HepG2 cells by using the RNeasy Total RNA Isolation Kit (QIAGEN Inc. Valencia, California, USA). The concentration of each sample was determined based on the absorbance at 260 nm (A260). The purity of each sample was determined based on the ratio of A260 to A280. A range of 1.9-2.1 was considered to be pure enough. The integrity of the total RNA samples was confirmed by the Agilent 2200 Tape Station. The total RNA (250 ng) was converted into double-stranded cDNA (ds-cDNA) by using the cDNA Synthesis Kit (Affymetrix). Oligo-dT primers containing a T7 RNA polymerase promoter were utilized. The ds-cDNA was then purified and recovered by using Purification Beads (Affymetrix). Next, in vitro transcription was performed to generate biotin-labeled cRNA using the RNA Transcription Labeling Kit (Affymetrix). The biotin-labeled cRNA was purified using the RNeasy Affinity Column (Qiagen). To ensure optimal hybridization to the oligonucleotide array, the cRNA was fragmented. Fragmentation was performed such that cRNA fragments were between 50-200 bases in length by incubating the cRNA in fragmentation buffer at 94°C for 35 minutes. The samples were then added to the hybridization solution containing 100 mM MES, 1 M Na+, and 20 mM EDTA in the presence of 0.01% TWEEN 20. The final concentration of the fragmented cRNA was 0.05 pg / pL. The hybridization was performed by using the GeneChip® Hybridization Oven 640 (Affymetrix) at 45°C for 16 hours. The hybridization was performed by using the GeneChip® Hybridization Oven 640 (Affymetrix) at 45°C for 16 hours. The hybridization was performed by using the GeneChip® Hybridization Oven 640 (Affymetrix) at 45°C for 16 hours. TM The hybridization was performed by using the GeneChip® Hybridization Oven 640 (Affymetrix) at 45°C for 16 hours. Fluid station 450 (Affy) was stained with streptavidin-phycoerythrin. The array was read using a GeneChip scanner 3000 (Affy) at a resolution of 2.5 to 3 microns. Each gene was represented by approximately 11 probes and a number of control probes per transcript. The GeneChip software program was used to determine the intensity of expression for all genes on the array. For this experiment, the gene induction folds of the PB125 treatment of HepG2 cells were calculated compared to the average intensity observed in the control HepG2 cells in the culture medium without any added stimulants (such as PB125). As depicted in Table 1, the genes upregulated by PB125 include a variety of Nrf2-regulated antioxidant, anti-inflammatory, cellular stress response and other protective genes. These genes include, for example, genes involved in GSH production and regeneration, iron chelation, GSH utilization, thioredoxin (TXN) production, regeneration and utilization, etc. Table 1 lists the relevant example genes upregulated by PB125. In summary, this example supports that the mechanism of cytoprotection by PB125 involves activation of the Nrf2 cell signaling pathway.
[0072] Table 1 Gene microarray analysis revealed that PB125 regulates multiple Nrf2-related genes and genes associated with antioxidant, anti-inflammatory and other cytoprotective effects.
[0073]
[0074] As an example of the anti-inflammatory mechanism induced by PB125 treatment, we examined cytokine levels in primary cells treated with PB125 and stimulated with bacterial lipopolysaccharide endotoxin (LPS). Murine peritoneal macrophages were obtained after treatment with thioglycolate into the peritoneal cavity for 1 week followed by lavage to recover approximately 7 million macrophages. Aliquots of the cells were plated and treated with an ethanol control (0.1% matched PB125) or PB125 (5 ug / mL) for 16 hours, followed by stimulation with lipopolysaccharide (100 ng / mL) or vehicle (negative control) for 5 hours. Total RNA was isolated from the cells for quantitative PCR analysis to measure tumor necrosis factor-α (TNFα) and interleukin-1β (IL-1β) gene expression, normalized to 18s levels. Notably, PB125 treatment caused a severe reduction in LPS-induced expression of the proinflammatory cytokines TNFα and IL-1β. See Figure 11 .
[0075] The combination of rosemary (6.7% carnosol), ashwagandha (1% withaferin A), and luteolin (98% luteolin) of PB125 (at 30:10:4 rosemary:ashwagandha:luteolin) increased Nrf2-dependent gene expression of the GCLM gene in buccal cell samples from a human subject orally taking 60 mg of PB125 daily, compared to buccal cell samples from two normal control subjects (as measured by quantitative RT-PCR on purified RNA using human GCLM-specific primers (forward primer: TTGCCTCCTGCTGTGTGATG (SEQ ID NO. 1), reverse primer: GTGCGCTTGAATGTCAGGAA) (SEQ ID No. 2), normalized to GAPDH, where relative fold changes were calculated by the 2^(ΔΔCt) method. See Figure 13 .
[0076] As additional data supporting the present invention, we discovered an unexpected amount of synergy between the rosemary, ginger, ashwagandha, and luteolin components. For example, low concentrations of luteolin synergistically activated Nrf2 in combination with rosemary extract and ginger extract. In the present invention, other agents can be added to the Nrf2-activating combination, provided that they do not interfere with Nrf2 activation functionality. We found that silymarin and bacopa saponin components did not antagonize Nrf2 activation by the rosemary, ginger, ashwagandha, and luteolin components.
[0077] Following this experiment in another way, the luciferase RLU measured 17, 24, 41 and 48 hours after HepG2 cell treatment (with PB125 treatment at 0-10 ug / mL and 0-50 ug / mL ranges) were washed out after a 2 hour exposure time and replaced with fresh cell culture medium showing that Nrf2-driven production of luciferase was highest at 17 hours, followed by a rapid decrease to approximately baseline levels 48 hours after treatment.
[0078] Repeated treatment of cultured HepG2 cells with a 2-hour exposure every 24 hours, followed by readings 24 hours later, showed that Nrf2 activation by PB125 gradually faded between 24 and 48 hours and that cells could still be reactivated if treated again with PB125.
[0079] As an example of the anti-inflammatory mechanism induced by treatment with PB123 or PB125, we examined gene expression and cytokine levels in primary human pulmonary artery endothelial cells (HPAEC) treated with PB123 or PB125 and stimulated with bacterial lipopolysaccharide endotoxin (LPS). LPS stimulation induced the expression of inflammation-related genes, and this upregulation was attenuated by treatment with PB123 or PB125. Table 2 shows the 40 genes that were most highly upregulated by LPS treatment, and shows that both PB123 treatment and PB125 treatment attenuated LPS-induced gene expression. LPS stimulation increased the release of proinflammatory interleukin-6 (IL6) protein from HPAEC cells, and this increase was attenuated by treatment with PB125. See Figure 12 .
[0080] Table 2 Gene microarray analysis revealed that PB123 and PB125 exhibited anti-inflammatory effects. Both PB123 and PB125 reduced the LPS-induced expression signals of the 40 genes most highly upregulated by LPS.
[0081]
[0082]
[0083]
[0084] Example 2PB125
[0085] One embodiment of the present disclosure is a combination of rosemary extract (specified at 5 to 50% carnosol), ashwagandha extract (specified at 0.5 to 10% withaferin A), and luteolin (specified at 10-100% luteolin) in a mass ratio of 30:10:6, 30:10:5, 30:10:4, or 30:10:1, wherein the daily human dose of the combination is in the range of 42 to 1050 mg, as shown in Table 3.
[0086] Table 3. Compositions with ingredients and daily dosage ranges for PB125 for humans
[0087]
[0088] Example 3PB127
[0089] Another embodiment of the present disclosure is a PB127 combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and / or 10-25% 6-gingerol), luteolin (specified at 90-100% luteolin), and milk thistle extract (specified at 50-90% silymarin) in a mass ratio of 10:5:1:30, respectively, wherein the daily human dose of the combination is in the range of 46 to 920 mg, as shown in Table 4.
[0090] Table 4. Compositions with ingredients and daily dosage ranges of PB127 for use in humans.
[0091]
[0092] Example 4PB129
[0093] Another embodiment of the present disclosure is a PB129 combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and / or 10-25% 6-gingerol), luteolin (specified at 90-100% luteolin), milk thistle extract (specified at 50-90% silymarin), and Bacopa monnieri extract (specified at 10-60% bacosides) in a mass ratio of 10:5:1:30:48, respectively, wherein the daily human dose of the combination is in the range of 94 to 1820 mg, as shown in Table 5.
[0094] Table 5. Compositions with ingredients and daily dosage ranges of PB129 for use in humans.
[0095]
[0096] Example 5PB123
[0097] Another embodiment of the present disclosure is a combination of PB123 with rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and / or 10-25% 6-gingerol), and luteolin (specified at 90-100% luteolin) at a mass ratio of 10:5:1, respectively, wherein the daily human dose of the combination is in the range of 16 to 320 mg, as shown in Table 6.
[0098] Table 6. Compositions with ingredients and daily dosage ranges for PB123 for use in humans
[0099]
[0100]
[0101] Example 6PB131
[0102] Another embodiment of the present invention is a PB131 combination of rosemary extract (specified at 5 to 10% carnosol), ginger extract (specified at 1-10% 6-shogaol and / or 10-25% 6-gingerol), luteolin (specified at 90-100% luteolin), and Bacopa monnieri extract (specified at 10-60% bacosides) in a mass ratio of 10:5:1:48, respectively, wherein the daily human dose of the combination is in the range of 64 to 1220 mg, as shown in Table 7.
[0103] Table 7. Compositions with ingredients and daily dosage ranges for PB131 for use in humans
[0104]
[0105] The contents of all cited references (including literature references, patents, patent applications and websites) that may be cited throughout this application or listed below are hereby expressly incorporated by reference in their entirety for any purpose. Unless otherwise indicated, the disclosure may employ conventional techniques of microbiology, molecular biology and cell biology that are well-known in the art.
[0106] The disclosed methods and systems may be modified without departing from the scope herein.It should be noted that the matter contained in the above description or shown in the accompanying drawings is to be interpreted in an illustrative rather than a limiting sense.
Claims
1. A composition comprising two or more phytochemicals selected from the group consisting of carnosol, carnosic acid, shogaol, gingerol, luteolin, and withaferin A, wherein the two or more phytochemicals are present in the composition in an amount effective to activate the Nrf2 pathway (nuclear factor-erythroid 2-related factor 2) when the composition is administered to a mammal.
2. The composition of claim 1, comprising rosemary extract, ginger extract, and luteolin, wherein the ratio between the rosemary extract, ginger extract, and luteolin is approximately 10:5:1 (w / w), which ratio synergistically effectively activates the nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway; the rosemary extract is specified to contain 5-10% carnosol, the ginger extract is specified to contain 1-10% 6-shogaol, and the luteolin is specified to contain 95-99% luteolin.
3. The composition of claim 1 , comprising rosemary extract, ashwagandha extract, and luteolin, wherein the rosemary extract is specified to contain 5-10% carnosol, the ashwagandha extract is specified to contain 1-3% withaferin A, and the luteolin is specified to contain 95-99% luteolin, wherein the ratio of the rosemary extract, ashwagandha extract, and luteolin is approximately 30:10:4 (w / w), which ratio is synergistically effective in activating the nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway.
4. The composition of claim 2, wherein the composition further comprises one or more phytochemicals selected from the group consisting of Silybum marianum, Bacopa monnieri, and Ashwagandha.
5. The composition of claim 3, wherein the composition further comprises one or more phytochemicals selected from the group consisting of milk thistle, ginger extract, and Bacopa monnieri.
6. The composition of claim 4, wherein the composition comprises rosemary extract, ginger extract, luteolin and milk thistle extract, the ratio between the rosemary extract, ginger extract, luteolin and milk thistle extract being approximately 10:5:1:30 (w / w).
7. The composition of claim 4, wherein the composition comprises rosemary extract, ginger extract, luteolin, milk thistle extract, and Bacopa monnieri extract, and the ratio between the rosemary extract, ginger extract, luteolin, milk thistle extract, and Bacopa monnieri extract is approximately 10:5:1:30:48 (w / w).
8. The composition of claim 4, wherein the composition comprises rosemary extract, ginger extract, luteolin and Bacopa monnieri extract, the ratio between the rosemary extract, ginger extract, luteolin and Bacopa monnieri extract being approximately 10:5:1:48 (w / w).
9. The composition of claim 2, wherein the composition is used to prevent and / or treat a disease or condition selected from the group consisting of oxidative stress, detoxification, inflammation, cancer, or a related disease or condition.
10. The composition according to claim 2, wherein the composition is used as a nutritional supplement.
11. The composition of claim 2, wherein the composition is in the form of a tablet, capsule, soft gel, liquid, emulsion, gel, powder, ointment, or aerosol.
12. A method for preparing a medicament for treating and / or preventing a disease or condition in a mammal, wherein the treating and / or preventing the disease or condition in a mammal comprises administering the composition of claim 1 to the mammal.
13. The method of claim 12, wherein the composition is administered orally to a human at 10 to 1000 mg / day.
14. The method of claim 12, wherein the composition comprises at least two phytochemicals selected from the group consisting of carnosol, carnosic acid, shogaol, gingerol, luteolin and withaferin A, wherein the at least two phytochemicals exert their effects on at least two different control points of the Nrf2 activation pathway, the control points being selected from the group consisting of control points A, B, C, D and E.
15. A composition comprising rosemary extract, ginger extract, and luteolin, wherein the ratio between the rosemary extract, ginger extract, and luteolin is approximately 10:5:1 (w / w), and the rosemary extract, ginger extract, and luteolin in the ratio are synergistically effective in activating the nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway in human cells when administered to human cells; the rosemary extract is specified to contain 5-10% carnosol, the ginger extract is specified to contain 10-25% 6-gingerol, and the luteolin is specified to contain 95-99% luteolin.