Application of Syn3 in preparation of medicine for treating spinal cord injury

By binding to Syn3 and PSD95, the BDNF-TrkB signaling pathway is enhanced, axon regeneration and neural circuit reconstruction are promoted, solving the problems of short half-life and poor penetration of recombinant human BDNF in spinal cord injury, and achieving functional recovery of spinal cord injury.

CN120754223APending Publication Date: 2025-10-10THE SECOND HOSPITAL AFFILIATED TO SUZHOU UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511037856.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-28
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

Recombinant human BDNF has a short half-life in tissues and is difficult to penetrate the blood-spinal cord barrier, which limits its application in spinal cord injury and leads to limited functional recovery of SCI.

Method used

Using Syn3 solution, by binding to PSD95, it promotes the coupling of rkB-PSD95-Gαi1/3 signaling complex, enhances the BDNF-TrkB downstream PI3K-Akt signaling pathway, promotes neuronal axon growth, and penetrates the blood-spinal cord barrier to reach the spinal cord.

Benefits of technology

Syn3 promotes growth cone disassembly and axon regeneration after spinal cord injury, rebuilds neural circuits, restores hindlimb motor function and neuroelectrophysiology in mice, and improves urinary retention, providing a new option for targeted drug treatment of spinal cord injury.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120754223A_ABST
    Figure CN120754223A_ABST
Patent Text Reader

Abstract

The invention provides application of Syn3 in preparation of medicines for treating spinal cord injury, and belongs to the technical field of biological medicines. The invention finds that the PSD95 binding peptide Syn3 can promote coupling of rkB-PSD95-G alphai1 / 3 signal compounds, promote a BDNF-TrkB downstream PI3K-Akt signal channel and play a role in promoting neuronal axon growth, meanwhile, the Syn3 can penetrate through a blood spinal cord barrier to reach a spinal cord part and be stably combined with PSD95, after in-vivo injection, growth cone depolymerization and axon regeneration after spinal cord injury can be promoted, a neural circuit is further reconstructed, and the effect of promoting neuronal axon growth is achieved. Motion functions and nerve electrophysiology of the hind limbs of the mouse are recovered.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of Syn3 in the preparation and treatment of spinal cord injury. Background Art

[0002] After spinal cord injury (SCI), neuronal axon regeneration is impaired, making it difficult to establish functional neural circuits, leading to complete or incomplete motor, sensory, and autonomic dysfunction. Neurotrophic factors have neuroprotective and regenerative functions. Among them, brain-derived neurotrophic factor (BDNF) can promote spinal cord neuron axon regeneration. BDNF binds to TrkB to activate downstream PI3K-Akt and Ras / MAPK signaling, promoting axon regeneration and sprouting after spinal cord injury. However, recombinant human BDNF has a short half-life in tissues and has difficulty penetrating the blood-spinal cord barrier, which limits its application in spinal cord injury and has limited effect on functional recovery of SCI. Therefore, it is crucial to further elucidate the molecular mechanism by which BDNF promotes neuronal axon regeneration, identify key regulatory proteins, and find drugs that can cooperate with BDNF to improve the therapeutic effect of SCI. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide the use of Syn3 in the preparation of a drug for treating spinal cord injury.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides the use of Syn3 in preparing a medicine for treating spinal cord injury.

[0006] Preferably, the drug is a liquid preparation;

[0007] The concentration of the Syn3 solution in the drug is 0.1-0.5 μM, and the dosage of the Syn3 is 0.5-2 mg / kg.

[0008] Preferably, the Syn3 is administered by injection.

[0009] Preferably, the treatment of spinal cord injury includes improving urinary retention caused by spinal cord injury.

[0010] Preferably, the treatment of spinal cord injury includes promoting the recovery of hind limb motor function caused by spinal cord injury.

[0011] The present invention provides the use of Syn3 in preparing a reagent for promoting neuronal axon regeneration, wherein the concentration of Syn3 in the reagent is 0.2-2.0 μM.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention discovered that the PSD95-binding peptide Syn3 can promote the coupling of the rkB-PSD95-Gαi1 / 3 signaling complex, promote the BDNF-TrkB downstream PI3K-Akt signaling pathway, and promote neuronal axonal growth. At the same time, Syn3 can penetrate the blood-spinal cord barrier to reach the spinal cord and stably bind to PSD95. After in vivo injection, it can promote growth cone disaggregation and axon regeneration after spinal cord injury, thereby rebuilding neural circuits and restoring hindlimb motor function and neuroelectrophysiology in mice. This invention provides experimental evidence for the development of Syn3 as a targeted drug for spinal cord injury, and provides a new option for breakthroughs in clinical drug treatment of spinal cord injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Figure 2 is a stable binding diagram of the PDZ3 domain of Syn3 and PSD95, where A is the structure of the active peptide Syn3.

[0015] B shows the parameters of Syn3 and CN2097 binding to the PDZ3 domain of PSD95, and C shows the binding mode of Syn3 to the PDZ3cα segment of PSD95 as shown by nuclear magnetic resonance spectroscopy;

[0016] Figure 2 The figure shows the effect of Syn3 on enhancing BDNF-induced axon growth in primary mouse spinal cord neurons. A shows the Tuj-1 immunofluorescence staining of primary mouse spinal cord neurons after 3 days of treatment with different groups. B shows the measurement of axon length using Image J.

[0017] Figure 3 Figure 3 shows the effect of Syn3 on enhancing BDNF-induced growth cone disaggregation in primary mouse spinal cord neurons. A shows the effect of Syn3 on enhancing BDNF-induced growth cone disaggregation in primary mouse spinal cord neurons after 3 days of treatment with different groups. Immunofluorescence staining of Tuj-1 and F-actin was performed on primary mouse spinal cord neurons. B shows the growth cone area measured using Image J.

[0018] Figure 4 Figure 3 shows the effect of Syn3 on enhancing BDNF downstream signaling activation in primary mouse spinal cord neurons. A shows the cell lysates collected after treatment and subjected to Western blotting. B shows the quantification of TrkB phosphorylation or total protein expression using Image J software. C shows the quantification of Akt total protein using Image J software. D shows the quantification of S6K total protein using Image J software. E shows the quantification of Erk1 / 2 expression using Image J software.

[0019] Figure 5Figure 3 illustrates the effect of Syn3 on the activation of Akt and S6 signaling downstream of BDNF in primary mouse spinal cord neurons. A shows p-Akt immunofluorescence staining of treated neurons. B shows p-S6 immunofluorescence staining of mouse spinal cord neurons after co-treatment with BDNF and Syn3 for 3 days. C and D show the quantification of fluorescence results using Image J software.

[0020] Figure 6 The figure shows the effect of Syn3 on the activation of Akt signaling downstream of BDNF in primary mouse spinal cord nerve growth cones. A shows the immunofluorescence staining of p-Akt, and B shows the quantification of the fluorescence results using Image J software.

[0021] Figure 7 Figure 3 shows the effect of Syn3 specifically enhancing BDNF signal transduction. A is the quantitative analysis of Western blot results using Image J software; B is the quantitative analysis of TrkB; C is the quantitative analysis of p-Akt, p-S6K, Akt1, and S6K.

[0022] Figure 8 Figure 3 shows the effect of Syn3 targeting on enhancing BDNF downstream signaling activation in primary mouse spinal cord neurons. A is the quantitative Western blot results obtained using Image J software, and the results of five replicates were statistically analyzed. B and C are the expression of p-Akt (Ser-473), p-S6 (Thr-389), Akt1, and S6, as well as the quantitative analysis of p-Akt and p-S6.

[0023] Figure 9 Figure 1 shows the inability of Syn3 to enhance BDNF-induced neurite outgrowth in Gαi1 / 3 DKO primary mouse spinal cord neurons. Figures A and B show immunofluorescence staining of Tuj-1 and F-actin in treated primary neurons. Figures C and D show measurements of axon length and growth cone area using Imaris and Image J.

[0024] Figure 10 Figure 2 shows the inability of Syn3 to enhance BDNF downstream signaling activation in Gαi1 / 3DKO mouse spinal neurons. A and B show the results of Western blot analysis of primary spinal neurons from WT and Gαi1 / 3DKO mice after treatment. Cell lysates were collected for Western blot analysis. Image J software was used to quantify the Western blot results, and five replicates were statistically analyzed. C shows the quantitative analysis of Gαi1 and Gαi2. D shows the quantitative analysis of p-TrkB and TrkB. E shows the quantitative analysis of p-Akt (Ser-473), p-S6K (Thr-389), Akt1, and S6K.

[0025] Figure 11 The figure shows that Syn3 cannot enhance the activation of BDNF downstream signaling in spinal neurons of Gαi1 / 3DKO mice. A and B show the extraction and culture of primary spinal neurons from WT and Gαi1 / 3DKO mice, which were co-treated with BDNF and Syn3 for 3 days and then immunostained for p-Akt and p-S6. C and D show the quantification of the fluorescence results.

[0026] Figure 12 Quantitative analysis of Akt fluorescence results;

[0027] Figure 13 Figure 3. Knockdown of Gαi1 / 3 in primary mouse spinal cord neurons significantly inhibits BDNF+Syn3-induced downstream signaling activation. A and B are the results of Western blot experiments, and the Western blot results were quantified using Image J software. Figures CE and F are the quantitative analysis results of Gαi1, Gαi2, and Gαi3, respectively. Figures F and H are the quantitative analysis results of p-TrkB, p-Akt, p-S6K, TrkB, Akt1, and S6K.

[0028] Figure 14 Figure 1 shows the effect of knocking down PSD95 in primary mouse spinal cord neurons on significantly inhibiting BDNF+Syn3-induced downstream signaling activation. A and B are Western blot results; C is the quantitative analysis result of PSD95; D and E are the quantitative analysis results of p-TrkB, p-Akt, p-S6K, TrkB, Akt1, and S6K.

[0029] Figure 15 The figure shows the effect of Syn3 facilitating BDNF-induced TrkB-Gαi1 / 3 coupling, where A and B are representative images of immunofluorescence staining of each group, green: TrkB, red: Gαi1 or Gαi3, blue: DAPI;

[0030] Figure 16 This is a diagram showing the effect of Syn3 enhancing BDNF-induced TrkB-PSD95-Gαi1 / 3 coupling;

[0031] Figure 17 Figure 1 shows the effect of Syn3 passing through the blood-spinal cord barrier and being absorbed by spinal cord neurons. A is the molecular structure of Syn3-AF488, and the box represents Alexa Fluor 488 (AF488). B shows wild-type mice injected intraperitoneally with 1 mg / kg of Syn3-AF488. Four hours later, spinal cord tissue was obtained and observed under a laser confocal microscope. The right image is an enlargement of the left image. Green: Syn3-AF488, blue: DAPI.

[0032] Figure 18Figure 1 shows the effect of Syn3 on the recovery of hindlimb motor function in mice with spinal cord injury. A shows WT mice undergoing spinal cord injury. One group received an intraperitoneal injection of Syn3 (Syn3 group), while the other group received an intraperitoneal injection of the same dose of saline (Vehicle group). BMS motor function scores were obtained on days 0, 1, 3, 7, 14, 21, 28, 35, and 42 after surgery. B shows the reconstructed trajectory of the right hindlimb during a single stride in the two groups of mice. C shows the step height of a single stride in the two groups of mice. D shows representative images of footprints in the two groups of mice with spinal cord injury. E shows representative images of time-lapse photography of the two groups of mice during locomotion.

[0033] Figure 19 The effect of Syn3 on promoting the electrophysiological recovery of the hind limbs of mice with spinal cord injury is shown in Figure 3. A is a representative electrophysiological image of the two groups of mice with spinal cord injury; B and C are quantitative and statistical analyses of the electrophysiological action potential amplitude and latency of the two groups of mice;

[0034] Figure 20 The diagram shows the effect of Syn3 treatment on improving bladder function in mice. A is a representative image of H&E staining of bladder tissues in the two groups of mice; B is a quantitative analysis of the detrusor muscle thickness in the two groups of mice; C is a quantitative analysis of the bladder volume in the two groups of mice;

[0035] Figure 21 The figure shows the effect of Syn treatment on reducing the area of ​​spinal cord injury in mice. A is a representative image of the spinal cord tissue of the two groups of mice under direct observation; B is a representative image of the spinal cord tissue of the two groups of mice stained with H&E; C is the quantification of the spinal cord injury area of ​​the two groups of mice;

[0036] Figure 22 Figure 3 illustrates the effect of Syn3 on promoting axon regeneration after spinal cord injury. A and B are representative images of sagittal sections of the spinal cord injury area of ​​the two groups of mice using immunofluorescence double labeling. Red: NF200 or Tuj-1, green: GFAP, blue: DAPI. Scale bar: 500 μm. C shows the quantification and statistical analysis of the NF200 fluorescence area in A using Image J analysis. D shows the quantification and statistical analysis of the Tuj-1 fluorescence area in B using Image J analysis.

[0037] Figure 23 Figure 3 illustrates the effect of Syn3 on promoting axon regeneration in the corticospinal tract after spinal cord injury. A is a representative image of sagittal sections of the spinal cord injury area in two groups of mice. Green: GFP represents the corticospinal tract, blue: DAPI. Scale bar: 500 μm. B is a quantitative and statistical analysis of the distance from the CST terminal to the midpoint of the injury in A using Image J analysis.

[0038] Figure 24Figure 3 illustrates the effect of Syn3 on promoting axon regeneration in the raphe spinal tract after spinal cord injury. A is a representative image of immunofluorescence experiments on sagittal sections of the spinal cord injury area of ​​the two groups of mice, red: 5-HT, blue: DAPI, scale bar: 500 μm; B is a representative image of immunofluorescence experiments on transverse sections of the spinal cord injury area of ​​the two groups of mice, red: Chat, green: 5-HT, scale bar: 20 μm; C is the quantification and statistical analysis of the 5-HT fluorescence area in A using Image J analysis; D is the quantification and statistical analysis of the 5-HT fluorescence area in B using Image J analysis;

[0039] Figure 25 Figure 3 shows the effect of Syn3 on enhancing the activation of BDNF downstream signaling after spinal cord injury in mice. A shows the extraction of spinal cord tissue lysate and the detection of related proteins by Western blot; B shows the quantification of the proteins in A using Image J analysis.

[0040] Figure 26 Figure 3 illustrates the effect of Syn3 on enhancing the activation of BDNF downstream signaling in neurons in the spinal cord injury area of ​​mice. A and B are representative images of double immunofluorescence experiments around the spinal cord injury area of ​​two groups of mice. Green: p-Akt or p-S6, red: NeuN, blue: DAPI. Scale bars: 500 μm and 100 μm. C is the quantification and statistical analysis of the mean fluorescence intensity of p-Akt in A using Image J analysis. D is the quantification and statistical analysis of the mean fluorescence intensity of p-S6 in B using Image J analysis.

[0041] Figure 27 Figure 3 illustrates the effect of Syn3 on enhancing the activation of BDNF downstream signaling in the motor cortex neurons of mice. A and B are representative images of double immunofluorescence staining of the motor cortex of the two groups of mice. Green: p-Akt or p-S6, red: NeuN, blue: DAPI. Scale bar: 20 μm. C is the quantification and statistical analysis of the mean fluorescence intensity of p-Akt in the left center of A using Image J analysis. D is the quantification and statistical analysis of the mean fluorescence intensity of p-S6 in the left center of B using Image J analysis.

[0042] Figure 28 Schematic diagram of the experimental principle. DETAILED DESCRIPTION

[0043] The present invention provides the use of Syn3 in preparing a medicine for treating spinal cord injury.

[0044] In the present invention, the drug is a liquid preparation;

[0045] The concentration of the Syn3 solution in the drug is preferably 0.1-0.5 μM, more preferably 0.15-0.3 μM, and even more preferably 0.2 μM. The usage of the Syn3 is preferably 0.5-2 mg / kg, more preferably 0.7-1.5 mg / kg, and even more preferably 1 mg / kg.

[0046] In the present invention, the method of using Syn3 preferably includes injection.

[0047] In the present invention, the treatment of spinal cord injury includes improving urine retention caused by spinal cord injury, and Syn3 increases the thickness of the detrusor muscle of the mouse bladder.

[0048] In the present invention, the treatment of spinal cord injury includes promoting the recovery of hind limb motor function caused by spinal cord injury.

[0049] The present invention provides the use of Syn3 in preparing a reagent for promoting neuronal axon regeneration, wherein the concentration of Syn3 in the reagent is 0.2-2.0 μM.

[0050] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0051] In the present invention, *P<0.05, **P<0.01, ***P<0.001, and NS represent no statistically significant difference.

[0052] In the present invention, the examples were generally repeated five times, and the results of the five repetitions were statistically analyzed, and the data were expressed as mean ± standard deviation.

[0053] Sources

[0054] experimental animals

[0055] C57BL / 6J mice were purchased from the Shanghai Slake Laboratory Animal Center (Shanghai, China). Spinal cord injury model mice were female, 5-6 weeks old, and weighed 17-18 g. They were maintained at a temperature of 25 ± 1°C, a humidity of 10-20 lux, and a 12-h light / dark cycle. They were fed a standard irradiated sterilized mouse diet and received single-use sterile distilled water. Animal care and use were in accordance with the ethical guidelines for experimental animals of Soochow University.

[0056] The sources of main reagents and antibodies are shown in Table 1

[0057] Table 1 Main reagents and antibodies

[0058]

[0059]

[0060] Reagent preparation:

[0061] (1) DMEM complete medium (50 mL): Use a pipette to draw 44.5 mL of DMEM basal medium, 5 mL of fetal bovine serum, and 0.5 mL of double-antibody into a 50 mL centrifuge tube, and gently pipette to mix. Mark and store at 4°C until ready for use.

[0062] (2) Neurobasal medium (50 mL): Use a pipette to draw 48 mL of Neurobasal medium, 1 mL of B27 additive, 0.5 mL of GlutaMAX additive, and 0.5 mL of double-antibody into a 50 mL centrifuge tube. Gently pipette to mix, mark, and store at 4°C until ready for use.

[0063] Common experimental methods in the following examples:

[0064] Co-immunoprecipitation

[0065] (1) Remove the culture dishes of the control group and the BDNF and Syn3-treated groups from the incubator, wash them 1-2 times with 37°C PBS, discard the supernatant, add lysis buffer and let it stand on ice for 10 minutes, scrape the cells to one side with a plastic cell scraper, place the culture dish on its side on ice and let it stand for 2-3 minutes, transfer the lysed cell suspension to a 1.5 mL centrifuge tube and label it;

[0066] (2) Centrifuge at 4°C, 14,000 rpm for 15 min, and transfer the supernatant to a new 1.5 mL centrifuge tube. Add 20 μL of protein A / G agarose bead slurry at a ratio of lysate to protein A / G agarose bead slurry of 50:1, and incubate the sample on a shaker at 4°C for 10 min.

[0067] (3) Centrifuge at 4°C, 14,000 rpm for 5 min, remove the beads, transfer the supernatant to a new 1.5 mL centrifuge tube, determine the protein concentration, and then aliquot.

[0068] (4) Dilute the total protein to approximately 1 μg / μL or 10 μg / μL with PBS;

[0069] (5) Add primary antibody and 2.5 μL of normal IgG to cell lysate or 1000 μg of total protein and incubate at room temperature for 2 h; add 25-40 μL of protein A / G agarose bead slurry and incubate on a shaker at 44°C for 1-2 h;

[0070] (6) Centrifuge at 2500 rpm for 5 min at 4°C and collect the precipitate;

[0071] (7) Wash with PBS three times and repeat the above centrifugation steps;

[0072] (8) Add 60 μL of loading buffer, pipette to mix thoroughly, and transfer the sample to a metal bath at 95°C for 10 min. After the sample cools, separate the beads.

[0073] (9) Centrifuge the sample for 60 seconds, collect the supernatant, and load it for immunoblotting.

[0074] Syn3 administration: Syn3 was prepared in normal saline to a 0.1 mg / mL solution. Mice undergoing spinal cord transection injury were randomly divided into two groups. Mice in the Syn3 group received intraperitoneal injections of Syn3 (1 mg / kg) starting one day after surgery and continued daily until day 42 after surgery. Mice in the Vehicle group received the same volume of vehicle (normal saline).

[0075] Tissue immunofluorescence

[0076] (1) Perfusion sampling

[0077] After the mouse is anesthetized, it is placed on a foam board with its limbs fixed. The mouse abdomen is cut open with scissors, the pleural membrane is gently cut open, and both sides of the thorax are cut open to completely expose the mouse heart. Insert the needle into the left ventricle.

[0078] Fix the needle on the foam board with medical tape, and then cut the right atrial appendage. Use a perfusion pump to slowly inject pre-cooled saline into the left ventricle of the mouse. After about 5 minutes, the mouse's liver was observed to be completely white. Subsequently, the injected solution was replaced with pre-cooled 4% paraformaldehyde, and perfusion was continued for 5 minutes. After the perfusion, the mouse's limbs became stiff, and the mouse's tail tilted vertically upward, indicating that the perfusion was successful. Use scissors to cut off the mouse's head and spinal cord injury site, open the mouse's skull and vertebral plate, gently peel off the mouse's meninges and other components, and place the mouse's entire brain and spinal cord tissue in a pre-cooled 4% paraformaldehyde solution and fix it at 4°C overnight.

[0079] (2) Gradient dehydration

[0080] The spinal cord and brain tissues immersed in 4% paraformaldehyde solution were taken out and gently rinsed with PBS to remove the residual 4% paraformaldehyde solution. Gradient dehydration was performed using sucrose solutions (PBS configuration) of different concentrations. The spinal cord and brain tissues of mice were immersed in 15% sucrose solution and dehydrated. Each spinal cord and brain tissue required 5mL of sucrose solution. After waiting for the tissue to sink to the bottom (approximately 24h), the freshly prepared 30% sucrose solution was replaced and dehydration was continued. After waiting for the tissue to sink to the bottom, the gradient dehydration was completed.

[0081] (3) Frozen sections

[0082] Remove the spinal cord and brain tissue from the sucrose solution and gently remove any remaining sucrose solution with filter paper. Embed the tissue in OCT and freeze at -20°C. Once the OCT has completely solidified, the spinal cord and brain tissue can be stored in a -80°C freezer for long-term storage. Before frozen sectioning, pre-cool the microtome to -25°C and pre-chill the anti-roll plate, blade, and brush. Add 1-2 ml of OCT to the specimen tray, place the embedded tissue on the tray, and freeze at -80°C. Once the brain tissue has completely solidified on the ice plate, place the ice plate on the stage, attach the anti-roll plate and blade, adjust the distance between the stage and the blade, and perform serial sectioning. Each section should be 10 μm thick and transferred to an adhesive slide. Allow the sections to dry in OCT at room temperature for a period of time before further experimental manipulation or store in a -80°C freezer.

[0083] (4) Immunofluorescence staining

[0084] Wash sections gently with PBS three times for 5 minutes each on a shaker to remove any residual OCT embedding medium from the spinal cord and brain tissue. Note: Sections stored at -80°C must be rewarmed at room temperature for 1 hour. Permeabilize the tissue with 0.02% Triton X-100 solution for 20 minutes, then block with 0.5% goat serum in PBS for 1.5 hours at room temperature. Incubate sections with the desired primary antibody in a humidified chamber at 4°C overnight. The next day, wash sections gently with PBS three times for 5 minutes each on a shaker, followed by incubation with a specific fluorescent secondary antibody conjugated to Alexa Fluor 488, Alexa Fluor 594, or Alexa Fluor 647 for 2 hours at room temperature in the dark. Wash sections gently with PBS three times for 5 minutes each on a shaker, protecting from light. Air-dry the slides, mount with antifade reagent containing DAPI, and store at 4°C in the dark.

[0085] Example 1

[0086] Syn3 stably associates with PSD95.

[0087] CN2097 has a ring structure, and its mimetic peptide that selectively binds to the PDZ3 domain can enhance BDNF signaling. Syn3 is a disulfide-linked chimera, and its active ingredient Syn3* has 7 residues from the protein SynGAP and 6 residues from the CRIPT cyclic peptide ( Figure 1 Surface plasmon resonance experiments showed that the dissociation constant of Syn3 binding to PDZ3cα was 41 nM, which was significantly lower than that of CN2097. In addition, Syn3 had higher binding and dissociation rates, confirming that Syn3 binds to the PDZ3 domain of PSD95 more stably than CN2097 ( Figure 1 B) in.

[0088] A model of Syn3 binding to PDZ3cα was generated using the HADDOCK2.4 web server. This model used 13 non-buried residues of PDZ3cα (Gly324, Phe325, Asn326, Ile327, Val328, Gly329, His372, Glu373, Ala376, Ile377, Lys380, Ile404, and His405) as active residues, while passive residues were automatically selected by the software. Peptide conformations were randomly generated, and all peptide residues were labeled as active residues. The highest-scoring representative model ( Figure 1 C in Figure 1). The model predicts that the CRIPT loop peptide binds to the PDZ3 domain between the β2 strand and the α-helix, where three residues—Lys9, Thr11, and Val13—create a key binding contact point. SynGAP-derived residues Phe4, Trp7, and Val8 interact with the αC helix residue Ile404. Binding to the αC helix is ​​driven by hydrophobic interactions, enhancing the binding affinity and specificity of the PDZ3 domain.

[0089] Example 2

[0090] Effect of Syn3 on BDNF-induced neuronal axonal growth.

[0091] After BDNF was diluted to 25 ng / mL and Syn3 was diluted to 0.2 μM with PBS buffer, primary spinal cord neurons of mice were co-treated with the above diluted BDNF, Syn3, and BDNF+Syn3 for 3 days, and the system was replenished with PBS buffer. The control group was treated with PBS buffer for 3 days, and then the axons and growth cones of the neurons were immunofluorescently stained. The results showed that compared with the control group, the axons of primary spinal cord neurons in the BDNF-treated group were longer, and the axon length was further increased after BDNF+Syn3 co-treatment, while the use of Syn3 alone did not affect the axon length ( Figure 2 Immunofluorescence results showed that after BDNF treatment, the growth cone area increased, F-actin depolymerized, and microtubules extended to the peripheral area of ​​F-actin. After Syn3+BDNF co-treatment, the growth cone area further increased, F-actin depolymerization increased, and the number of microtubules extending to the periphery of F-actin increased. However, Syn3 treatment alone could not induce F-actin depolymerization, and the growth cone area showed no statistical difference compared with the control group ( Figure 3 The above experimental results show that Syn3 enhances BDNF-induced axon growth, F-actin depolymerization and increase in growth cone area in primary mouse spinal cord neurons.

[0092] The immunofluorescence staining is to plant 7W primary mouse spinal cord neurons per well on poly-ornithine-coated slides (slides are placed in 24-well plates). The primary mouse spinal cord neurons are cultured for 3 days and then treated with corresponding drugs. After the treatment, they are washed twice with preheated PBS and then fixed with 4% paraformaldehyde for 15 minutes. After fixation, they are washed three times with PBS, permeabilized with 0.2% TritonX-100 solution for 20 minutes, and then blocked in 0.5% goat serum solution for 1 hour. Next, a solution containing rabbit anti-p-Akt (1:500), p-S6 (1:500), and mouse anti-Tuj-1 (1:500) is added and incubated at 4°C overnight. The next day, the slides are washed three times with PBS, and the corresponding fluorescent secondary antibodies are added and incubated in the dark for two hours at room temperature, and then washed three times with PBS in the dark. Finally, the slides are taken out and dried, and cured at 4°C for 24 hours. Photographs were taken using a Zeiss laser confocal microscope LSM900.

[0093] Example 3

[0094] Syn3 enhances BDNF downstream signaling activation in mouse spinal cord neurons.

[0095] First, primary mouse spinal neurons were treated with PBS for 30 minutes, then pretreated with 0.2 μM Syn3 or PBS for 20 minutes, and then treated with BDNF (25 ng / mL) for the specified time (0, 1, 2, 5, 10 and 20 minutes). After treatment, cell lysates were collected for Western blotting experiments. The results showed that Syn3 had no significant effect on BDNF-induced TrkB phosphorylation or total protein expression. The effect of Syn3 on BDNF-induced downstream signal activation was then detected. The results showed that Syn3 significantly enhanced BDNF-induced Akt (Ser-473) and S6K (Thr-389) phosphorylation, while the total protein expression of Akt1 and S6K did not change significantly after Syn3 treatment. The activation level of Erk / MAPK signaling was also detected, and the results showed that Syn3 could not enhance BDNF-induced Erk1 / 2 (Thr202 / Tyr204) phosphorylation (see for details). Figure 4 ).

[0096] Mouse spinal cord neurons were co-treated with Syn3 and BDNF for 3 days, and then the neurons were subjected to immunofluorescence staining (same as in Example 2). The results showed that BDNF treatment increased the phosphorylation levels of Akt and S6 in neuronal cell bodies ( Figure 5 ) and increased the phosphorylation level of Akt in growth cones ( Figure 6Co-treatment of Syn3 and BDNF further enhanced the phosphorylation levels of Akt and S6, while Syn3 alone did not increase the phosphorylation levels of Akt and S6 in cell bodies and growth cones.

[0097] Example 4

[0098] Syn3 is specific for enhancing BDNF-TrkB downstream signaling.

[0099] To investigate the specific enhancement of BDNF-TrkB signaling by Syn3, we used lentiviral-encapsulated shRNA to knock down the expression of the BDNF receptor TrkB in spinal neurons (for details, see Shi X, Zhou XZ, Chen G, et al. Targeting the postsynaptic scaffolding protein PSD-95 enhances BDNF signaling to mitigate depression-like behaviors in mice. Sci Signal. 2024; 17(834): eadn4556.). Primary mouse spinal neurons were transfected with TrkB-shRNA (shTrkB), while a control group was transfected with nonsense shRNA (shC). Three days after transfection, cells were pretreated with Syn3 (0.2 μM) for 20 minutes, followed by treatment with BDNF (25 ng / mL) for 20 minutes. Neuronal proteins were extracted and analyzed by Western blot. The experimental results showed that TrkB-shRNA significantly downregulated the expression of TrkB protein in primary mouse spinal cord neurons and almost blocked the phosphorylation of Akt and S6K induced by Syn3 and BDNF combined treatment (BDNF+Syn3). Figure 7 ).

[0100] Primary mouse spinal cord neurons were pretreated with Syn3 or vehicle control (PBS) for 20 minutes, and then treated with CNTF or VEGF (25 ng / mL) for 20 minutes. Cell lysates were collected for Western blot. The experimental results showed that Syn3 pretreatment in primary mouse spinal cord neurons did not affect the phosphorylation of Akt and S6 induced by CNTF and VEGF ( Figure 8 ).

[0101] Example 5

[0102] Syn3 fails to enhance BDNF-induced axonal growth in Gαi1 / 3DKO primary spinal motor neurons.

[0103] Gαi1 / 3 are key proteins in BDNF-induced axon regeneration. Syn3 can enhance BDNF-induced downstream Akt-mTOR signaling activation through specific binding to the PDZ3 domain of PSD95, thereby promoting spinal cord axon growth. These results suggest that Gαi1 / 3 is involved in Syn3's enhancement of BDNF-induced axon growth.

[0104] In order to demonstrate the role of Gαi1 / 3 protein in Syn3-enhanced BDNF-induced spinal axon growth, primary spinal cord neurons from WT and Gαi1 / 3DKO mice were extracted. After the cells adhered to the wall, they were treated with BDNF for 3 days, and the Gαi1 / 3DKO group was additionally treated with Syn3 for 3 days, followed by immunofluorescence experiments (same as Example 2). The results showed that compared with the WT group, the axons of spinal neurons in the Gαi1 / 3DKO group were shorter, the growth cones were highly aggregated, the microtubules could not extend to the peripheral area of ​​F-actin, the growth cone area was smaller, and Syn3 could not reverse the growth cone aggregation and axon shortening of Gαi1 / 3DKO neurons (see for details). Figure 9 ).

[0105] Example 6

[0106] In Gαi1 / 3DKO primary spinal motor neurons, Syn3 failed to enhance BDNF-induced downstream Akt-mTOR activation.

[0107] To further demonstrate the role of Gαi1 / 3 proteins in spinal cord neurons in Syn3-enhanced BDNF downstream signaling, primary spinal cord neurons from wild-type and Gαi1 / 3 DKO mice were isolated and pretreated with 0.2 μM Syn3 or PBS for 20 minutes. They were then treated with BDNF (25 ng / mL) for 20 minutes. Cell lysates were collected and analyzed by Western blot for Gαi1, Gαi2, and Gαi3 protein expression and TrkB activation. The results showed that Gαi1 and Gαi3 protein expression was absent in Gαi1 / 3 DKO primary spinal cord neurons, while Gαi2 expression was normal. Furthermore, BDNF+Syn3 induction did not affect Gαi protein expression. Furthermore, the absence of Gαi1 / 3 expression in primary spinal cord neurons did not affect BDNF+Syn3-induced TrkB activation.

[0108] The effect of Gαi1 / 3 deficiency on the phosphorylation levels of Akt and S6K induced by BDNF+Syn3 was detected. The results showed that compared with the WT group, the phosphorylation of downstream Akt and S6K induced by BDNF+Syn3 in neurons of the Gαi1 / 3DKO group was significantly reduced, while the expression of Akt1 and S6K total proteins did not change significantly ( Figure 10 ).

[0109] Immunofluorescence staining was then used to verify the above experimental results. Primary spinal cord neurons from WT and Gαi1 / 3DKO mice were extracted and treated with BDNF for 3 days after cell attachment. The Gαi1 / 3DKO group was additionally treated with Syn3 for 3 days. Immunofluorescence staining was performed after the treatment. The results showed that compared with the WT group, the levels of p-Akt and p-S6 in neurons of Gαi1 / 3DKO mice decreased, and Syn3 could not reverse the decrease in Akt and S6 phosphorylation in Gαi1 / 3DKO neurons ( Figure 11 ).

[0110] Finally, immunofluorescence detection of Akt signals in the growth cones of the above treatments was performed. The results showed that the phosphorylation level of Akt in the growth cones of neurons in the Gαi1 / 3DKO group of mice was reduced, and Syn3 could not reverse the reduction of Akt phosphorylation in the growth cones of Gαi1 / 3DKO mice ( Figure 12 These results confirmed that Gαi1 / 3 is a key protein in Syn3-enhanced BDNF-induced downstream Akt-mTOR activation.

[0111] Example 7

[0112] Knockdown of Gαi1 / 3 in primary mouse spinal cord neurons inhibited BDNF+Syn3-induced downstream signaling activation.

[0113] Cultured primary mouse spinal cord neurons were transfected with lentivirus encoding Gαi1 shRNA and Gαi3 shRNA to knock down the expression of Gαi1 / 3 (s1 / s2, each containing two different sequences). The shC group was transfected with a lentivirus encoding a nonsense shRNA, while the control group was cultured normally. The sequence of the Gαi1 shRNA, SEQ ID NO: 1, is AAGGTGCTGTTCGTAATCCTA (5'-3'), and the sequence of the Gαi3 shRNA, SEQ ID NO: 2, is AAGCTGGTCAACATCATCAAA (5'-3'). Three days after transfection, shC, shGαi1 / 3s1, and shGαi1 / 3s2 primary mouse spinal cord neurons were pretreated with Syn3 (0.2 μM) for 20 minutes and then treated with BDNF (25 ng / mL) for 20 minutes. Protein was extracted and analyzed by Western blot. The results showed that compared with the shC group, the expression of Gαi1 and Gαi3 proteins in primary mouse spinal cord neurons in the shGαi1 / 3s1 and s2 groups was significantly reduced, while there was no significant difference in Gαi2 protein ( Figure 13 A and CE in ).

[0114] The activation of BDNF receptor TrkB was then detected. The results showed that compared with the shC group, the phosphorylation level of TrkB in primary spinal cord neurons in the shGαi1 / 3s1 and shGαi1 / 3s2 groups did not change significantly ( Figure 13 Finally, the activation levels of Akt and S6K downstream of BDNF were detected. The results showed that compared with the shC group, the phosphorylation of Akt and S6K induced by BDNF+Syn3 in the shGαi1 / 3s1 and shGαi1 / 3s2 groups was significantly decreased ( Figure 13 B, G, H in ).

[0115] Example 8

[0116] Knockdown of PSD95 in primary mouse spinal cord neurons inhibits BDNF+Syn3-induced downstream signaling activation.

[0117] PSD95 is a key protein that promotes the formation of the TrkB-Gαi1 / 3 signaling complex. Syn3 binds to the PDZ3 domain of PSD95, enhancing Akt-mTOR signaling downstream of BDNF. Here, we investigated whether PSD95 mediates Syn3-enhanced BDNF signaling.

[0118] Primary mouse spinal cord neurons were cultured and transfected with lentivirus encoding PSD95 shRNAs (s1 / s2, representing two different sequences) to knock down PSD95 expression (shPSD95 s1 / shPSD95 s2). A control group was transfected with a lentivirus encoding a nonsense shRNA (shC). The sequence of PSD95 shRNA-s1 (SEQ ID NO: 3) is AAGACCAUCGAGUACUUCAUC (5'-3'), and the sequence of PSD95 shRNA-s2 (SEQ ID NO: 4) is AAGGUCAAGUUCGAGCAGUUC (5'-3'). Three days after transfection, primary mouse spinal cord neurons expressing shC, shPSD95 s1, and shPSD95 s2 were pretreated with Syn3 (0.2 μM) for 20 minutes and then treated with BDNF (25 ng / mL) for 20 minutes. Proteins were extracted and analyzed by Western blot. The results showed that compared with the shC group, the expression level of PSD95 protein in primary mouse spinal cord neurons in the shPSD95 s1 group and shPSD95 s2 group was significantly reduced, confirming that viral transfection successfully reduced the expression of PSD95 ( Figure 14 A and C in ).

[0119] Subsequently, the activation of the BDNF receptor TrkB was detected. The results showed that compared with the shC group, the phosphorylation of TrkB and the expression level of TrkB induced by BDNF+Syn3 in primary mouse spinal cord neurons in the shPSD95 s1 group and shPSD95 s2 group did not change significantly (A and D in 14). Finally, the phosphorylation levels of downstream Akt and S6K induced by BDNF+Syn3 were detected. The results showed that compared with the shC group, the phosphorylation levels of Akt and S6K induced by BDNF+Syn3 in primary mouse spinal cord neurons in the s1 group and s2 group were significantly decreased, while the total protein expression of Akt and S6K did not change significantly ( Figure 14 B and E in ).

[0120] Example 9

[0121] Effect of Syn3 on the TrkB-PSD95-Gαi1 / 3 signaling complex.

[0122] Neurons were pretreated with Syn3 (0.2 μM) for 20 minutes and then treated with BDNF (25 ng / ml) for 5 minutes. Immunofluorescence co-labeling of the treated cells showed that the location of TrkB and Gαi1 / 3 co-expression increased after BDNF treatment, and Syn3 treatment further increased the location of TrkB and Gαi1 / 3 co-expression. Syn3 treatment alone had no effect on the co-expression of TrkB and Gαi1 / 3 ( Figure 15 ).

[0123] Protein lysates from the cells treated above were collected and immunoprecipitated to detect protein interactions. The results showed that after BDNF treatment, Gαi1 / 3, PSD95, and TrkB interacted to form a complex (TrkB-PSD95-Gαi1 / 3). Syn3 pretreatment further enhanced BDNF-induced interaction and complex formation of Gαi1 / 3, PSD95, and TrkB ( Figure 16 In addition, the “Input” results showed that Syn3 combined with BDNF treatment or BDNF treatment alone did not affect the expression of Gαi1, Gαi3, PSD95 and TrkB proteins.

[0124] Example 10

[0125] Syn3 penetrates the blood-spinal cord barrier.

[0126] A fluorescent group AlexaFluor488 (AF488) was conjugated to the amine group of Syn3 cysteine ​​and named Syn3-AF488 ( Figure 17A) in FIG. 1. Syn3-AF488 was injected into wild type mice by intraperitoneal injection, and green fluorescence was observed in the spinal cord region of mice by laser confocal 6h later. This indicates that Syn3 can pass through the blood-spinal cord barrier Figure 17 B) in FIG. 1.

[0127] Example 11

[0128] Syn3 promotes the recovery of hindlimb motor function in mice after spinal cord injury.

[0129] BMS motor function scores were performed on Syn3 group and Vehicle group spinal cord injury mice at 0, 1, 3, 7, 14, 21, 28, 35 and 42d after operation, and the results showed that the BMS scores of mice in both groups gradually increased, and the BMS scores of Syn3 treated mice increased faster, and at 35 and 42d after operation, the BMS scores of Syn3 treated group were significantly higher than those of Vehicle group Figure 18 A) in FIG. 1. Subsequently, the effect of Syn3 treatment on hindlimb muscle strength in spinal cord injury mice was evaluated, and footprint analysis was performed at 42d after SCI, and the results showed that Syn3 treated group appeared foot palm landing at 42d, and Vehicle group mice were all foot dorsum landing Figure 18 D) in FIG. 1.

[0130] Further evaluation of the effect of Syn3 treatment on the gait and motor coordination ability of SCI mice, 42d after operation, the hip joint, knee joint, ankle joint and foot joint of the right hindlimb of mice were marked with white small discs, and the movement video within a single step was captured by camera, and the movement trajectory was reconstructed Figure 18 B) in FIG. 1, and the results showed that mice in Vehicle group all caused dragging phenomenon due to too long limb extension time, while 3 mice in Syn3 treated group recovered the ability to continuously walk with the hindpaw sole, and the hindlimb could be lifted off the ground during walking Figure 18 C) in FIG. 1. Adobe Photoshop was used to stack the representative frame number of mouse movement video, and the results also showed that Syn3 treated spinal cord injury mice could partially recover the ability to walk with the sole Figure 18 E) in FIG. 1. The above results all indicate that Syn3 treatment increases the recovery of hindlimb motor function in mice.

[0131] Example 12

[0132] Syn3 promotes the recovery of urinary retention and spinal cord tissue defect in mice after spinal cord injury.

[0133] The results of hindlimb nerve electrophysiology examination of Syn3 group and Vehicle group mice showed that the amplitude of evoked action potential in the hindlimb of Syn3 treated mice increased significantly, and the latency decreased significantly Figure 19The thickness of the bladder detrusor muscle and bladder capacity were used as indicators to evaluate the recovery of urinary retention after spinal cord injury. The results showed that the thickness of the bladder detrusor muscle increased and the bladder capacity decreased in the Syn3 treatment group, and the differences were statistically significant. Syn3 treatment significantly improved urinary retention caused by spinal cord injury ( Figure 20 ).

[0134] Example 13

[0135] Syn3 treatment reduces the size of the damaged area after spinal cord injury in mice.

[0136] In order to test the effect of Syn3 on tissue healing after spinal cord injury, the spinal cord tissue structure was first observed. There was no obvious tissue morphological structure defect in both groups. H&E staining results showed that the spinal cord injury area in the Syn3 treatment group was significantly reduced ( Figure 21 ).

[0137] Example 14

[0138] Syn3 promotes axon regeneration in the corticospinal and raphe spinal tracts after spinal cord injury

[0139] Cell experiments have confirmed that Syn3 can promote axon regeneration. In this section, we explored the effect of Syn3 on axon regeneration in vivo after spinal cord injury. First, we verified the effect of Syn3 treatment on all axons in the spinal cord. We performed immunofluorescence staining of GFAP, NF200, and Tuj-1 on sections of spinal cord injured mice. The results showed that the number of NF200 and Tuj-1 positive axons in the Syn3 treatment group was significantly increased compared with the vehicle group ( Figure 22 Subsequently, corticospinal tract tracing was performed on mice in the Syn3 and Vehicle groups. AAV9-hSyn-EGFP was injected into the motor cortex of the mice 28 days after spinal cord injury according to the coordinates (0 / 1.5mm, -0.5 / 1.5mm, and -1.0 / 1.5mm). The spinal cord was removed after perfusion 2 weeks later. The results showed that the axons in the corticospinal tract of the Vehicle group mice failed to penetrate the central area of ​​the injury, while a small number of axons in the corticospinal tract of the Syn3 treatment group penetrated the central area of ​​the spinal cord injury ( Figure 23 ).

[0140] Six weeks after spinal cord injury, immunofluorescence co-staining of 5-HT and motor neuron marker protein Chat was used to assess the growth of 5-HT-ergic axons in the raphe spinal tract. The results showed that compared with the mice in the Vehicle group, the regeneration of 5-HT-ergic axons in the caudal side of the injury in the Syn3-treated mice was significantly increased. Spinal cord transection results showed that the density of 5-HT-ergic axons around the motor neurons in the caudal ventral horn of the injury site in the Syn3-treated mice was significantly increased ( Figure 24The above results indicate that intraperitoneal injection of Syn3 can promote axon regeneration after spinal cord injury. The regenerated axons cross the injured area to reach the innervated motor neurons and establish synaptic connections, promoting functional improvement in mice with spinal cord injury.

[0141] Example 15

[0142] Syn3 enhances the activation of Akt-mTOR signaling downstream of BDNF in neurons after spinal cord injury in mice

[0143] To investigate whether Syn3 promotes axon regeneration by activating Akt-mTOR signaling downstream of BDNF, proteins from spinal cord tissues of the Vehicle and Syn3 treatment groups 42 days after SCI were extracted and immunoblotting was performed. The results showed that compared with the Vehicle group, the phosphorylation of Akt and S6 in the Syn3 treatment group after spinal cord injury was significantly increased ( Figure 25 The spinal cord tissues of the above treatment groups were taken out for immunofluorescence staining. The results further confirmed that Syn3 upregulated the levels of p-Akt and p-S6 in spinal cord neurons ( Figure 26 Finally, brain tissues from the treatment group were removed and sliced ​​for immunofluorescence staining. It was also found that Syn3 treatment significantly increased the phosphorylation of Akt and S6 in motor cortical neurons ( Figure 27 These results confirm that Syn3 promotes axon regeneration after spinal cord injury by activating the Akt-mTOR pathway in neurons.

[0144] The experimental principle is obtained by sorting out the above examples 1 to 15. Figure 28 .

[0145] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Application of Syn3 in the preparation of drugs for treating spinal cord injury.

2. The application according to claim 1, characterized in that The medicine is a liquid preparation; The concentration of the Syn3 solution in the drug is 0.1-0.5 μM, and the dosage of the Syn3 is 0.5-2 mg / kg.

3. The application according to claim 2, characterized in that: The method of using Syn3 includes injection.

4. The application according to claim 1, characterized in that The treating spinal cord injury includes improving urinary retention caused by spinal cord injury.

5. The application according to claim 1, characterized in that: The treatment of spinal cord injury includes promoting the recovery of hind limb motor function caused by spinal cord injury.

6. Use of Syn3 in the preparation of a reagent for promoting neuronal axon regeneration, characterized in that: The concentration of Syn3 in the reagent is 0.2-2.0 μM.