Application of hepatocyte growth factor in preparation of reagent for treating and / or preventing cancer

Abstract

The invention relates to the field of cancer treatment, in particular to application of a hepatocyte growth factor in preparation of a reagent for treating and / or preventing cancers. More specifically, the invention relates to application of the hepatocyte growth factor in preparation of a reagent for treating and / or preventing cancer metastasis. The invention provides an application of a hepatocyte growth factor in preparation of a reagent for treating and / or preventing cancers, which is characterized in that the cancers are accompanied by lymph node metastasis and nerve remodeling.

Description

Technical Field

[0001] The present invention relates to the field of cancer treatment, and in particular, to the use of hepatocyte growth factor in preparing a reagent for treating and / or preventing cancer. More particularly, it relates to the use of hepatocyte growth factor in preparing a reagent for treating and / or preventing cancer metastasis. Background Art

[0002] The progression of malignant tumors is often accompanied by lymph node (LN) metastasis, and this pathological feature has been shown to be significantly negatively correlated with patient prognosis. Currently, clinical treatment mainly involves combined resection of primary and metastatic lymph nodes. However, due to the limited sensitivity of lymphatic system imaging technology and the accuracy of metastasis detection methods, intraoperative lymph node dissection faces a dilemma: incomplete resection is prone to tumor recurrence, while excessive dissection will destroy the structural integrity of the lymphatic network, thereby inducing immune homeostasis imbalance and increasing the risk of complications such as postoperative lymphocytic cysts, infection, and refractory lymphedema. It is worth noting that some clinical studies have shown that expanding the scope of lymph node dissection does not significantly improve the overall survival of patients, which highlights the urgent need to develop new targeted treatment strategies.

[0003] There is a need in the art for new therapeutic strategies, particularly for the treatment of cancer metastasis. Summary of the Invention

[0004] In view of this, in a first aspect, the present invention provides use of hepatocyte growth factor in preparing an agent for treating and / or preventing cancer, wherein the cancer is accompanied by lymph node metastasis and neural remodeling.

[0005] According to the present invention, the hepatocyte growth factor (HGF) gene is derived from mice, and its Genbank accession number is NM_001289458.

[0006] Furthermore, the reagent is an HGF gene inhibitor.

[0007] According to the present invention, the HGF gene inhibitor preferably refers to a molecule or preparation prepared or screened with the HGF gene as the target, which has an inhibitory effect on the HGF gene. The inhibitory effect includes but is not limited to: inhibiting HGF gene activity, or inhibiting HGF gene transcription or expression.

[0008] In some specific embodiments, the inhibitor acts by blocking HGF-mediated activation of fibroblastic reticular cells (FRCs) and sympathetic nerve fiber growth.

[0009] According to the present application, preferably, the HGF gene inhibitor is selected from one or more of the following: a nucleic acid molecule, a nucleic acid construct, a lentivirus, an antibody or a small molecule compound.

[0010] Further preferably, the nucleic acid molecule is a double-stranded RNA or an shRNA.

[0011] Further preferably, the HGF gene target sequence on which the nucleic acid molecule acts is as shown in SEQ ID NO: 9.

[0012] In a specific embodiment, the HGF gene target sequence is: CTTCGAGCTATCGCGGTAAAG (SEQ ID NO: 9).

[0013] Further preferably, the nucleotide sequence of the shRNA is as shown in SEQ ID NO: 10.

[0014] In a specific embodiment, the nucleotide sequence of the shRNA is (SEQ ID NO: 10):

[0015] GAATTCCTTCGAGCTATCGCGGTAAAGTTCAAGAGACTTTACCGCGATAGCTCGAAGTTTTTTGGATCC.

[0016] Further preferably, the small molecule compound is Norleual TFA or SRI 31215.

[0017] According to the present application, the agent for treating cancer has one or more of the following functions:

[0018] 1. Inhibiting FRCs activation induced by tumor cells; 2. Reducing ECM stiffness and collagen deposition; 3. Blocking HGF-mediated sympathetic nerve fiber extension; 4. Delaying lymph node metastasis and tumor progression.

[0019] According to the present application, preferably, the therapeutic drug for cancer must include the HGF gene inhibitor, and the HGF gene inhibitor is the only effective component or one of the effective components for the aforementioned functions.

[0020] According to the present application, the cancer is colorectal cancer (CRC) or other solid tumors accompanied by lymph node metastasis.

[0021] In a second aspect, a nucleic acid molecule is provided, which is an HGF gene inhibitor and can reduce the expression of the HGF gene in pancreatic cancer cells, comprising:

[0022] a) a double-stranded RNA containing a nucleotide sequence capable of hybridizing to the HGF gene under stringent conditions; or

[0023] b) shRNA, wherein the shRNA contains a nucleotide sequence capable of hybridizing to the HGF gene under stringent conditions.

[0024] According to the present invention, the double-stranded RNA comprises a first chain and a second chain, the first chain and the second chain are complementary to each other to form an RNA dimer, and the sequence of the first chain is identical to the HGF gene target sequence; the shRNA comprises a sense chain fragment and an antisense chain fragment, and a stem-loop structure connecting the sense chain fragment and the antisense chain fragment, the sequences of the sense chain fragment and the antisense chain fragment are complementary, and the sequence of the sense chain fragment is identical to the HGF gene target sequence.

[0025] According to the present invention, preferably, the double-stranded RNA is small interfering RNA (siRNA).

[0026] According to the present invention, preferably, the nucleotide sequence of the shRNA is shown as SEQ ID NO: 10.

[0027] According to the present invention, the shRNA can be converted into siRNA after enzyme cleavage and processing, thereby playing a role in specifically silencing the expression of HGF gene in pancreatic cancer cells.

[0028] The third aspect of the present invention provides a nucleic acid construct, which is an HGF gene inhibitor, contains a gene segment encoding the shRNA in the aforementioned nucleic acid molecule, and can express the shRNA.

[0029] According to the present invention, preferably, the nucleic acid construct is obtained by cloning the gene fragment encoding the shRNA in the aforementioned nucleic acid molecule into a vector.

[0030] According to the present invention, preferably, the vector is a lentiviral vector.

[0031] According to the present invention, preferably, the nucleic acid construct further contains a promoter sequence and / or a nucleotide sequence encoding a marker that can be detected in tumor cells; further preferably, the detectable marker is green fluorescent protein (GFP).

[0032] The HGF gene interfering nucleic acid construct is packaged into infectious viral particles and then infects tumor cells, thereby transcribing the shRNA of the present invention. After enzymatic processing and other steps, siRNA is finally obtained for specifically silencing the expression of the HGF gene.

[0033] In a fourth aspect, the present invention provides a lentivirus, which is an HGF gene inhibitor and is produced by viral packaging of the aforementioned nucleic acid construct with the assistance of a lentiviral packaging plasmid and a cell line.

[0034] In a fifth aspect, the present invention provides a pharmaceutical composition comprising an effective amount of an HGF inhibitor and a pharmaceutically acceptable carrier.

[0035] In some specific embodiments, the HGF inhibitor is a nucleic acid molecule, a nucleic acid construct, a lentivirus, an antibody, or a small molecule compound.

[0036] More preferably, the nucleic acid molecule is double-stranded RNA or shRNA.

[0037] Further preferably, the HGF gene target sequence acted by the nucleic acid molecule is shown in SEQ ID NO:9.

[0038] Further preferably, the nucleotide sequence of the shRNA is shown in SEQ ID NO: 10.

[0039] More preferably, the small molecule compound is Norleual TFA or SRI 31215.

[0040] According to the present invention, preferably, the HGF gene inhibitor is the only active ingredient or one of the active ingredients that inhibits tumor-related neural remodeling and lymph node metastasis.

[0041] The form of the drug for inhibiting tumor-related neural remodeling and lymph node metastasis is not particularly limited and may be in the form of a solid, liquid, gel, semi-fluid, or aerosol. The dosage form of the drug is any clinically or pharmaceutically acceptable dosage form. For example, but not limited to, the dosage form of the drug is a powder, injection, capsule, oral solution, tablet, pill, or spray.

[0042] Furthermore, the pharmaceutical composition also includes instructions.

[0043] Furthermore, the instructions contain information on the use of the drug for treating and / or preventing cancer, for example, the effective amount of the drug required for treating cancer, the number of times of administration, the interval time, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 ab. Images of the PLN on days 0, 1, 2, 3, 5, 7, and 10 after footpad inoculation of tumor cells (a) and counts (b). Scale bar: 2 cm. c. 3D images of PLN DBH-EGFP-positive sympathetic nerve fibers on days 0, 1, 2, 3, 5, 7, and 10 after tumor cell inoculation. Scale bars: upper - 300 μm; lower - 100 μm. de. Statistical results of nerve fiber length (d) and nerve branch number (e) of DBH-P2A-EGFP-positive nerve fibers. All nerve fibers were counted in each image.

[0045] Figure 2 a. SnRNA-seq analysis was performed to investigate the correlation between stromal cells, immune cells and nerves in PLN; b. t-SNE image map of different cell subpopulations in PLN; c. According to snRNA-seq data, the total number of cells in PLN was divided into 12 cell subpopulations; d. The number of FBs, MRCs, LECs and BECs in snRNA-seq data; e. Markers used for classification of different cell subpopulations in PLN; f. The proportion of cell subpopulations such as FBs, MRCs, LECs and BECs; g. GO-BP analysis of different cell subpopulations in single cell sequencing data; h-i. GO analysis of the correlation between FBs (h) / MRCs (i) and nerve signaling pathways; j. Screening process of nerve growth factors, neurotrophic factors and other nerve-related factors in single cell sequencing data (2.5 days vs. 0 days, P < 0.05, |log2FC| > 0.2) k. HGF expression in different cell subpopulations in PLN; l-m. t-SNE image map (l) showing the expression of HGF in different cell subpopulations. HGF is highly expressed in FBs / MRCs and is considered to be closely related to nerve fiber growth (m).

[0046] Figure 3 a-b. HGF concentration and relative mRNA expression level in FRCs supernatant treated with MC38 cell medium or control, 48 hours, at least 5 replicates per group; c-f. PC12 cell images after 48 hours of treatment with primary FRCs / MC38 cell medium or control, Norleual TFA or SRI 31215 was added to PC12 cells (c, d), the right side shows the statistical results of nerve fiber length (e) and TH positive nerve fiber length (f), scale bar: 20 μm (c), count all PC12 cells per group; scale bar: 12 μm (d), count at least 5 PC12 cells per group, at least 5 replicates of experiments per group.

[0047] Figure 4a-c. 3D images of DBH-P2A-EGFP positive sympathetic nerve fibers in PLNs treated with HGF inhibitor or solvent, AAV or negative control (NC), 7 days after inoculation of MC38 cells, scale bar: 100 pm, and, statistical analysis of nerve fiber length and number of nerve branches in 3D images of DBH-P2A-EGFP positive sympathetic nerve fibers in PLNs after treatment with HGF inhibitor or solvent, AAV or NC (c), all nerve fibers in each image were counted; d. photographs of PLNs treated with HGF inhibitor or solvent, AAV or NC, 7 days after inoculation of MC38 cells (k), statistical results are shown below (l), scale bar: 3 mm. Each group was repeated at least 4 times; e. IHC staining showing the expression of a-SMA in lymph nodes treated with HGF inhibitor or solvent, AAV or NC, 7 days after inoculation of MC38 cells. Statistical results are shown on the right, scale bar: 100 pm, each experiment was repeated at least 4 times; f. IHC staining of panCK in PLNs treated with HGF inhibitor or solvent, AAV or NC, 7 days after inoculation of MC38 cells. Statistical results are shown on the right. Scale bar: 100 pm, each group was repeated at least 4 times. DETAILED DESCRIPTION

[0048] The advantages and various effects of the present application will be more clearly apparent from the following specific embodiments and examples. Those skilled in the art will understand that these specific embodiments and examples are used to illustrate the present application, but not to limit the present application.

[0049] If not specifically stated, all embodiments and optional embodiments in the present application can be combined to form new technical solutions. If not specifically stated, all technical features and optional technical features in the present application can be combined to form new technical solutions. If not specifically stated, all steps in the present application can be performed in sequence or randomly, preferably in sequence. For example, the method comprises steps (a) and (b), which means that the method can comprise steps (a) and (b) performed in sequence, or steps (b) and (a) performed in sequence. For example, the method can further comprise step (c), which means that step (c) can be added to the method in any order, for example, the method can comprise steps (a), (b) and (c), or steps (a), (c) and (b), or steps (c), (a) and (b), etc.

[0050] If not specifically stated, the terms used in the present application have the commonly understood meanings understood by those skilled in the art.

[0051] The purpose of the terms used herein is only to describe specific embodiments and is not intended to limit the present disclosure. When used herein, the singular forms "a", "an", and "the" are intended to include the plural forms, unless the context clearly indicates otherwise. It should also be understood that the terms "comprising" and / or "comprising", when used in this specification, determine the presence of the features, integers, steps, operations, elements and / or parts, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, parts and / or groups. When used herein, the term "and / or" includes any and all combinations of the relevant listed items.

[0052] In the description of this article, it should be noted that, unless otherwise specified, “above” and “below” are inclusive of the number themselves, and “a variety” in “one or more” means more than two.

[0053] Lymph nodes, as secondary lymphoid organs, undergo dynamic remodeling regulated by both sympathetic and sensory nerves. Tumor invasion can induce pathological lymph node expansion, accompanied by activation of fibroblastic reticular cells (FRCs) and microenvironmental remodeling. Studies have shown that FRCs play a key role in maintaining lymph node structural stability by secreting extracellular matrix (ECM) and regulating matrix stiffness. However, the adaptive regulatory mechanisms between the nervous system and the microenvironment during lymph node expansion remain largely unknown.

[0054] Hepatocyte growth factor (HGF), a multifunctional cytokine, is gaining increasing attention for its role in the tumor microenvironment. Through the c-Met receptor, HGF not only participates in angiogenesis and epithelial-mesenchymal transition, but there is also evidence that the HGF / c-Met axis can specifically activate neural remodeling and promote peripheral neural invasion in pancreatic cancer. Notably, the therapeutic value of the HGF signaling pathway in neural remodeling and lymph node metastasis has not been fully explored, and the regulatory mechanisms involved are also lacking systematic research.

[0055] Building on this research gap, this study reveals for the first time the central regulatory role of the HGF signaling pathway in tumor-induced adaptive neural remodeling in lymph nodes. By specifically inhibiting HGF activity, it effectively blocks the abnormal growth of tumor-associated nerve fibers, thereby inhibiting the formation of a pre-metastatic microenvironment and pathological lymph node expansion. This discovery provides a precise therapeutic approach that combines anti-tumor metastasis with lymphatic system protection.

[0056] In the present invention, "prevention and / or treatment" means preventing and / or delaying the occurrence of a disease or condition or normalizing it.

[0057] Example 1. Materials and methods used in the present invention

[0058] Cell culture

[0059] MC38 and PC12 cells were purchased from the American Type Culture Collection (ATCC, USA) and cultured in Dulbecco's Modified Eagle Medium (L110KJ, China) supplemented with 10% (v / v) fetal bovine serum (DCF-201-0500, Dcell, China) and 1% penicillin / streptomycin (S110JV, Basal Media, China) in a humidified incubator at 37°C and 5% carbon dioxide. Serum-free solution (YC0100, Yoche Biotechnology, Shanghai, China) was used for cell cryopreservation.

[0060] Real-time qPCR

[0061] Using ViiA TM qPCR reactions were performed using the SYBR Green qPCR Master Mix Kit (G3326, Applied Biosystems, USA). The reactions were performed according to the protocol of the 2× Universal Blue SYBR Green qPCR Master Mix Kit (G3326, CyberBio, China). Real-time PCR analysis was performed on a 7500 Real-Time PCR System (Applied Biosystems, USA) using the recommended thermal cycle settings: initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. Relative mRNA expression was calculated using the 2(-ΔΔCt) method and normalized to 18S mRNA levels. The primer list is shown in Table 1 below.

[0062] Table 1

[0063]

[0064]

[0065] Enzyme-linked immunosorbent assay (ELISA)

[0066] Remove the desired ELISA plate (PCDBM0133, PC-biotech, Shanghai, China) and equilibrate to room temperature. Add 50 μL of standard sample of varying concentrations to the standard wells. Add 50 μL of test sample to the remaining wells. After incubation at 37°C for 90 minutes, add 350 μL of wash buffer to each well and let stand for 1 minute. Shake off the wash buffer and blot dry with absorbent paper. Repeat this process three times.

[0067] Then, 100 μL of biotin-labeled detection antibody was added to each well, and the reaction wells were covered with sealing film. After incubation at 37°C for 60 minutes, the liquid was discarded and each well was washed three times with 350 μL of washing solution.

[0068] Subsequently, 100 μL of horseradish peroxidase (HRP)-labeled detection antibody was added to each well. The reaction wells were covered with a sealing film. After incubation at 37°C for 30 minutes, the liquid was discarded. Each well was washed 5 times with 350 μL of washing solution. Finally, 50 μL of TMB solution was added to each well. After incubation at 37°C in the dark for 15 minutes, the sealing film was removed and 50 μL of stop solution was added to each well. The OD value of each well was measured at a wavelength of 450 nm. The reaction curve was fitted using a four-parameter equation, and the sample concentration was calculated based on the OD value.

[0069] animal

[0070] Male C57BL / 6J mice (6-8 weeks old) were purchased from Jima Pharmaceutical Co., Ltd. in Nanjing, Jiangsu Province. Mice were housed and handled according to protocols approved by the Analytical Testing Center of the Laboratory Animal Center of Shanghai Jiao Tong University. All animals received humane care in accordance with the standards of the "Guide for the Care and Use of Laboratory Animals" prepared by the National Academy of Sciences, which is published by the National Institutes of Health (NIH). All experiments were repeated at least three times.

[0071] DBH-P2A-EGFP and CALCA-P2A-BFP mice

[0072] The DBH-P2A-EGFP and CALCA-P2A-BFP mice used in this study were designed and manufactured by Jiangsu Nanjing Jima Pharmaceutical Co., Ltd. The housing and handling of mice followed protocols approved by the Laboratory Animal Center of the Analytical and Testing Center of Shanghai Jiao Tong University.

[0073] Mouse footpad model

[0074] MC38 cells (4 × 10 per mouse) were injected into the left / right footpads of C57BL / 6J mice. 6 A mouse model of CRC cell lymphatic metastasis was established using a 24-well plate (100 cells / 25 μL) MC38 cell-injected mouse model. On days 0, 1, 2, 3, 5, 7, and 10 after tumor cell inoculation, mice in the MC38 cell-injected group were sacrificed by spinal dislocation under carbon dioxide anesthesia, and lymph node (LN) tissue was collected. Some mice developed metastatic tumors in various regional lymph nodes, including the popliteal and inguinal lymph nodes.

[0075] To investigate the function of HGF, Norleual TFA or AAV was injected into the popliteal fat pad of mice 6 hours before MC38 cell inoculation and every 3 days thereafter (day 0, day 3, day 6). PLNs were collected on days 5 and 7 and cleared using HYBRiD.

[0076] Sample pretreatment

[0077] C57BL / 6J mice were anesthetized with 2% isoflurane. Lymph nodes were collected from C57BL / 6J mice after sacrifice by cervical dislocation and fixed in 4% paraformaldehyde overnight at 4°C. Fixation should not exceed two days. After fixation, samples were stored in 1× PBS containing 0.02% sodium azide.

[0078] Preparation of tissue clearing agent

[0079] In a fume hood, N,N,N',N'-tetrakis(2-hydroxypropyl)ethylenediamine (122262, Sigma, USA) was diluted to a final concentration of 25% as a decolorization buffer using 10× PBS (70011044, Thermo Fisher Scientific, USA) and distilled water and stirred with a magnetic stirrer. The mixture was stored at room temperature in the dark. A concentration gradient of 50%, 70%, 80%, and 95% THF was prepared using decolorization buffer and THF (T103264, Aladdin, China), mixed thoroughly, and stored at 4°C. 1× PBST was prepared as a wash buffer using 0.1% Tween-20 (T8220, Solarbio, China) and 0.02% sodium azide. 1× PBST was prepared as a staining buffer using 0.2% Triton X-100 (T8200, Solarbio, China).

[0080] Tissue clearing

[0081] Initially, the samples were washed three times with 1× PBS to remove residual formaldehyde, with each wash lasting at least 1 hour. Subsequently, the samples were placed in decolorization buffer and placed on a shaker at 37°C for 2 days for decolorization. The decolorization solution was changed once a day. If the decolorization solution changes color, the decolorization time should be extended. After the decolorization stage, the samples were thoroughly washed three more times, each using 1× PBS for one hour each. The samples were placed in 50% THF, 70% THF, 80% THF and 95% THF solutions in sequence and placed on a shaker at 4°C for at least 30 minutes for tissue clearing. Subsequently, the samples were placed in 100% dichloromethane (270997, Sigma, USA) solution and shaken at 4°C for 60 minutes. The 100% dichloromethane solution was replaced and the process was repeated once. The samples were sequentially placed in 95% THF, 80% THF, 70% THF, and 50% THF, then placed on a shaker at 4°C for at least 30 minutes per gradient to clear the tissue. The samples were washed three times with 1× PBS for one hour each. Prior to imaging, the samples were placed in Easy Index (RI = 1.52, Cat. No.: EI-500-1.52, Lifecanvas Technologies, USA) and shaken overnight at 37°C. The following day, the samples were placed on a shaker at room temperature to match the refractive index.

[0082] Sample staining

[0083] Prepare a 5% bovine serum albumin (BSA, 4240GR005, Biofroxx, Germany) solution using sterile 1× PBS and use immediately. For samples labeled for staining, postpone refractive index matching. After tissue clearing, incubate the samples in a 5% BSA solution overnight on a shaker at 4°C. Subsequently, the LN samples were washed with 1× PBS at room temperature for one hour, repeated three times. Prepare an antibody solution diluted in 1× PBST. The antibodies used in the experimental protocol include tyrosine hydroxylase (TH) (ab112, Abcam, USA), PGP9.5 (PA5-29012, Invitrogen, USA) and NFL (MA5-14981, Invitrogen, USA). Each sample was immersed in 200 μL of antibody solution and incubated at 37°C on a shaker for 7 days.

[0084] After the incubation period, the samples were washed with 1× PBS at room temperature, and then washed once with 1× PBS at room temperature three times for 1 hour each. Finally, the samples were placed in 200 μL of secondary antibody solution and incubated at 37°C for 7 days.

[0085] Thin-section fluorescence microscopy (LSFM) imaging

[0086] A low-melting-point agarose (A600015, BBI, China) solution was prepared at a concentration range of 1% to 2% using EasyIndex. The solution was then heated in a microwave oven until the agarose was completely melted, removing all air bubbles. The melted agarose was then kept at a constant temperature by placing it in an oven set at 65°C.

[0087] After carefully cleaning the slide with absolute ethanol, carefully drop the agarose solution onto the clean slide, taking care not to create bubbles. Then, use precision tweezers to neatly place the sample on the slide.

[0088] At the final stage, LN samples were captured using a 9× objective (voxel size 0.72 μm) on a MegaSPIM light-sheet microscope (LifeCanvas Technologies, USA), ensuring uniform laser intensity across all samples.

[0089] Image processing and quantification

[0090] 3D reconstruction was performed using Imaris 10.1 (Oxford Instruments, UK). Data were imported into Imaris for processing. Regions with positive target signal were segmented using the Surface module for each channel of the sample. These segments were connected using the Threading module. Thread segment length (sum) and thread number and segment branch point data were exported from Imaris for quantification.

[0091] Immunofluorescence (IF) staining

[0092] For immunofluorescence staining of cells, 2 × 10 3 Cells were seeded into 24-well plates at 4% paraformaldehyde per well. Cells were then fixed with 4% paraformaldehyde and blocked with PBS containing 5% bovine serum albumin. The cells were then incubated with primary antibodies against TH (ab112, Abcam, USA) and β-III tubulin (GB12139-100, Servicebio, China), followed by secondary antibody incubation. Nuclear staining was performed using DAPI (C0060, Solarbio, China) for 10 minutes at room temperature.

[0093] For tissue immunofluorescence staining, paraffin sections were dewaxed with graded ethanol and antigen retrieval was performed in citrate buffer. Sections were then blocked with 5% BSA for 1 hour and incubated overnight at 4°C with primary antibodies against TH (ab112, Abcam, USA) and NFL (MA5-14981, Invitrogen, USA) at the recommended dilutions. The following day, secondary antibodies were incubated for 1 hour at room temperature. Finally, cell nuclei were counterstained with DAPI for 5 minutes. Digital images were captured using a confocal microscope (Leica, Germany).

[0094] Single-nucleus RNA sequencing (snRNA-seq)

[0095] SnRNA-seq was performed according to the experimental procedures of Shanghai Bohao Biotechnology Co., Ltd. (Bohao, China). The data were preprocessed and normalized to avoid affecting the overall cell classification results. After integrated analysis of multiple samples, the normalized data were clustered and visualized using the Louvain algorithm. t-SNE was used to reduce the high-dimensional data to 2 or 3 dimensions for single-cell data visualization. Then, the single-cell sequencing cell type annotation software SingleR was used in combination with marker genes to annotate cell types. SingleR selected single-cell RNA sequencing data as a reference library, selected genes with large variations between different cell types in the reference database, and then calculated the correlation between the predicted cells and the reference database. By continuously eliminating the cell types with the worst correlation and calculating the correlation in a cyclic manner, a preliminary annotation of the predicted cell types was obtained. Next, referring to previous studies, unique characteristic genes of each cell subpopulation were identified, and various cells in the single-cell RNA sequencing results were classified in detail.

[0096] Primary FRC isolation

[0097] Draining lymph nodes were collected from 10 4-week-old mice, washed twice with 4°C sterile PBS, and then carefully minced into approximately 1 mm pieces using sterile scissors. 3 The fragments were then digested in 1 ml of 0.2 mg / ml collagenase P (11213865001, Roche, USA) at 37°C for 50 min. To ensure adequate digestion, the mixture was stirred every 10 min. After the initial digestion, the digestion solution was aspirated using a 1 ml pipette tip for 1 min, the larger undigested tissue fragments were allowed to settle for another 1 min, and the supernatant was then collected. The supernatant was then diluted in a 1:1 ratio with pre-chilled (4°C) Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12 (DMEM / F-12) (1:1) (L310KJ, Basic Culture Medium, China) containing 10% fetal bovine serum (FBS) and 1% antibiotics (S110JV, Basic Culture Medium, China). The mixture was centrifuged at 300 g for 5 min at 4°C. The supernatant was then discarded, and the cell pellet was collected and resuspended in DMEM / F-12 (1:1). The cell suspension was transferred to a 25 cm 2Incubate in a culture flask at 37°C and 5% carbon dioxide. Change the growth medium after 12 hours and every three days. Wash the adherent cells with DMEM / F-12 (1:1) before each change. After culturing the cells in the culture flask for 1 week, rinse the cells with PBS (calcium-free and magnesium-free) and then use 0.05% trypsin (S320KJ, BasalMedia, China) for 120 seconds to detach the cells. Subsequently, transfer the detached cells to a new 25 square centimeter culture flask and maintain under the same conditions for another 12 hours. This process was repeated 4 times until the purity of the primary mouse draining lymph node reticular fibroblasts exceeded 98%, at which time the fibroblasts were collected.

[0098] Statistical analysis

[0099] Data are presented as mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism (version 8.0.1.244x64, USA). Intergroup comparisons were performed using one-way analysis of variance or two-tailed t-test. P < 0.05 was considered statistically significant, and P < 0.01 was considered extremely significant.

[0100] Ethics Statement

[0101] This study involved animal subjects and was approved by the Laboratory Animal Center of the Analytical and Testing Center of Shanghai Jiao Tong University (ID: A2024402).

[0102] Example 2: Verification of the key role of HGF in tumor-induced lymph node neural remodeling The applicant established an MC38 colorectal cancer cell footpad injection model to induce mouse popliteal lymph node (PLN) metastasis. HYBRiD tissue clearing technology combined with light sheet fluorescence microscopy (LSFM) was used for 3D imaging. It was found that the lymph node volume increased during TLNE ( Figure 1 , ab), and sympathetic nerve fibers (TH + ) length and number of branches increased significantly ( Figure 1 Single-nucleus RNA sequencing (snRNA-seq) analysis showed that lymph node stromal cells are mainly FRCs (FBs and MRCs). During TLNE, FRCs highly express HGF and drive neural remodeling by activating neural guidance pathways (such as axon guidance). Figure 2 ).

[0103] Example 3: In vitro functional verification of HGF inhibitors

[0104] To further study the biological function of HGF, the applicant first treated primary FRCs with MC38 cell conditioned medium (CM). qPCR and ELISA tests showed that the secretion of HGF mRNA and protein in the CM group was significantly increased (Figure 3 , ab). Further treatment of PC12 cells with FRCs / MC38 conditioned medium revealed an increase in axonal extension length, whereas the addition of HGF inhibitors Norleual TFA or SRI 31215 significantly inhibited axonal growth ( Figure 3 , cf).

[0105] Example 4: In vivo efficacy evaluation of HGF inhibitors

[0106] Based on the results of previous in vitro functional experiments, the applicant further studied the effect of HGF inhibitors on the progression of tumor cell lymph node metastasis in animals. The applicant first injected HGF inhibitors (Norleual TFA or AAV-shHGF (SEQ ID NO.10)) into the popliteal fat pad of mice, and then inoculated MC38 cells. After 7 days, PLN was collected, and 3D imaging showed that the length and number of sympathetic nerve fibers in the inhibitor group were reduced by more than 50% compared with the control group ( Figure 4 , ac). In addition, the lymph node volume of the inhibitor group ( Figure 4 , d) and collagen deposition was significantly reduced ( Figure 4 , e), confirming that HGF targeted therapy can effectively inhibit TLNE. In addition, HE staining results showed that the lymph node metastasis of tumor cells in the inhibitor group was significantly reduced ( Figure 4 , f).

[0107] In summary, the applicant discovered that HGF is a key driver of tumor-induced lymph node neural remodeling. Its inhibitors inhibit metastasis and colonization by targeting HGF function and regulating lymph node matrix remodeling, showing significant anti-tumor lymph node metastasis effects at the molecular, cellular, and in vivo levels. From in vitro FRCs / MC38 co-culture models to in vivo mouse metastasis models, HGF inhibitors can effectively inhibit axon extension and neural proliferation, demonstrating the universality and reliability of their mechanism of action. Local targeted drug delivery (popliteal fat pad injection) combined with highly selective inhibitor design can precisely intervene in the metastatic sentinel lymph nodes while avoiding systemic toxicity, providing a new, efficient, and low-toxic strategy for the prevention and treatment of solid tumor lymph node metastasis.

[0108] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are merely examples, and any embodiments having substantially the same structure and effect as the technical concept within the scope of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the present application, any other embodiments that can be conceived by those skilled in the art and that combine some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. Use of hepatocyte growth factor in preparing a reagent for treating and / or preventing cancer, characterized in that: The cancer is accompanied by lymph node metastasis and neural remodeling.

2. The use according to claim 1, characterized in that The reagent is an HGF gene inhibitor.

3. The use according to claim 2, characterized in that The HGF gene inhibitor is a nucleic acid molecule, a nucleic acid construct, a lentivirus, an antibody or a small molecule compound.

4. The use according to any one of claims 1 to 3, characterized in that The HGF gene inhibitor is shRNA as shown in SEQ ID NO.10, Norleual TFA or SRI 31215.

5. The use according to any one of claims 1 to 4, characterized in that The HGF inhibitors exert their effects by blocking HGF-mediated fibroblast activation and sympathetic nerve fiber growth.

6. The use according to any one of claims 1 to 5, characterized in that The cancer is colorectal cancer or other solid tumors with lymph node metastasis.

7. A nucleic acid molecule, which is an HGF gene inhibitor and can reduce the expression of the HGF gene in pancreatic cancer cells, comprising: a) double-stranded RNA, wherein the double-stranded RNA contains a nucleotide sequence capable of hybridizing with the HGF gene under stringent conditions, wherein the nucleotide sequence hybridizing with the HGF gene is shown in SEQ ID NO.9; or b) shRNA, wherein the shRNA contains a nucleotide sequence capable of hybridizing with the HGF gene under stringent conditions, and the shRNA is shown as SEQ ID NO.

10.

8. A nucleic acid construct, which is an HGF gene inhibitor, comprises a gene segment encoding the shRNA of the nucleic acid molecule according to claim 7 and is capable of expressing the shRNA.

9. A lentivirus, which is an HGF gene inhibitor, is produced by viral packaging of the nucleic acid construct according to claim 8 with the assistance of a lentiviral packaging plasmid and a cell line.

10. A pharmaceutical composition comprising an effective amount of an HGF inhibitor and a pharmaceutically acceptable carrier.

Images