Application of tyrosine kinase inhibitor and serine / glycine deficient substance in preparation of composition for treating non-small cell lung cancer

Abstract

The invention discloses application of substances lacking tyrosine kinase inhibitors (TKIs) and serine / glycine in preparation of a composition for treating non-small cell lung cancer. And the TKIs is preferably selected from Vandetanib. And TKIs administration is carried out while nutrition deficiency of the serine / glycine in the non-small cell lung cancer cells is caused by the substance lacking of the serine / glycine. Starting from a metabolic adaptability mechanism, the invention proves that the combination of substances lacking TKIs and serine / glycine is a very effective accurate compatibility strategy, has good broad spectrum, does not generate toxic and side effects, and has very strong feasibility, safety and practicability.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology and relates to the application of a tyrosine kinase inhibitor and a serine / glycine-deficient substance in preparing a composition for treating non-small cell lung cancer. Background Art

[0002] Based on the analysis of tumor genomic data, researchers have discovered numerous mutations that can drive the development, progression, metastasis, and clonal evolution of lung cancer, such as those in genes like EGFR, KRAS, RET, ALK, and ROS1. This has spurred a shift in lung cancer treatment strategies from traditional chemoradiotherapy to precision medicine. Tyrosine kinase inhibitors (TKIs) are the most representative precision medicine strategy for lung cancer, and their widespread use has improved progression-free survival (PFS) in NSCLC patients to a certain extent. Compared to normal cells, tumor cells proliferate more vigorously and require adjustments to their metabolic pathways to adapt to their survival needs. Therefore, metabolic pathways that tumor cells specifically rely on have become new therapeutic targets for cancer.

[0003] In fact, compared with targeted therapy, metabolic therapy has a longer history. As early as the 1940s, folic acid antagonists were used to treat childhood acute lymphoblastic leukemia, and the subsequent use of purine and pyrimidine analogs formed the basis of tumor chemotherapy. In the past 20 years, although the remodeling characteristics of tumor metabolism have been widely studied, the only therapeutic strategies approved for clinical use that target metabolic targets are IDH1 / 2 mutation inhibitors such as ivosidenib. More metabolic therapy strategies are still based on "starvation therapy" based on the high nutritional metabolic needs of tumor cells. Dietary restriction has been found to inhibit tumor growth in clinical trials. For example, a diet lacking non-essential amino acids such as serine can inhibit the growth of TP53-deficient tumor cells in mice. However, how to achieve the precise combination of TKIs and metabolic intervention strategies to maintain anti-tumor efficacy while avoiding off-target damage to normal tissues remains a key bottleneck in the current clinical translation process.

[0004] Although TKI treatment of lung cancer improves prognosis, the problem of drug resistance is prominent. Its resistance mechanisms include target mutations (such as EGFR T790M mutation), bypass activation of other kinase signals (such as amplification of the MET gene after EGFR inhibition), and metabolic reprogramming of tumor cells (such as FGFR mutations activating oxidative phosphorylation and EGFR mutations activating serine de novo synthesis). In addition, TKIs treatment relies on specific mutations, and metabolic pathway inhibitors have a narrow therapeutic window and high toxicity, which limits their therapeutic range. Tumor metabolic heterogeneity resists intervention through a "compensation / inhibition" model, resulting in the failure of single therapy. For example, "starvation therapy" is easily resisted by the "compensation / inhibition" model; when cells face amino acid deficiency, they can activate the amino acid stress response (Amino Acid Response, AAR) to promote cell survival, thereby achieving a therapeutic effect that resists "amino acid deficiency therapy."

[0005] With the discovery of resistance and compensatory mechanisms of TKIs and nutritional deficiencies, combination therapy has become an important option to overcome the monotherapy strategy. Studies have shown that small molecules targeting PHGDH, the rate-limiting enzyme in serine de novo synthesis, can synergize with serine deficiency to inhibit tumor cell growth (Nature Communications. 2021 Jan 14; 12(1): 366). Serine and glycine are both non-essential amino acids that integrate important metabolic processes such as carbon, nitrogen, and sulfur cycles. The two can be converted into each other under the catalysis of SHMT1 / 2 enzymes (serine hydroxymethyltransferase 1 / 2). In tumor cells, restricting serine / glycine in culture medium and diet can inhibit tumor cell growth in vitro and in vivo (Nature, 2013, 493(7433):542-6; Dietary modifications for enhanced cancer therapy), but this inhibitory effect seems to be only accidental. Subsequent studies have confirmed that simply restricting serine / glycine cannot inhibit tumor growth in mice (Cancer Res, 2014, 74(24):7521-33; Cell Metab, 2020, 31(2):339-50e4; Nat Commun, 2021, 12(1):366). Among the currently known mechanisms, the mechanisms by which serine / glycine deficiency restricts tumor growth include inhibition of tumor cell replication (Nat Commun, 2021, 12(1):366), mitochondrial fragmentation caused by abnormal lipid metabolism (Cell Rep, 2018, 22(13):3507-20), and increased levels of ROS (reactive oxygen species) (Nature, 2013, 493(7433):542-6). Based on the cell killing and resistance mechanisms of serine / glycine deficiency, researchers have tried different combinations to improve the sensitivity of metabolic therapy. For example, combining serine / glycine deficiency with radiotherapy (Br J Cancer, 2022, 127(10):1773-1786), ROS inhibitor biguanides (Cancer Res, 2014, 74(24):7521-33), or mitochondrial respiratory chain inhibitors (Cell reports, 2018, 24(9):2381-2391; Nature metabolism, 2019, 1(9):861-867) can better kill tumor cells. However, there has been no study to evaluate the specificity of these combined approaches. Do they only target tumor cells or do they also damage normal cells? This is because it will increase the serious toxic side effects during clinical treatment.

[0006] Despite a series of advances in serine / glycine, no studies have yet explored whether TKIs can synergize with serine / glycine-deficient substances for the selective treatment of non-small cell lung cancer. Summary of the Invention

[0007] Based on the above shortcomings of the prior art, the purpose of the present invention is to provide a method for preparing a composition for treating non-small cell lung cancer by using a tyrosine kinase inhibitor and a serine / glycine-deficient substance, which is particularly suitable for patients who have an insufficient response to or are resistant to TKI monotherapy.

[0008] The present invention provides the following technical solutions:

[0009] One of the technical solutions of the present invention provides the use of tyrosine kinase inhibitors (TKIs) and serine / glycine-deficient substances in the preparation of a composition for treating non-small cell lung cancer.

[0010] Furthermore, the tyrosine kinase inhibitors (TKIs) are selected from any one of vandetanib, gefitinib, lapatinib, crizotinib, cabozantinib, and sorafenib.

[0011] Furthermore, the tyrosine kinase inhibitor (TKIs) is preferably vandetanib.

[0012] Among them, vandetanib is a multi-target tyrosine kinase inhibitor developed by AstraZeneca that can inhibit the activity of kinases such as VEGFR, EGFR, and RET. It is currently only clinically approved for the treatment of medullary thyroid carcinoma. In the early stages of the drug's development, phase I / II clinical trials showed that vandetanib can improve the prognosis of NSCLCs (J Clin Oncol, 2007, 25(27):4270-7; J Clin Oncol, 2007, 25(27):4270-7). However, the results of a larger-scale phase III clinical trial showed that vandetanib did not improve the prognosis of NSCLCs and caused more severe grade III-IV side effects (Lancet Oncol, 2010, 11(7):619-26; J. Clin. Oncol. 2012, 30, 1114–1121). Therefore, the multi-target advantage of vandetanib has not shown multiple effects in the treatment of lung cancer, and may even produce more toxic side effects. And so far, vandetanib has not been approved by the food and drug regulatory authorities of any country or region for the treatment of lung cancer.

[0013] The present invention discovered that restricting serine / glycine can enhance the ability of vandetanib to selectively kill NSCLC cells and reduce the weight loss side effect of vandetanib treatment alone in mice. This will expand the application of vandetanib in the treatment of NSCLCs, provide a new strategy for vandetanib treatment, and is expected to promote its clinical application and bring new hope to patients.

[0014] Furthermore, in the composition for treating non-small cell lung cancer, the serine / glycine-deficient substance is the sole nutrient source for non-small cell lung cancer cells. In other words, non-small cell lung cancer cells cannot obtain serine and glycine from anywhere other than the serine / glycine-deficient substance.

[0015] Furthermore, the serine / glycine-deficient substance is: a low-serine / glycine food or a low-serine / glycine nutritional supplement. In the low-serine / glycine food or the low-serine / glycine nutritional supplement, the total mass fraction of serine and glycine is ≤ 0.1%.

[0016] Furthermore, the serine / glycine-deficient substances include: serine / glycine-free foods and serine / glycine-free nutritional supplements, that is, the total mass fraction of serine and glycine is 0%.

[0017] Furthermore, the non-small cell lung cancer refers to non-small cell lung cancer that is insufficiently responsive or resistant to TKI monotherapy. The non-small cell lung cancer cell line is selected from any one or more of H1975, H1299, HCC827, A549, Calu-3, or Calu-6.

[0018] Furthermore, the combination of the composition is used in a manner that: serine / glycine deficiency is caused in non-small cell lung cancer cells by a serine / glycine-deficient substance, and TKIs are administered at the same time.

[0019] A second technical solution of the present invention provides the use of a tyrosine kinase inhibitor and a serine / glycine-deficient substance in the preparation of a composition for improving the prognosis of non-small cell lung cancer.

[0020] Furthermore, a combination therapy for the treatment of non-small cell lung cancer is provided. Through specific serine / glycine depletion, tumor cells are induced to transition from their original metabolic heterogeneity to a relatively homogeneous state, activating the amino acid stress response (AAR) to maintain cell survival. During this induction process, it was confirmed that the mechanisms of AAR activation in NSCLC cells and normal lung epithelial cells are different: tumors rely on cMYC, while normal cells rely on ATF4. The use of TKIs such as vandetanib can selectively inhibit the cMyc-AAR in tumor cells without affecting the ATF4-AAR in normal cells. This precise combination of a specific tyrosine kinase inhibitor and serine / glycine depletion can selectively inhibit NSCLC tumor growth in vitro and in vivo.

[0021] Compared with the prior art, the present invention has at least the following improvements and beneficial effects:

[0022] Based on the mechanism of metabolic adaptability, the present invention demonstrates that the combination of TKIs, particularly vandetanib, and the serine / glycine-deficient substance is a highly effective precision combination strategy for the treatment of NSCLCs. This combination strategy has excellent broad-spectrum therapeutic potential, is not affected by specific tumor mutation types, can be used to inhibit the viability of a variety of tumor cells, and has a strong sensitization effect on TKIs. TKIs and serine / glycine deficiency have excellent selectivity, and while inhibiting tumor growth, they can also alleviate the adverse effects of TKIs alone on weight loss without producing toxic side effects. The present invention is the first to discover that TKIs can selectively inhibit the SSP gene and conduct a detailed investigation of its inhibitory mechanism. The inventors creatively used TKIs in combination with serine / glycine-deficient substances to demonstrate that this combination regimen is selective and non-toxic for the treatment of NSCLCs and elucidate its molecular mechanism. This discovery reveals a new mechanism of action for TKIs beyond directly targeting kinases, providing a new strategy for overcoming TKI resistance caused by tumor metabolic reprogramming.

[0023] The combination strategy of the present invention has good practicality. Vandetanib itself and several other TKIs are clinical drugs. Among them, vandetanib has been approved for the treatment of medullary thyroid carcinoma and was also used in clinical trials to evaluate NSCLC patients in the early stages of development. This suggests that the strategy of combining TKIs such as vandetanib with the serine / glycine-deficient substance of the present invention has strong feasibility, safety and practicality. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1Figure 1 shows the results of the combination therapy of vandetanib and serine / glycine selectively inhibiting de novo serine synthesis genes in NSCLC cells with different mutation types in vitro; Figure symbols: A, quantitative PCR detection of the expression of de novo serine synthesis genes in NSCLC cells with different mutation types (HCC827, Calu-3, A549, H1299) under normal culture conditions after treatment with vandetanib; B, quantitative PCR detection of SSP gene expression after treatment of different NSCLC cells (HCC827, H1299, A549, H1975) with different types of TKIs; F, quantitative PCR detection of TKI-resistant strain H1975 (containing EGFR) under serine / glycine-deficient (-SG) conditions after treatment with vandetanib. T790M G, Quantitative PCR detection of SSP expression in normal lung epithelial cells Beas-2B under vandetanib treatment-SG; H, Quantitative PCR detection of SSP expression in H1975 cells under different types of TKIs treatment-SG;

[0025] Figure 2 Figure 2 is a result of the combination therapy selectively inhibiting the growth of NSCLCs cells in vitro in Example 2; Figure symbols: A, CCK8 detection of H1975 cell viability under four treatment conditions (DMSO, vandetanib, -SG, vandetanib combined with -SG); B, H1975 cell growth curve after four treatments; C, CCK8 detection of cell viability after four treatment conditions of A549, H1299 and Calu-6; D, CCK8 detection of normal lung epithelial cell Beas-2B viability after four treatment conditions; E, CCK8 detection of the effect of other TKIs combined with SG deficiency on H1975 cell viability; F, CCK8 detection of the effect of other TKIs combined with SG deficiency on the viability of normal lung epithelial cell Beas-2B; G, Annexin V / PI detection of H1975 cell apoptosis status after four treatment conditions; H, Annexin V / PI detection of H1299 cell apoptosis status after four treatment conditions; I, Annexin V / PI was used to detect the apoptosis status of Calu-6 cells after treatment with four different conditions; J, Annexin V / PI was used to detect the apoptosis status of normal lung epithelial cells Beas-2B after treatment with four different conditions;

[0026] Figure 3Figure 3 is a result diagram of the molecular mechanism of the combination therapy selectively inhibiting NSCLC tumor growth in Example 3; Figure labels: AB, quantitative PCR detection of ATF4 (A) and MYC (B) expression in A549 and H1299 cells after treatment with vandetanib; C, western detection of ATF4 and MYC protein expression in A549 and H1299 cells after treatment with vandetanib; D, quantitative PCR detection of SSP gene expression in H1299 cells after MYC knockdown; E, quantitative PCR detection of SSP gene expression after inhibition of MYC upstream MAPK and PI3K-AKT; F, quantitative PCR detection of four Expression of MYC and ATF4 after conditional treatment of H1975; G, Western detection of MYC and ATF4 protein expression after four conditional treatments of H1975; H, quantitative PCR detection of SSP gene expression in H1975 treated with GCN2 and MYC inhibitors under normal and -SG conditions; I, quantitative PCR detection of SSP gene expression in lung epithelial cells Beas-2B treated with GCN2 and MYC inhibitors under normal and -SG conditions; JK, CCK8 detection of cell viability after Beas-2B and H1975 treated with MYC (J) and GCN2 (K) inhibitors;

[0027] Figure 4 Figures show the results of the combined therapy in Example 4 inhibiting NSCLC tumor growth in vivo; Figures: A, tumor volume growth curves of tumor-bearing mice after treatment with the four conditions; B, tumor morphology photographs (left) and weight statistics (right) of tumor-bearing mice after treatment with the four conditions;

[0028] Figure 5 The safety evaluation results of the combination therapy in Example 5; Figures: A, weight change curve of mice during the four treatment conditions; B-D, liver (B), kidney (C), and cardiac function (D) index detection of mice after the four treatment conditions; E, liver tissue sections of mice after the four treatment conditions; F, red blood cell (left) and hemoglobin (right) detection of mice after the four treatment conditions;

[0029] Figure 6 Flowchart showing the effects of the combined strategy of TKIs and serine / glycine deficiency on metabolism. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is described in detail below with reference to specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0031] All raw materials in the present invention are not particularly limited in their sources and can be purchased commercially or prepared according to conventional methods known to those skilled in the art. See Tables 1-3 for details. TKIs include tyrosine kinase inhibitors such as vandetanib, gefitinib, lapatinib, crizotinib, sorafenib, and cabozantinib.

[0032] Table 1 Experimental reagents and consumables

[0033]

[0034]

[0035] Experimental cells and mice:

[0036] Human NSCLC cell lines H1975, H1299, HCC827, A549, Calu-3, and Calu-6, normal lung epithelial cell line Beas-2B, and 293T cells for transfection were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences.

[0037] Six-week-old female Balb / c nude mice were purchased from SPIEF (Suzhou) Biotechnology Co., Ltd.

[0038] Table 2 Experimental instruments and equipment

[0039]

[0040]

[0041] Table 3 Cell lines and TKIs targets

[0042] name Mutation characteristics HCC827 <![CDATA[EGFR E746-A750del ]]> Calu-3 <![CDATA[ERBB2扩增 / TP53 M237I ]]> Calu-6 <![CDATA[KRAS Q61K ]]> A549 <![CDATA[KRAS G12S ]]> H1299 <![CDATA[NRAS Q61K / TP53 deficiency]]> H1975 <![CDATA[EGFR L858R / T790M ]]> Beas-2B Normal lung epithelial cell line vandetanib VEGFR, EGFR, RET Gefitinib EGFR Lapatinib HER1 / 2 crizotinib ALK, MET, ROS sorafenib VEGFR, FGFR, RET, FLT3, KIT cabozantinib VEGFR, RET, FLT3, KIT, ROS1, NTRK

[0043] Example 1: The combination therapy of TKIs and the serine / glycine-deficient substance selectively inhibits the expression of serine de novo synthesis genes in NSCLCs cells with different mutation types in vitro.

[0044] This example first used quantitative PCR to examine the effects of different TKIs on the expression of SSP genes (serine synthesis pathway, SSP [PHGDH, NCBI sequence number 26227; PSPH, NCBI sequence number 5723; PSAT1, NCBI sequence number 29968; SHMT2, NCBI sequence number 6472]) in NSCLC cells and normal lung epithelial cells, Beas-2B. The NSCLC cells selected included HCC827, Calu-3, A549, H1975, and H1299. The specific experiments were as follows:

[0045] (1) Take 2×10 5HCC827, Calu-3, A549, H1299, and H1975 cells were seeded in 6-well plates and cultured in 10% FBS / 1640 medium for 24 hours. 5 μmol / L vandetanib, gefitinib, lapatinib, crizotinib, or sorafenib were added to the culture medium and treated for 48 hours. Simultaneously, an equal amount of DMSO was used as a control group. At least three biological replicates were maintained for each cell line and each treatment condition. The experimental results correspond to Figure 1 A~ Figure 1 E.

[0046] (2) Take another 2×10 5 H1975 cells and normal lung epithelial cells Beas-2B were seeded in 6-well plates and cultured in 10% FBS / 1640 medium for 24 hours. The cells were divided into three experimental groups and one control group: the experimental group cells were treated with SG-deficient medium (1640 medium lacking serine and glycine, the same below) containing 10% small molecule dialyzed serum (serum without small molecules such as amino acids), complete medium containing 5 μmol / L TKIs (vandetanib, gefitinib, lapatinib or crizotinib), and SG-deficient medium containing 5 μmol / L TKIs (vandetanib, gefitinib, lapatinib or crizotinib). Figure 1 H1975 cells were treated for 1, 3, and 5 days in F. Figure 1 G- Figure 1 Cells were treated with H for 48 hours; control cells were treated with complete medium supplemented with an equal volume of DMSO. At least three biological replicates were maintained for each cell line and treatment condition. The complete medium was 1640 medium supplemented with 10% FBS, the same below.

[0047] (3) After all cells were treated, they were digested with trypsin and collected. They were lysed with Trizol, and RNA was extracted and quantified.

[0048] (4) 1 μg of RNA was reverse transcriptase-converted into cDNA, and then the expression of the SSP gene and the internal reference gene U6 was detected by quantitative PCR. The reaction system of the quantitative PCR is shown in Table 3, and the reaction procedure is shown in Table 4. The quantitative PCR operation steps involved in the following examples are the same.

[0049] Table 3 Quantitative PCR reaction system

[0050]

[0051] Table 4 Quantitative PCR reaction procedures

[0052]

[0053] (5) Data collection, analysis, and graphing. The Δct value of the target gene in each sample was subtracted from the ct value of the internal reference gene U6 to obtain the Δct value. The Δct value of each gene in the experimental group was then subtracted from the Δct value of the control group (DMSO-treated group) to obtain the ΔΔct value. The ΔΔct values ​​were exponentially converted to 2 and normalized to the control group before graphing using GraphPad 8.0.

[0054] The experimental results are as follows Figure 1 As shown:

[0055] Figure 1 A. The results showed that compared with DMSO treatment, vandetanib could inhibit the expression of SSP gene in HCC827, Calu-3, A549 and H1299 cells cultured in complete medium; Figure 1 As shown in Figure B, quantitative PCR detection confirmed that compared with the control group, EGFR-targeted gefitinib and lapatinib can inhibit the expression of serine de novo synthesis genes PHGDH, PSPH, PSAT1 and SHMT2 in HCC827, while non-EGFR-targeted inhibitors crizotinib, sorafenib and cabozantinib have no inhibitory effect. Figure 1 C- Figure 1 As shown in E, consistent with its ineffectiveness in HCC827 cells, sorafenib had almost no significant effect on the expression of serine de novo biosynthesis genes in the tested cell lines (A549, H1299, and H1975). Figure 1 C- Figure 1 As shown in Figure D, the inventors observed that gefitinib and lapatinib, which are effective in HCC827, can inhibit A549, but have no significant inhibitory effect on the expression of serine de novo synthesis genes in H1299 cells. Figure 1 B~ Figure 1 C. Figure 1 As shown in Figure E, the inventors also found that although crizotinib had no effect in HCC827 cells, it could inhibit the expression of four serine de novo synthesis genes in A549 and H1299 cells, and even inhibit the expression of PHGDH and SHMT2 in H1975 cells. Figure 1 C. Figure 1 As shown in Figure E, cabozantinib also significantly inhibited the expression of serine de novo synthesis genes in H1299 cells, while lapatinib showed a moderate inhibitory effect on the expression of serine de novo synthesis genes in H1975 cells. Comparison of the inhibitory effects of different TKIs on the SSP gene in NSCLC cells showed that, with the exception of sorafenib, other TKIs had a certain inhibitory effect, but vandetanib had a stronger inhibitory ability and affected more cell types.

[0056] like Figure 1As shown in Figure F, quantitative PCR analysis demonstrates that, compared to the control group, one day of culture in -SG (SG-deficient) significantly activated SSP gene expression (DMSO column vs. -SG-D1 column). Expression of genes involved in de novo serine synthesis gradually decreased with prolonged culture (red columns). Based on the established serine / glycine-deficient culture system, 5 μmol / L vandetanib inhibited PHGDH and PSAT1 expression within one day of initiating the AAR reaction (-SG+Van-D1 column vs. -SG-D1 column). While SSP gene expression decreased with prolonged culture in -SG alone, vandetanib potentiated the SSP gene expression-reducing effect of -SG culture on day 3 (-SG+Van-D3 column vs. -SG-D3 column), reducing expression to the same level by day 5 (-SG-D5 column vs. -SG+Van-D5 column). This result suggests that although vandetanib cannot inhibit SSP gene expression in H1975 cells under complete culture medium conditions (pink column compared with DMSO column), it inhibits SSP gene expression under SG-deficient culture conditions.

[0057] like Figure 1 As shown in Figure G, by quantitative PCR, the inventors confirmed that compared with the control group, vandetanib did not affect the expression of SSP gene in normal lung epithelial cells in either complete medium or SG-deficient medium. Figure 1 A- Figure 1 F and Figure 1 The results in Figure G show that vandetanib selectively inhibits the gene expression of SSP in NSCLCs cells. Figure 1 As shown in Figure 2H, by quantitative PCR detection, the inventors confirmed that compared with the control group, crizotinib can inhibit the expression of PHGDH and PSPH under -SG culture conditions, while lapatinib and gefitinib have no significant effect.

[0058] Example 2: Combination therapy of TKIs and serine / glycine-deficient substances selectively inhibits the growth of NSCLC cells in vitro.

[0059] This example first examined the effects of different TKIs on NSCLC cells and normal lung epithelial Beas-2B cells under normal and serine / glycine-deficient conditions using CCK8 (common knowledge among those skilled in the art). Then, using annexinV / PI (common knowledge among those skilled in the art), the effect of vandetanib on apoptosis in NSCLC cells and normal lung epithelial Beas-2B cells under normal and serine / glycine-deficient conditions (cultured in 10% dialyzed fetal bovine serum / amino acid-free 1640 plus an amino acid combination lacking serine / glycine) was examined. The specific experiments are as follows:

[0060] (1) Digest the cells in the logarithmic growth phase and adjust the cell density with complete culture medium. Take 1×10 4 A549, H1299, Calu-6, and H1975 cells, as well as normal lung epithelial Beas-2B cells, were seeded in 96-well plates and cultured in complete medium for 24 hours. These cells were then divided into three experimental groups and one control group: experimental groups were treated with SG-deficient medium, complete medium containing 5 μmol / L TKIs (vandetanib, gefitinib, lapatinib, crizotinib, or cabozantinib), or SG-deficient medium containing 5 μmol / L TKIs (vandetanib, gefitinib, lapatinib, or crizotinib); control groups were treated with complete medium supplemented with an equal volume of DMSO. At least six biological replicates were performed for each cell line and treatment condition.

[0061] (2) CCK8 detection of cell viability. After 48 hours of treatment with the above four conditions, 10 μL CCK-8 solution was added directly to each well to a final concentration of 10%. Be careful not to generate bubbles when adding. Tap the plate wall to mix well to prevent cell shedding; incubate at 37°C in the dark for 1-4 hours to develop color until OD 450 Stop incubation after the color development reaches ≈1.0. Observe the color development every 30 minutes to avoid overreaction. After the reaction is complete, remove the 96-well plate and centrifuge at 1000 rpm for 5 minutes to settle bubbles. Immediately measure the absorbance at 450 nm (OD value) using a microplate reader. Process the data based on the OD value and calculate cell viability using the following formula:

[0062]

[0063] (3) Cell apoptosis detection. Digest the cells in the logarithmic growth phase and adjust the cell density with complete culture medium. Take 2×10 5 H1299, Calu-6, and H1975 cells, as well as normal lung epithelial cells Beas-2B, were seeded in 6-well plates and cultured in complete medium for 24 hours. The cells were then divided into three experimental groups and one control group: the experimental groups were treated with SG-deficient medium, complete medium containing 5 μmol / L vandetanib, or SG-deficient medium containing 5 μmol / L vandetanib, respectively; the control group was treated with complete medium supplemented with an equal volume of DMSO.

[0064] (4) After 48 hours of treatment and culture, the cells were digested with trypsin and collected by centrifugation. The cells were resuspended in pre-cooled 1× Binding Buffer to a concentration of 1×10 6 / mL, and then take 100 μL of cell suspension (about 1×10 5Cells) were transferred to the flow cytometry tube and the following were added in sequence: 5 μL Annexin V-FITC, 5 μL PI, mixed gently, and incubated at room temperature in the dark for 15 minutes; 400 μL 1× Binding Buffer was added, mixed, and loaded onto the flow cytometry instrument; gating strategy: Annexin V- / PI- represents live cells (lower left quadrant), Annexin V + / PI- is early apoptosis (lower right quadrant), Annexin V + / PI + : Late apoptosis / necrosis (upper right quadrant); apoptosis rate of each group was calculated based on the gate results. Three biological replicates were performed for each treatment condition.

[0065] The experimental results are as follows Figure 2 As shown:

[0066] Reference numerals: Figure 2 As shown in Figure A, the present invention demonstrates that, compared to the DMSO-treated control group, after 48 hours of treatment with 5 μmol / L vandetanib alone, the cell viability of H1975 cells decreased from 100% to 85.4%, while in the absence of SG alone, the cell viability decreased to 83.6%. Combined treatment reduced cell viability to 59.1%, demonstrating a significant synergistic killing effect. As shown in Figure 2B, the cell growth experiment also demonstrates that combined treatment has a stronger ability to inhibit H1975 cell proliferation than single-factor treatment. Figure 2 As shown in C, the same combination strategy was used to treat A549, H1299 and Calu-6 and also showed significant synergistic killing effects. Figure 2 As shown in Figure D, vandetanib alone, SG deficiency, and combined treatment affected the activity of Beas-2B in normal lung epithelial cells by 93.15%, 107.2%, and 88.7%, respectively, with no significant synergistic effect. These results indicate that vandetanib combined with SG deficiency can selectively inhibit the growth of NSCLCs in vitro.

[0067] like Figure 2 E- Figure 2 As shown in Figure F, when evaluating the selective therapeutic effect of other TKIs combined with SG deficiency, the present invention confirmed that lapatinib can selectively kill the viability of H1975 cells like vandetanib (-SG+Lap column compared with DMSO column, Lapatinib column, -SG column), and gefitinib has no significant effect on H1975 ( Figure 2 E) or normal lung epithelial cells Beas-2B ( Figure 2F) (-SG+Gef column compared with DMSO column, Gefitinib column, and -SG column) had no killing effect. In contrast, crizotinib (-SG+Cri column compared with DMSO column, Crizotinib column, and -SG column) and cabozantinib (-SG+Cab column compared with DMSO column, Cabozantinib column, and -SG column) had killing effects on H1975 and normal lung epithelial cells.

[0068] like Figure 2 As shown in Figure 2, through cell apoptosis detection, the present invention confirmed that the combined treatment can significantly increase the proportion of early (EA, 2% increased to 5%) and late apoptotic cells (LA, 10% increased to 20%) in H1975 cells compared with the other three groups (vandetanib-treated group, -SG-treated group, and control group).

[0069] like Figure 2 H- Figure 2 As shown in Figure 1, the combined treatment significantly increased the expression of H1299 ( Figure 2 H) and Calu-6( Figure 2 I) apoptosis ratio, and also increased the necrotic cell ratio in H1299 cells ( Figure 2 H). The difference is that, Figure 2 As shown in Figure J, combined treatment only slightly increased the proportion of early (2% to 5%) and late apoptosis (3% to 5%) of normal lung epithelial cells. The results of cell viability and / or apoptosis by CCK8 clearly showed that vandetanib or lapatinib combined with SG lacked the selective killing effect on NSCLC cells.

[0070] Example 3 Molecular mechanism of the selective inhibition of NSCLC tumor growth by combination therapy.

[0071] This example used quantitative PCR, immunoblotting, and CCK8 analysis to investigate the differences in the selective killing mechanisms of vandetanib against NSCLCs and normal lung epithelial Beas-2B cells when cultured in complete medium and SG-deficient medium. Except for the c-MYC gene knockdown experiments, all other experimental methods were the same as those in Examples 1 and 2.

[0072] The specific experiments for c-MYC gene knockdown are as follows:

[0073] (1) Using the Broad Institute TRC shRNA online tool, the siRNA sequence for the c-MYC gene (CAGGAACTATGACCTCGACTA) was designed and then the sequence was constructed into the lentiviral vector pLKO.1.

[0074] (2) Cultured 293T cells were transfected with vector or c-MYC shRNA and packaging plasmids psPAX2 and pMD2.G, respectively. 48 hours after transfection, the viral supernatant was collected.

[0075] (3) In cultured H1299 cells, vector or c-MYC-KD2 virus supernatant was added to the culture supernatant in the presence of polybrane (final concentration of 8 μg / ml) and infected for 48 hours.

[0076] (4) H1299 cells were infected for 48 hours and screened with 1 μg / ml puromycin to obtain positive H1299 vector and c-MYC-KD2 cell lines for subsequent experiments.

[0077] The experimental results are as follows Figure 3 As shown:

[0078] Figure 3 A- Figure 3 As shown in Figure B, the present invention demonstrates that, compared to DMSO, 5 μmol / L vandetanib does not affect the expression of ATF4, the most common upstream transcription factor of SSP (generally expressed in normal cells), in A549 and H1299 cells under complete culture conditions, but can significantly inhibit the expression of c-MYC gene (generally expressed in tumor cells). This is consistent with the gene expression results. Figure 3 As shown in Figure C, the present invention further confirmed that vandetanib can inhibit the protein expression of c-MYC but not ATF4 in A549 and H1299 cells. The above results suggest that c-MYC may be the main transcription factor regulating SSP transcription in NSCLC cells.

[0079] To confirm the regulatory effect of c-MYC on SSP, the inventors knocked down the c-MYC gene in H1299 cells. Figure 3 As shown in Figure D, the present invention demonstrates that c-MYC knockdown (c-MYC-KD2) significantly reduces SSP gene expression compared to an empty vector. In c-MYC knockdown H1299 cells, continued treatment with vandetanib did not further reduce SSP gene expression, indicating that vandetanib primarily regulates SSP gene expression through c-MYC.

[0080] Receptor tyrosine kinases can regulate c-MYC activity through MAPK and PI3K-AKT (e.g. Figure 6As shown), in order to explore which signal mainly controls c-MYC-SSP transcription after vandetanib targets RTK (typical members of the RTK pathway include: EGFR, PDGFR, VEGFR, etc., which have an upstream and downstream synergistic activation relationship with MAPK and PI3K-AKT). The inventors used PD0325901 (MEK inhibitor, which can block the signal transduction of the MAPK pathway), BRD7389 (RSK inhibitor, which can block the signal transduction of the MAPK pathway), HS-173 (PI3K inhibitor, which can block the signal transduction of the PI3K-AKT pathway), MK-2206 (AKT inhibitor, which can block the signal transduction of the PI3K-AKT pathway) and Rapamycin (mTOR inhibitor, which can block the signal transduction of the PI3K-AKT pathway) to treat A549 and H1299 cells, as shown. Figure 3 As shown in Figure E, the present invention demonstrates that PD0325901 (a MEK inhibitor) significantly inhibits SSP gene expression in A549 and H1299 cells compared to a DMSO-treated control group (red bars for each gene compared to other bars). These results suggest that vandetanib primarily regulates SSP expression through the RTKs MAPK and c-MYC.

[0081] In order to further clarify the mechanism by which vandetanib selectively kills NSCLCs under SG deficiency conditions, the present invention also detected the expression levels of c-MYC and ATF4 after treatment with vandetanib under serine / glycine deficiency conditions. Figure 3 As shown in F, compared with the DMSO control, 5 μmol / L vandetanib treatment alone did not affect the expression of c-MYC and ATF4, while SG deficiency alone activated both c-MYC and ATF4 expression. Combined treatment only reduced the expression of c-MYC (the fourth bar compared to the third bar) but not ATF4. Figure 3 As shown in G, the protein expression level of c-MYC was significantly lower than that of the SG group alone 1, 2, and 3 days after combined treatment. Figure 3 As shown in Figure 3, the present invention demonstrates that the use of c-MYC inhibitors rather than GCN2 inhibitors (corresponding to ATF4) can inhibit the transcriptional activation of SSP genes under SG deficiency conditions. Figure 3 As shown in Figure 1, GCN2 inhibitors, but not c-MYC inhibitors, inhibited SSP gene transcription in normal lung epithelial Beas-2B cells. Furthermore, compared with GCN2 inhibitors, c-MYC inhibitors increased SSP transcription in both complete and SG-deficient cultures. These results strongly suggest that NSCLCs rely on c-MYC, while normal cells rely on ATF4, to regulate SSP transcription in SG-deficient conditions.

[0082] Given that vandetanib mainly regulates SSP transcription through RTKs-MAPK-c-MYC, it can selectively inhibit NSCLC cell viability. Figure 3 J- Figure 3 As shown in Figure K, CCK8 confirmed that compared with DMSO, GCN2 inhibitors but not c-MYC inhibitors could inhibit the viability of normal lung epithelial cells Beas-2B under SG-deficient conditions. However, both c-MYC and GCN2 inhibitors could inhibit the viability of H1975 cells under SG-deficient conditions, suggesting that although the AAR regulatory axis of GCN2-ATF4 is not involved in SSP transcription under SG-deficient conditions, other stress signals controlled by them are also crucial for maintaining cell viability under SG-deficient conditions.

[0083] Example 4 Synergistic inhibition of tumor growth in vivo.

[0084] In this embodiment, 3×10 6 H1975 cells were inoculated subcutaneously into Balb / c nude mice and the tumors were grown to 100-150 mm. 3 The mice were divided into four groups: normal feeding plus oral administration of DMSO (DMSO group), normal feeding plus oral administration of vandetanib (25 mg / kg), serine / glycine-deficient feeding plus DMSO, and serine / glycine-deficient feeding plus oral administration of vandetanib (25 mg / kg). The normal feeding consisted of irradiated sterilized experimental mouse growth and breeding feed; the serine / glycine-deficient feeding consisted of a normal irradiated sterilized experimental mouse growth and breeding feed without the addition of serine and glycine. After two weeks of treatment, some DMSO mice had tumors exceeding ethical limits, so treatment was terminated.

[0085] The experimental results are as follows Figure 4 As shown:

[0086] Under this condition, if Figure 4 As shown in Figure A, it was observed that, in contrast to the in vitro results, oral administration of vandetanib inhibited H1975 tumor growth in vivo, whereas serine / glycine depletion had no therapeutic effect. However, the combined treatment significantly inhibited tumor growth compared to both the control and single-treatment groups. In addition, as Figure 4 Figure B shows quantification of tumor volume changes during treatment. The average growth rate in the DMSO group was 5.74-fold, the serine / glycine-deficient group increased by 6.12-fold, the vandetanib group alone increased by 5.11-fold, and the combination treatment group increased by only 2.74-fold. Specifically, the average tumor volume was 0.8 g in the DMSO group, 0.71 g in the serine / glycine-deficient group alone, 0.45 g in the vandetanib group alone, and 0.32 g in the combination treatment group. These results demonstrate that combined treatment with vandetanib and serine / glycine-deficient therapy can inhibit the growth of NSCLCs in vivo.

[0087] Safety evaluation of Example 5.

[0088] Safety evaluation was performed for several treatments in Example 4, including mouse weight test, internal organ function index test, liver tissue section test, and blood routine test. The specific operation steps are as follows:

[0089] (1) Peripheral blood routine test. Blood was collected from the orbit and placed in a 0.5 mol / L EDTA anticoagulation tube; 20 μL of whole blood was diluted with diluent at a ratio of 1:7; the diluted whole blood was detected using a Hisumeng animal blood routine counter.

[0090] (2) Serum heart, liver, and kidney function test. After the above anticoagulated blood was centrifuged at 2000 rpm for 20 minutes, the plasma was collected; 10 μL of plasma was taken according to one index, and then placed in a full-automatic biochemical analyzer for analysis and taking the value.

[0091] (3) After euthanasia of the mice, the livers of the four groups of mice were separated, and part of the liver tissue was cut and placed in 4% paraformaldehyde for fixation for at least 24 hours; paraffin embedding sectioning was performed; then hematoxylin-eosin staining (a conventional staining technique in the art) was performed, the stained sections were dried and mounted, and an inverted microscope was used to take pictures.

[0092] The experimental results are shown in Figure 5

[0093] As shown in Figure 5 A, although the treatment with vandetanib alone has the ability to inhibit tumor growth, it causes weight loss in mice, from 18.85 g before treatment to 16.8 g after treatment (11% weight loss); the other three treatments do not affect the change in mouse weight.

[0094] In addition, as shown in Figure 5 B to Figure 5 D, the function tests of the heart, liver, and kidney showed that the three treatments did not cause damage to these functions; as shown in Figure 5 E, liver sections also showed no liver tissue damage; as shown in Figure 5 F, blood routine tests even observed that the combined treatment could increase the content of red blood cells and hemoglobin, which may be beneficial for resisting anemia caused by tumors.

[0095] In summary, the combined treatment of vandetanib and serine / glycine deficiency is a safe and effective treatment method, and can improve the weight loss caused by vandetanib treatment alone.

[0096] ​The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.

Claims

1. Use of a tyrosine kinase inhibitor and a serine / glycine-deficient substance in the preparation of a composition for treating non-small cell lung cancer.

2. The use according to claim 1, characterized in that The tyrosine kinase inhibitor is selected from any one of vandetanib, gefitinib, lapatinib, crizotinib, cabozantinib and sorafenib.

3. The use according to claim 2, characterized in that The tyrosine kinase inhibitor is selected from vandetanib.

4. The use according to claim 1, characterized in that The serine / glycine-deficient substance is the sole nutrient source for non-small cell lung cancer cells.

5. The use according to claim 1, characterized in that The serine / glycine-deficient substances include: foods low in serine / glycine, and nutritional supplements low in serine / glycine.

6. The use according to claim 5, characterized in that In the low-serine / glycine food and low-serine / glycine nutritional supplement, the total mass fraction of serine and glycine is ≤0.1%.

7. The use according to claim 1, characterized in that The serine / glycine-deficient substances include: serine / glycine-free foods and serine / glycine-free nutritional supplements.

8. The use according to claim 1, characterized in that The non-small cell lung cancer refers to non-small cell lung cancer that is insufficiently responsive to or resistant to TKI monotherapy.

9. The use according to claim 1, characterized in that The non-small cell lung cancer cell line is selected from any one or more of H1975, H1299, HCC827, A549, Calu-3 or Calu-6.

10. Use of a tyrosine kinase inhibitor and a serine / glycine-deficient substance in the preparation of a composition for improving the prognosis of non-small cell lung cancer.

Images