Application of OsDr1 gene in regulating axillary bud germination of indica rice

Abstract

The application discloses application of an OsDr1 gene in regulating axillary bud germination of rices with tillering from the tillers, and belongs to the technical field of biotechnology. The application obtains a gene OsDr1 interacting with a rice with tillering from the tillers related gene OsDrAp1 through yeast two-hybrid screening; the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO. 3, and the primers for amplifying the OsDr1 gene are shown as SEQ ID NO. 1 and 2. The application constructs OsDr1 transgenic knockout materials, and analysis finds that the OsDr1 can influence the axillary bud germination rate of rices with tillering from the tillers, and can be used for breeding research of the rices with tillering from the tillers.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to application of an OsDr1 gene in regulating axillary bud germination of regenerative rice. BACKGROUND

[0002] Rice is one of the most important food crops in China, and ensuring stable rice yield is of great significance to China's agricultural production. Regenerative rice refers to the rice that, after the first season rice is harvested, the surviving axillary buds of the rice stubble germinate into panicles under suitable light, temperature, water and fertilizer conditions, and then the rice matures. Regenerative rice not only saves manpower and material resources, but also has better quality than the first season rice because it does not experience high temperature. Due to its special growth characteristics, regenerative rice is particularly suitable for areas where there is excess light and temperature for planting one season of rice and insufficient light and temperature for planting two seasons of rice, so as to achieve two harvests from one planting, increase yield and be efficient. Therefore, the promotion of regenerative rice in production has very important strategic significance.

[0003] In the early stage of development of regenerative rice, the yield of regenerative rice was improved mainly by improving planting management methods through the planting experience of farmers in various places, such as paying attention to fertilization, tillage and management of regenerative rice, and using the seeds of regenerative rice for planting. For example, providing experience for the appropriate time of harvesting regenerative rice from the first season rice, the height of the rice stubble and the management of field irrigation. It is also found that the next year's regenerative rice has the characteristics of more tillers, more panicles and more grains. With the progress of productivity, researchers have gradually begun to conduct research from the genetic and molecular level. At present, the molecular research on the influence of regenerative rice has achieved certain results, but only two genes have been cloned, which cannot meet the production needs of regenerative rice, and it is urgent to speed up the progress.

[0004] Dr1 (down-regulator) belongs to the NF-Y transcription factor family, and can form a complex with DrAp1. The complex widely exists in various organisms, and usually exercises inhibition on the transcription of downstream target genes, thereby participating in physiological processes such as plant-microbe interaction, root development and stress response. SUMMARY

[0005] The application provides application of an OsDr1 gene in regulating axillary bud germination of regenerative rice, wherein the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO. 3.

[0006] In an embodiment of the application, the regulation is knocking out the above-mentioned OsDr1 gene in rice.

[0007] The application also provides application of a protein encoded by an OsDr1 gene in regulating axillary bud germination of regenerative rice, wherein the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO. 3.

[0008] The application also provides a method for regulating axillary bud germination of the rices, wherein when it is required to reduce the axillary bud germination rate of the rices, the OsDr1 gene in the rices is overexpressed; when it is required to increase the axillary bud germination rate of the rices, the OsDr1 gene in the rices is silenced or knocked out; and the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO. 3.

[0009] The application also provides an application of the OsDr1 gene in rice breeding, wherein a rice strain with a faster axillary bud germination rate is obtained by screening a rice plant with a low expression of the OsDr1 gene, and the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO. 3.

[0010] The application also provides an application of the protein encoded by the OsDr1 gene in rice breeding, wherein a rice strain with a faster axillary bud germination rate is obtained by screening a rice plant with a high expression of the protein encoded by the OsDr1 gene, and the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO. 3.

[0011] The application also provides a method for obtaining improved rices with a faster axillary bud germination rate, comprising knocking out the OsDr1 gene in the rices.

[0012] In an embodiment of the application, the method comprises the following steps: knocking out the OsDr1 gene in the rices by using a CRISPR / Cas9 genome editing system.

[0013] Compared with the prior art, the application has the following beneficial effects:

[0014] The application obtains the gene OsDr1 interacting with the gene OsDrAp1 related to the rices by yeast two-hybrid screening. It is found by analyzing the OsDr1 transgenic knockout material that the OsDr1 can also affect the axillary bud germination rate of the rices, and the influence of the OsDr1 on the growth and development of the axillary buds of the rices can be used for the breeding research of the rices. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 For verification of the interaction between OsDrAp1 and OsDr1 in Example 1, wherein A, yeast two-hybrid, SD-THLA, four-lacking medium (SD / -Trp-His-Leu-Ade); B, pull down; C, BiFC; D, Co-IP.

[0016] Figure 2 For the observation of the axillary bud germination of the OsDr1 transgenic material of the rices and the statistical results of the ratooning bud emergence rate in Example 1. DETAILED DESCRIPTION

[0017] Example 1

[0018] 1. OsDr1 gene cloning

[0019] It was found that OsDrAp1 could affect the germination of tiller buds of rices, and it was reported in the literature that OsDrAp1 and OsDr1 could form a complex. Therefore, according to the reference sequence provided by NCBI, primers were designed to amplify and clone OsDr1 using Japonica cDNA as a template. The amplification primers are as follows:

[0020] OsDr1 CDS-1F (SEQ ID NO. 1): ATGGATCCGATGGATATCGTGG;

[0021] OsDr1 CDS-1R (SEQ ID NO. 2): TCATGAACTGTCCAAGCCATGT.

[0022] PCR amplification was performed using KOD FX DNA Polymerase provided by TOYOBO Company. The PCR amplification system was as follows: Primer Star 10 μL, ddH2O 7 μL, Primer-F 1.5 μL, Primer-R 1.5 μL, and template DNA 1 μL. After adding the sample, the mixture was centrifuged, and the PCR amplification program was as follows: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 65℃ annealing for 30 s, 72℃ extension for 60 s, 35 cycles in total; 72℃ extension for 5 min; 4℃ constant temperature. OsDr1 CDS was obtained from Japonica. After amplification, the PCR product was detected by agarose gel electrophoresis, and the amplification product was sent to the company for sequencing after gel recovery, and the OsDr1 CDS sequence was obtained.

[0023] > OsDr1 CDS (SEQ ID NO. 3)

[0024] ATGGATCCGATGGATATCGTGGGGAAGTCCAAGGAGGACGTCTCCCTCCCCAAATCAACAATGTTTAAGATTATAAAGGAGATGTTGCCCCCTGATGTTCGAGTGGCAAGAGATGCACAAGATCTTCTTGTGGAATGCTGTGTAGAGTTCATCAACCTCCTATCTTCTGAATCCAATGAAGTTTGCAGCCGAGAGGACAAGAAAACTATTGCTCCTGAGCATGTTCTTAGAGCTCTGCAGGATCTTGGCTTTAGGGAGTACATTGAAGAGGTTCAAGCGGCCTACGAACACCATAAGCATGATACCCTGGATTCTCCAAAAGCAAGCAAATTCACTGGTGTGGAGATGACAGAGGAACAAGCTGTAGCTGAGCAACAGAGGATGTTTGCTGAGGCCCGAGCAAGGATGAACAATGGTGCCGCCAAACCGAAGGAGCCAGAACCTGAAGCGCAGCAACAAACACAACAGCCACCACAGCCTCAGCTGCACCCTCAACCACAGCAACCCCTGCAGCCTCAACTTCAGCTCCATCCTCAACCACAACAACAGCCCTCACAGCTACATCCTCAACAGCTGCTGCATCCTCAATCGCAGCAAACTCCGCAGCCTCAACCTCAGGTCCACCCTCAACCACAGCAGCCTCCACAGCTGCAACCGCAACCTCAGCTTCTCCAGCAACCGCAGCTGCCCCAACAGCTGCAGCCGCAATCTCAGCTCCCCCCACAACCGCAGCAGCCCCCACAGCTGCAGCTGCAATCTCAGCTCCACCCACAACCGCAGCAGCCCCCACAGCTGCAGCCGCAACCTCAGCTCCATCAGCAACCGCAGCCGCAGGCAGAGCTGCAATCACAGTCACAACCACAAACAGAACATGGCTTGGACAGTTCATGA

[0025] 2. OsDr1 interacts with OsDrAp1

[0026] The pGADT7-Dr1, pGADT7-DrAp1, pGBKT7-Dr1, pGBKT7-DrAp1 vectors were constructed for yeast two-hybrid experiment. After confirming that the proteins had no self-activation activity, the experimental group and the control group were transferred into yeast AH109, and grown on a two-lack (SD / -Leu / -Trp) medium for 3-4 days. The yeast colonies grown on the two-lack medium were picked to a four-lack medium (SD / -Leu / -Trp / -His / -Ade) for continued growth, and the interaction was verified. The p2YN-DrAp1 and p2YC-Dr1 vectors were constructed for BiFC experiment. After cutting the rice young stems which had grown for about 2 weeks, the cell walls were decomposed by cellulase, pectinase and hemicellulase, and the protoplasts were obtained by resuspending and centrifuging the filtrate with W5 solution-20% sucrose solution-W5 solution. After microscopic examination, the experimental group and the control group plasmids were respectively transferred into the rice protoplasts for expression for 12-24 h, and the fluorescence signals were observed and photographed by laser confocal microscope. The DrAp1-His and Dr1-MBP vectors were constructed for prokaryotic expression for pulldown experiment. After ultrasonic disruption, the supernatant protein was incubated with the corresponding labeled beads to make the target protein gather on the beads, and the DrAp1-His protein was purified. After protein quantification, 5%-10% of the protein was taken as Input. An appropriate amount of Dr1-MBP and MBP proteins combined with Anti-MBP beads was taken, and an equal amount of DrAp1-His protein was added, and after incubation, SDS-PAGE and western blot were performed. The MBP antibody was used to detect the presence or absence of Dr1-MBP protein and MBP protein in the sample and the relationship between the protein amounts, and the His antibody was used to detect the presence or absence of DrAp1-His protein in the sample. The pCAMBIA1305-DrAp1-GFP and pCAMBIA1300-Dr1-Flag vectors were constructed for Co-IP experiment. After being respectively transferred into the rice protoplasts for expression for 48-72 h, Co-IP was performed. Whether DrAp1-GFP was normally expressed was observed by fluorescence microscope, and the protein extraction was performed in the high expression leaf area. Part of the sample was taken as Input, and the rest was incubated with GFP beads, and then SDS loading buffer was added for western blot. The GFP and Flag antibodies were respectively used to detect the presence or absence of the corresponding proteins in the Input sample and the beads sample.

[0027] A series of molecular experiments were used to verify whether OsDr1 and OsDrAp1 derived from Nipponbare could interact. It was found by yeast two-hybrid experiment that only when OsDrAp1 and OsDr1 coexisted, the yeast cells could grow on the four-lack medium Figure 1A). OsDrAp1 coding region combined with MBP tag, OsDr1 coding region combined with GST tag and induced corresponding protein in vitro, MBP as Input, the protein eluted on GST beads was subjected to western blot, and it was found that OsDrAp1-MBP protein could bind with OsDr1-GST protein, while OsDrAp1-MBP protein could not bind with GST protein, proving that there was interaction between the two proteins Figure 1 B). BiFC experiment found that yellow fluorescence could be observed when OsDrAp1 and OsDr1 coexisted Figure 1 C). GFP-OsDr1 and Myc-OsDrAp1 were expressed in rice protoplast system respectively, and Co-IP experiment was performed after total protein extraction, and it was found that GFP-OsDr1 protein could bind with Myc-OsDrAp1 protein, while GFP protein could not bind with Myc-OsDrAp1 protein Figure 1 D). The above experiments prove that OsDrAp1 and OsDr1 have interaction relationship.

[0028] 3. OsDr1 transgenic function verification

[0029] The CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) was used to design a knockout target (SEQ ID NO. 4: GTTCAGCTCACATTTGGGGA) in the main functional domain of OsDr1, the primer was designed and annealed, and then ligated to the CRISPR-Cas9 vector, transformed into E. coli, extracted the plasmid and transformed into Agrobacterium, infected rice (Zhonghua No. 11) callus to construct OsDr1 knockout transgenic materials. The primer was designed to amplify the OsDr1 CDS sequence and the promoter sequence, each material was planted according to 7 strains x 5 rows in a small area, and normal field water and fertilizer management was carried out. After the rice matured, it was artificially harvested, and the stubble height was 15 cm. After 14 days of harvesting, the regeneration bud emergence rate of the remaining 15 single plants in each small area except the edge rows was counted. The regeneration bud germination of OsDrAp1 knockout material was observed, and it was found that the germination rate of the knockout plants was significantly improved, proving that OsDr1 negatively regulates the axillary bud germination of ratooning rice Figure 2 ).

[0030] The above-described embodiments are only descriptions of the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. Application of knocking out OsDr1 gene in promoting axillary bud germination of super rice, characterized in that, The nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO.

3.

2. The use of reducing the expression amount of the protein encoded by the OsDr1 gene in promoting the germination of axillary buds of the super rice, characterized in that, The nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO.

3.

3. A method for promoting the germination of axillary buds of rices of the japonica species, characterized in that, The OsDr1 gene in rice is silenced or knocked out; the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO.

3.

4. Use of the OsDr1 gene in rice breeding, characterized in that, A rice strain with a faster axillary bud germination rate is obtained by screening rice plants with low expression of the OsDr1 gene; the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO.

3.

5. Use of a protein encoded by the OsDr1 gene in rice breeding, characterized in that, A rice strain with a faster axillary bud germination rate is obtained by screening rice plants with low expression of the OsDr1 gene; the nucleotide sequence of the OsDr1 gene is shown as SEQ ID NO.

3.

6. A method of obtaining improved rice having faster axillary bud sprouting rate, the method comprising, The method comprises the following steps: knocking out the OsDr1 gene in rice by using a CRISPR / Cas9 genome editing system.

7. The method of claim 6, wherein, The method comprises the following steps: knocking out the OsDr1 gene in rice by using a CRISPR / Cas9 genome editing system.

Images