Auxiliary diagnosis, prognosis diagnosis or risk stratification circRNA marker for acute myeloid leukemia and application thereof

Abstract

The application belongs to the technical field of biology and relates to a circRNA marker for auxiliary diagnosis, prognosis diagnosis or risk stratification of acute myeloid leukemia and application thereof. The application finds that the expression level of circular RNA hsa_circ_0002782 is significantly increased relative to normal bone marrow samples, indicating that it has great potential as an AML biomarker, which provides a new and possibly more accurate method for early detection of AML, and helps timely intervention and treatment. Through development of a gene detection product based on circular RNA hsa_circ_0002782, the application realizes early diagnosis of AML at the molecular level, and this high-precision diagnostic tool can help doctors identify potential risk patients in the early stage of the disease, thereby providing a more effective personalized medical solution.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to circRNA markers for the auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia and their applications. Background Technology

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous malignant tumor of the hematopoietic system characterized by the arrest of differentiation and clonal proliferation of hematopoietic stem cells and progenitor cells. Chromosomal karyotype analysis is often used to assess the prognosis of AML patients. With the advancement of molecular biology techniques, gene mutations and rearrangements have been widely used clinically. Some molecular mutations, such as NPM1, FLT3-ITD, CEBPA, and c-KIT, have been incorporated into the NCCN and ELN guidelines as markers for AML risk stratification and prognostic assessment. With continuous advancements in medical technology, the discovery of arsenic trioxide and all-trans retinoic acid has enabled the vast majority of acute promyelocytic leukemia (APL) patients to achieve complete cure through combination therapy with these two drugs.

[0003] Despite significant progress in prognostic risk stratification, supportive care, intensive chemotherapy with multiple drugs, and autologous or allogeneic hematopoietic stem cell transplantation (auto / allo-HSCT), the prognosis for adult non-AML-M3 patients remains precarious due to the relapse and refractory nature of AML. In recent years, the advent of multi-kinase inhibitors targeting gene mutations has offered hope; however, long-term follow-up data are lacking. Therefore, there is an urgent need to explore the molecular pathogenesis of AML, identify new therapeutic targets, and discover potential biomarkers for AML stratification. Summary of the Invention

[0004] The purpose of this invention is to address the aforementioned problems in the existing technology by proposing a circular RNA biomarker for the auxiliary diagnosis, prognostic diagnosis, or risk stratification of acute myeloid leukemia (AML), thereby making AML prognostic diagnosis more accurate and rapid.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] A circular RNA biomarker for the auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, wherein the circular RNA biomarker is RNA hsa_circ_0002782 as shown in SEQ ID NO. 1.

[0007] This invention also provides the application of a reagent for detecting the expression level of RNA hsa_circ_0002782 in the preparation of products for the auxiliary diagnosis, prognostic diagnosis, or risk stratification of acute myeloid leukemia.

[0008] In the above applications, the detection reagent for RNA hsa_circ_0002782 expression level includes primers that specifically recognize RNA hsa_circ_0002782.

[0009] In the above applications, the primers that specifically recognize RNA hsa_circ_0002782 include the upstream primer shown in SEQ ID NO. 2 and the downstream primer shown in SEQ ID NO. 3.

[0010] The present invention also provides a product for the auxiliary diagnosis, prognostic diagnosis or risk stratification of acute myeloid leukemia, including primers that specifically recognize RNA hsa_circ_0002782.

[0011] In the aforementioned product for the auxiliary diagnosis, prognostic diagnosis, or risk stratification of acute myeloid leukemia, the primers that specifically recognize RNA hsa_circ_0003141 include the upstream primer shown in SEQ ID NO. 2 and the downstream primer shown in SEQ ID NO. 3.

[0012] The aforementioned product for the auxiliary diagnosis, prognostic diagnosis, or risk stratification of acute myeloid leukemia also includes a primer for the specific recognition of the internal reference GAPDH.

[0013] In the aforementioned product for the auxiliary diagnosis, prognostic diagnosis, or risk stratification of acute myeloid leukemia, the specific identification internal reference GAPDH primer includes the upstream primer shown in SEQ ID NO. 4 and the downstream primer shown in SEQ ID NO. 5.

[0014] In the aforementioned product for the auxiliary diagnosis, prognostic diagnosis, or risk stratification of acute myeloid leukemia, the product is a reagent kit or a gene chip.

[0015] The aforementioned products for the auxiliary diagnosis, prognostic diagnosis, or risk stratification of acute myeloid leukemia also include pharmaceutically acceptable excipients.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] 1. This invention is the first to systematically discover and validate that the expression level of circular RNA hsa_circ_0002782 in bone marrow samples from patients with acute myeloid leukemia (AML) is significantly higher than that in normal controls. Through high-throughput sequencing, qRT-PCR validation, and multicenter clinical sample analysis, it was confirmed that this circular RNA exhibits highly specific and stable upregulation in AML patients, with statistically significant differences in expression, unaffected by fluctuations in common internal reference genes. Compared to traditional diagnostic methods relying on morphology and immunophenotyping, molecular marker-based detection methods offer higher sensitivity and specificity. Especially in the early stages of the disease, before clinical symptoms are fully apparent, abnormal expression of hsa_circ_0002782 can be detected, providing a novel pathway for non-invasive or minimally invasive early screening of AML, contributing to the clinical goal of "early detection and early intervention," and significantly improving the overall survival rate of patients.

[0018] 2. This invention further develops a highly sensitive gene detection product targeting hsa_circ_0002782. This product can achieve early molecular-level diagnosis of AML in blood or bone marrow samples, and is particularly suitable for regular screening of high-risk populations (such as patients with MDS transformation and those at risk of secondary leukemia after radiotherapy and chemotherapy). This detection method is simple to operate, cost-effective, and has good prospects for clinical translation, and is expected to become a supplementary or pre-screening tool in the AML diagnostic process.

[0019] 3. This invention utilizes the circular RNA hsa_circ_0002782 as a biomarker for regular monitoring, which can not only help assess disease progression or treatment response but also adjust individualized treatment plans. This approach improves the efficiency of disease management, enables more rational allocation of medical resources, and reduces the cost of long-term treatment. Attached Figure Description

[0020] Figure 1 The results of first-generation sequencing of the RT-PCR product after using hsa_circ_0002782 in Example 1 are shown.

[0021] Figure 2 Example 1 shows the amplification efficiency of the internal reference GAPDH gene and the target hsa_circ_0002782 gene established based on the AML2 cell line.

[0022] Figure 3 This is a schematic diagram illustrating the upregulation of hsa_circ_0002782 expression in newly diagnosed AML patients and its diagnostic value as detected by quantitative RT-PCR in Example 2.

[0023] Figure 4The expression of hsa_circ_0002782 in Example 2 is related to overall survival and event-free survival in acute myeloid leukemia; where a represents overall survival and b represents event-free survival.

[0024] Figure 5 The results of cell proliferation after knockdown of hsa_circ_0002782 small interfering virus in acute myeloid leukemia cell lines AML2 and NB4 in Example 3 are shown; where a is AML2 and b is NB4.

[0025] Figure 6 The results of apoptosis in the acute myeloid leukemia cell line AML2 after knockdown of hsa_circ_0002782 small interfering virus in Example 3 are shown.

[0026] Figure 7 The results of apoptosis in the acute myeloid leukemia cell line NB4 after knockdown of hsa_circ_0002782 small interfering virus in Example 3 are shown.

[0027] Figure 8 Example 4 shows the screening of AML circRNA microarrays; where A is a hierarchical clustering diagram showing the differences in circRNA expression between the AML group, the ALL group, and the normal control group; B is a scatter plot showing the differences in circRNA expression between the normal control group and the AML group (the area outside the two green lines indicates an expression difference ≥2-fold); C is a volcano plot showing the differences in circRNA expression between the AML group and the normal control group (red dots indicate an expression difference ≥2-fold).

[0028] Figure 9 Example 5 uses receiver operating characteristic (ROC) curves to verify the diagnostic efficacy of hsa_circ_0002782 in AML. Detailed Implementation

[0029] The following are specific embodiments of the present invention, which further describe the technical solution of the present invention, but the present invention is not limited to these embodiments.

[0030] This invention relates to a specific circular RNA, hsa_circ_0002782, and the primer sequences for its specific recognition primer pair and the internal reference gene GAPDH.

[0031] The sequence and primer composition involved in this invention are as follows:

[0032] The circular RNA hsa_circ_0002782 shown in SEQ ID NO. 1:

[0033] .

[0034] To effectively detect and quantify the presence and expression level of hsa_circ_0002782, this invention provides primer pairs specifically recognizing RNA hsa_circ_0002782, including the forward primer shown in SEQ ID No. 2 and the reverse primer shown in SEQ ID No. 3:

[0035] SEQ ID NO.2: CCTGCTGTCACAGAAGCTAATGG;

[0036] SEQ ID NO.3: TGGAGCTGGTTATTTGGGTAGCA;

[0037] These two short sequences were designed to pair with complementary sequences on hsa_circ_0002782, allowing for the amplification and detection of the circular RNA using molecular biology techniques such as PCR (polymerase chain reaction). Primer design considered factors such as specificity, efficiency, and amplification product length to ensure optimal experimental results.

[0038] In gene expression analysis, a stable internal reference gene is usually required to standardize the data and eliminate errors caused by processing procedures or individual differences between samples. The upstream and downstream primers for the internal reference GAPDH provided in this invention are as follows: the forward primer is shown in SEQ ID NO. 4, and the reverse primer is shown in SEQ ID NO. 5.

[0039] SEQ ID NO.4: ATGGGGAAGGTGAAGGTCG;

[0040] SEQ ID NO.5:GGGTCATTGATGGCAACAATATC.

[0041] Using this primer pair, GAPDH mRNA in the sample can be amplified, which can then be used to correct the relative expression level of the target RNA.

[0042] In the following examples, the present invention uses real-time quantitative PCR to detect the expression difference of hsa_circ_0002782 in AML samples, and analyzes the prognosis of AML in the high expression group and the low expression group in combination with clinical information. Therefore, a kit for detecting changes in the expression of this gene can be made for the prognostic diagnosis of AML.

[0043] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below in conjunction with the accompanying drawings and specific embodiments. Unless otherwise specified, the technologies involved in this invention are all conventional molecular biology techniques. The enzymes, reagents, and reaction conditions involved can be reasonably selected based on the experience of those skilled in the art. The reagents and consumables involved are commercially available ordinary products, and the detection methods and instruments involved are also well known and skillfully mastered by those skilled in the art.

[0044] Example 1

[0045] RT-qPCR and sequencing were used to verify the reliability of the hsa_circ_0002782 gene and its primers.

[0046] S1. Cell Collection and Pretreatment

[0047] Collect the in vitro cultured AML2 cell line, wash twice with PBS, add 1 mL of RNAiso Plus reagent (TaKaRa) to the cell clumps, mix thoroughly by pipetting, and store at -80℃ for later use.

[0048] S2, RNA extraction

[0049] Add 200 μL of chloroform directly to the RNAiso Plus lysis buffer from step 1 above, vortex vigorously for 15 seconds, let stand for 10 minutes, and then centrifuge at 12000 g for 15 minutes at 4°C. Transfer the supernatant to a new EP tube, add an equal volume of isopropanol, mix well, let stand for 10 minutes, and then centrifuge at 12000 g for 10 minutes at 4°C. Remove the supernatant, add 1 ml of 75% ethanol, invert and wash, and centrifuge at 12000 g for 5 minutes at 4°C. Remove the supernatant again, add 1 ml of anhydrous ethanol, invert and wash, and centrifuge at 12000 g for 5 minutes at 4°C; remove the supernatant and air dry at room temperature. Add an appropriate volume (20-50 μL) of DEPC water to dissolve the RNA, depending on the amount of RNA precipitate, and measure the RNA concentration (A260 / A280 = 1.8–2.1).

[0050] S3, cDNA reverse transcription

[0051] cDNA reverse transcription was performed using Thermo's RevertAid First Strand cDNA Synthesis Kit. The reverse transcription reaction was carried out according to the formulations shown in Tables 1 and 2 below.

[0052] Table 1: Reagents and Usage Content

[0053]

[0054] Reaction procedure: 65℃, 5 minutes; 4℃, ready for use;

[0055] Table 2: Reaction System

[0056]

[0057] Reaction procedure: 25℃, 5 minutes; 42℃, 60 minutes; 70℃, 5 minutes; 4℃, primers ready;

[0058] Table 3: Primer sequences

[0059]

[0060] S4. Quantitative PCR (qPCR)

[0061] qPCR was used to amplify hsa_circ_0002782 and GAPDH. The amplification was performed using the TaKaRa TB Green™ Premix ExTaq™ II (Tli RNaseH Plus) kit. The experimental procedures were performed according to Table 4 below.

[0062] Table 4: PCR amplification system

[0063]

[0064] The reaction procedure was a three-step method. The standard PCR amplification program was as follows: pre-denaturation at 95°C for 1 min; second step denaturation at 95°C for 15 sec, annealing at 60°C for 30 sec, and extension at 72°C for 32 sec, for 40 cycles. The standard melting curve program was as follows: 95°C for 15 sec; 60°C for 1 min; 95°C for 15 sec; 60°C for 15 sec.

[0065] S5, agarose gel electrophoresis

[0066] GAPDH was used as an internal control, and PCR amplification products were detected by 3% agarose gel electrophoresis. The PCR products were sent to Shanghai Sangon Biotech for sequencing, and sequence alignment confirmed the detection of the hsa_circ_0002782 gene. Figure 1 .

[0067] S6. Using cDNA from AML2 cell line as a template, vortex the PCR amplification product, briefly centrifuge, and progressively dilute it at ratios of 1:100, 1:1000, 1:10000, 1:100000, 1:100000, 1:1000000, and 1:10000000. Perform PCR experiments according to the reaction system and conditions described above for quantitative real-time PCR, obtain the CT value, and plot the amplification efficiency graph. The results are shown in [Figure 6]. Figure 2 The amplification efficiency of the internal control primer GAPDH was 99.71%, and the amplification efficiency of the target gene hsa_circ_0002782 primer was 98.74%, confirming that the primers had good amplification efficiency.

[0068] Example 2

[0069] Quantitative RT-PCR detection of hsa_circ_0002782 expression in bone marrow of patients with acute myeloid leukemia.

[0070] S1. Bone Marrow Specimen Collection and Processing: Bone marrow specimens from 190 patients with AML who were first diagnosed at the First Affiliated Hospital of Ningbo University from June 2016 to June 2023 were collected, along with 21 normal control bone marrow specimens. This study was approved by the Ethics Committee of the First Affiliated Hospital of Ningbo University. Bone marrow specimens were collected from bone marrow cell culture flasks, and patient information was recorded. Mononuclear cells were collected using the Ficoll density gradient centrifugation method. Finally, RNAiso Plus reagent (TaKaRa) was added, and the mixture was repeatedly pipetted and mixed thoroughly before storage at -80℃ for later use.

[0071] S2. RNA extraction: The method is the same as in Example 1;

[0072] S3, cDNA reverse transcription: The method is the same as in Example 1;

[0073] S4. Quantitative PCR amplification: The method is the same as in Example 1;

[0074] S5. Using AML2 cell line as a control, 2 -ΔΔCt The expression level of the hsa_circ_0002782 gene was calculated using the following method: ΔΔCt=[Ct] hsa_circ_0002782 -Ct GAPDH ] 样本 -[Ct hsa_circ_0002782 -Ct GAPDH ] 正常对照 Data were statistically analyzed using SPSS 26 software. Fisher's exact test was used to compare differences between groups, and Kaplan-Meier and Log-rank tests were used to analyze differences in survival data between groups. A p-value < 0.05 was considered statistically significant. Figure 3 It can be seen that hsa_circ_0002782 is abnormally highly expressed in newly diagnosed AML.

[0075] S6. The correlation between hsa_circ_0002782 and clinical characteristics was analyzed, and the results are shown in Table 5. The results showed that there was no statistically significant correlation between hsa_circ_0002782 and white blood cells, platelets, bone marrow blasts, hemoglobin, etc. However, the complete remission rate of the low hsa_circ_0002782 expression group (74.1%) was significantly higher than that of the high hsa_circ_0002782 expression group (48.7%). This indicates that hsa_circ_0002782 plays an independent role in AML and may be related to prognosis.

[0076] Table 5: Relationship between hsa_circ_0002782 expression level and different clinical indicators in AML patients

[0077]

[0078] S7. Analyze the relationship between hsa_circ_0002782 and AML prognosis, from... Figure 4 The results showed that AML with high expression of hsa_circ_0002782 had worse overall survival and event-free survival, indicating a poor prognosis.

[0079] S8. Multivariate analysis of the relationship between hsa_circ_0002782 and AML prognosis, results are shown in Tables 6 and 7. The results indicate that hsa_circ_0002782 expression can serve as an independent prognostic factor for AML.

[0080] Table 6: Multivariate analysis of overall survival and prognosis in AML patients

[0081]

[0082] Table 7: Multivariate analysis of event-free survival in AML patients

[0083]

[0084] Example 3

[0085] In vitro experiments to verify the effect of hsa_circ_0002782 on the growth of acute myeloid leukemia cells

[0086] S1. Synthesize the hsa_circ_0012152 small interfering RNA lentiviral vector (sh-hsa_circ_0002782) and irrelevant lentiviral sequences (negative control), as shown in Table 8. This lentiviral vector is labeled with a puromycin-resistant marker. Transfect the acute myeloid cell line AML2 and cell line NB4 with the lentiviral vector and select with puromycin to construct a stable sh-hsa_circ_0012152 cell line. Compared with the negative control cell line, the cell growth of the sh-hsa_circ_0012152 transfected cell line was inhibited, as shown in Table 8. Figure 5 .

[0087] Table 8: Lentiviral Sequences

[0088]

[0089] S2. Cell lines were labeled with Annexin V-APC / 7-AAD and apoptosis was detected by flow cytometry. Results are shown below. Figure 6 , 7 It can be seen that the apoptosis rate (Q2+Q4) of the sh-hsa_circ_0002782 group was significantly higher than that of the negative control group.

[0090] Example 4

[0091] Bone marrow mononuclear cells from 3 normal controls, 3 newly diagnosed acute lymphoblastic leukemia patients, and 5 newly diagnosed acute myeloid leukemia patients were collected for circRNA microarray screening. Figure 8 The results showed that 255 circRNAs were upregulated (FC≥2, p<0.05) compared with the normal control. Based on gene expression abundance and upregulation fold, hsa_circ_0002782 was selected as the target gene.

[0092] Example 5

[0093] To validate the expression and diagnostic efficacy of hsa_circ_0002782 in newly diagnosed AML patients and healthy individuals. One hundred bone marrow samples from newly diagnosed AML patients and 20 bone marrow samples from healthy controls were collected. Each sample was processed using the same method as in Example 1, and the expression level of hsa_circ_0002782 in each sample was calculated. Figure 3 The results showed that hsa_circ_0002782 was significantly upregulated in patients with acute myeloid leukemia (AML) compared to healthy individuals (control group). Its diagnostic efficacy in AML was analyzed using recipient operation-specific curves (ROC curves) (see...). Figure 9 The AUC value was 0.963, sensitivity was 0.90, and specificity was 0.95. The analysis results indicate that hsa_circ_0002782 can serve as a novel molecular marker for the auxiliary diagnosis of AML.

[0094] Based on the above results, this invention, using clinical samples for validation, identified a novel prognostic gene for acute myeloid leukemia (AML), hsa_circ_0002782. Multivariate regression analysis revealed the relative expression level of hsa_circ_0002782, indicating that hsa_circ_0002782 promotes cell growth in AML and acts as an oncogene. Especially when combined with clinical indicators, it exhibits good predictive value and can be applied to the preparation of reagents or kits for the prognostic diagnosis of AML patients.

[0095] The embodiments herein cover any points not exhaustively within the scope of the technical claims of this invention, as well as new technical solutions formed by equivalent substitutions of one or more technical features in the embodiments. These are all within the scope of the claims of this invention. Furthermore, in all listed or unlisted embodiments of this invention, each parameter in the same embodiment merely represents an instance (i.e., a feasible solution) of its technical solution, and there is no strict coordination or limitation relationship between the parameters. The parameters can be substituted for each other without violating axioms and the claims of this invention, unless otherwise stated.

[0096] The technical means disclosed in this invention are not limited to those described above, but also include technical solutions composed of any combination of the above technical features. The above descriptions are specific embodiments of this invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications are also considered within the scope of protection of this invention.

[0097] The specific embodiments described herein are merely illustrative of the spirit of the invention. Those skilled in the art to which this invention pertains may make various modifications or additions to the described specific embodiments or use similar methods to substitute them, without departing from the spirit of the invention or exceeding the scope defined by the appended claims.

Claims

1. Application of an RNA hsa_circ_0002782 expression level detection reagent in the preparation of products for the auxiliary diagnosis and prognosis of acute myeloid leukemia; The RNA hsa_circ_0002782 expression level detection reagent comprises primers specifically recognizing RNA hsa_circ_0002782; The primers specifically recognizing RNA hsa_circ_0002782 comprise an upstream primer shown in SEQ ID No. 2 and a downstream primer shown in SEQ ID No.

3. The RNA hsa_circ_0002782 sequence is shown in SEQ ID No. 1.

Images