Castration CMV virus-like particle subunit vaccine and preparation method thereof

Abstract

The invention relates to a castrated CMV virus-like particle subunit vaccine and a preparation method thereof. The invention provides the GnRH-I-CMV recombinant protein which is high in purity and good in specificity. A vaccine prepared from the GnRH-I-CMV recombinant protein is high in antigen purity, good in safety and good in castration effect.

Description

Castration-resistant CMV virus-like particle subunit vaccine and preparation method thereof

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biotechnology, in particular to a castrated CMV virus-like particle subunit vaccine and a preparation method thereof. Background Art

[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.

[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can increase gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promote the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), and promote follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.

[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated components. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, in turn inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.

[0006] Cucumber mosaic virus (CMV), a representative member of the genus Cucumovirus in the family Bromoviridae, is an icosahedral, single-stranded, positive-sense RNA virus with a diameter of approximately 28 to 30 nm. Studies have shown that non-infectious nanoparticles made from recombinant CMV CP resemble wild-type virus purified from plants in shape and appearance. CMV vaccine platforms, due to their ability to induce long-lasting memory responses to antigens fused to their surface, have been applied to vaccine platform technology to enhance the immunogenicity of peptide antigens fused to nanoparticle structures. However, there are no reports on how to construct a GnRH castration vaccine using CMV.

[0007] Summary of the Invention

[0008] In view of this, the technical problem to be solved by the present invention is to provide a castrated CMV virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.

[0009] The present invention provides a GnRH-VLP recombinant protein, which comprises GnRH and a capsid protein of cucumber mosaic virus.

[0010] The GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0011] The capsid protein of the cucumber mosaic virus (CMV) has an amino acid sequence as shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced on the basis of the amino acid sequence shown in SEQ ID NO: 5; or a sequence with a homology of more than 90% to the amino acid sequence shown in SEQ ID NO: 5.

[0012] In some embodiments, the GnRH-VLP recombinant protein provided by the present invention has the following structure from N-terminus to C-terminus:

[0013] Sequentially linked to GnRH and the capsid protein of cucumber mosaic virus

[0014] Alternatively, the capsid protein of cucumber mosaic virus, G4S, LPETG, GGGGG and GnRH-I are linked in sequence.

[0015] The present invention also provides:

[0016] 1), a nucleic acid encoding the GnRH-VLP recombinant protein;

[0017] II), an expression unit containing a nucleic acid encoding GnRH-VLP;

[0018] III), a recombinant vector containing a nucleic acid encoding GnRH-VLP or an expression unit as described above;

[0019] IV), transforming or transfecting host cells with an expression vector for GnRH-VLP;

[0020] V) The culture product of the host cells as described above.

[0021] The nucleic acid can be DNA, RNA, cDNA or PNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (such as promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be, for example, a part of a vector (such as an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc. The gene sequence can use a wild-type sequence or can be codon-optimized, and the present invention is not limited to this. The nucleic acids of the present invention encode GnRH and CMV respectively. The nucleic acid encoding CMV is a nucleic acid encoding the full length or partial fragment of CMV. In some embodiments, the codon-optimized CMV encoding nucleic acid is recorded as CMV opt , whose nucleic acid sequence is shown in SEQ ID NO: 7.

[0022] The present invention provides expression units comprising GnRH and CMV. These expression units comprise the nucleic acids described herein, either singly or in tandem, with a promoter and terminator, but are not limited thereto. In some embodiments, the CMV expression unit further comprises a linker and an LPETG fragment, wherein the linker is G4S. The GnRH expression unit further comprises a GGGGG fragment.

[0023] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for expression of the operably linked coding gene in a specific host organism. Nucleic acid sequences or elements necessary for expression in bacteria include promoters, ribosome binding sites, and possibly other sequences. The recombinant expression vector is selected based on the host. The expression vector described in the present invention may be circular or linear, and this is not limited in the present invention. Taking a prokaryotic host as an example, it may be Escherichia coli, Bacillus, Streptomyces, or Cyanobacteria; its backbone vector may be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid, or a pcDNA series plasmid (e.g., pcDNA3.1). For example, the recombinant backbone vector is a pET series vector, and optionally, the backbone vector of the recombinant vector is pET-21(+), pET-24(+), pET32a, pET-23(+), or pET-28a(+).

[0024] The construction of the recombinant vector provided by the present invention comprises cloning the nucleic acid fragment encoding the fusion protein as described above into an expression vector by homologous recombination method.

[0025] In some embodiments, the present invention provides a recombinant plasmid CMV-pET28a, which is obtained by cloning the nucleotide sequence shown in SEQ ID NO. 5 into the NdeI site and XhoI site of the prokaryotic expression vector pET28a by homologous recombination.

[0026] In other embodiments, the present invention provides a recombinant plasmid GnRH-I Q -pcDNA3.1, the recombinant plasmid GnRH-I Q -pcDNA3.1 is obtained by cloning the nucleotide sequence shown in SEQ ID NO. 3 into the HindIII site and EcoRI site of the eukaryotic expression vector pcDNA3.1 by homologous recombination.

[0027] In other embodiments, the present invention also provides a recombinant plasmid CMV opt -LPETG-pET32a, the recombinant plasmid CMV opt -LPETG-pET32a was obtained by cloning the nucleotide sequence shown in SEQ ID NO. 7 into the BamHI site and XhoI site of the prokaryotic expression vector pET32a by homologous recombination.

[0028] In other embodiments, the present invention also provides a recombinant plasmid GGGGG-GnRH-I E -pcDNA3.1, the recombinant plasmid GGGGG-GnRH-I E -pcDNA3.1 was obtained by adding five glycine sequences to the N-terminus of the nucleotide sequence shown in SEQ ID NO.4 to obtain the nucleotide sequence shown in SEQ ID NO.9, and cloning it into the HindIII site and EcoRI site of the eukaryotic expression vector pcDNA3.1 by homologous recombination.

[0029] Furthermore, the present invention also provides a host cell transformed or transfected with the aforementioned recombinant vector, or with the aforementioned nucleic acid integrated into its genome.

[0030] The host described in the present invention includes bacteria, fungi, viruses or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeasts include Saccharomyces cerevisiae, Saccharomyces cerevisiae, Pichia pastoris, and Candida. The viruses include but are not limited to adenoviruses, adeno-associated viruses, lentiviruses, and prions. The animals include humans, mice, rabbits, pigs, zebrafish, and the like. The expression of the nucleic acid encoding the recombinant protein in the host can be either integrated or episomal, and the present invention does not limit this. In the embodiment of the present invention, CMV is expressed using Escherichia coli as the host, and GnRH-I is expressed using HEK293f as the host.

[0031] Furthermore, the present invention also provides a culture product of the host cell.

[0032] The method for preparing the GnRH-I-CMV recombinant protein of the present invention comprises: culturing the host cell as described above to obtain a culture product containing the recombinant protein;

[0033] Alternatively, the method comprises preparing GnRH-I protein and capsid protein of cucumber mosaic virus separately, and obtaining the recombinant protein through coupling.

[0034] As described above, the method for preparing the fusion protein includes:

[0035] GnRH-I protein and CMV protein were prepared separately, and fusion protein was obtained by coupling.

[0036] Or include:

[0037] (1) GnRH-I Q The decapeptide gene fragment was directly synthesized and cloned into the pcDNA3.1 eukaryotic expression vector to obtain the positive recombinant plasmid GnRH-I Q -pcDNA3.1, expressed and purified GnRH-I in HEK293f cells Q recombinant proteins;

[0038] (2) The CMV coat protein gene shown in SEQ ID NO. 5 (GenBank: AF523352.1) was cloned into the prokaryotic expression vector pET28a to obtain the recombinant expression vector CMV-pET28a, and the recombinant expression vector was transformed into the Escherichia coli C2566 expression strain to express the CMV recombinant protein;

[0039] (3) Using chemical coupling catalytic coupling method to GnRH-I Q GnRH-I was obtained by coupling protein with CMV protein. Q -CMV virus-like particles.

[0040] GnRH-I was expressed as a recombinant HEK293f Q In a preferred embodiment of the method for preparing recombinant protein, the eukaryotic expression vector is pcDNA3.1.

[0041] As a preferred embodiment of the method for preparing CMV virus-like particles expressed by recombinant Escherichia coli, the prokaryotic expression vector is pET28a.

[0042] As a preferred embodiment of the method for preparing recombinant CMV virus-like particles, the recombinant expression strain CMV-pET28a-C2566 is cultured to an OD of 600 When the expression level reaches 0.8-1.0, IPTG with a final concentration of 1 mM is added to induce expression.

[0043] Or include:

[0044] (1) In GnRH-I E The 10-peptide gene was synthesized by adding 5 glycine sequences to the N-terminus, and the fragment was directly cloned into the pcDNA3.1 eukaryotic expression vector to obtain the positive recombinant plasmid GGGGG-GnRH-I. E -pcDNA3.1, expressed in HEK293f cells and purified to obtain GGGGG-GnRH-I E recombinant proteins;

[0045] (2) Add LPETG sequence to the N-terminus of CMV coat protein gene (GenBank: AF523352.1), and clone the synthesized fragment into prokaryotic expression vector pET32a to obtain recombinant expression vector CMV opt -LPETG-pET32a, and transform the recombinant expression vector into Escherichia coli BL21 (DE3) expression strain to express CMV opt -LPETG recombinant protein;

[0046] (3) GGGGG-GnRH-I was synthesized by protease catalysis. E Protein and CMV opt -LPETG protein coupling to obtain CMV opt -GnRH-I E Virus-like particles.

[0047] As a preferred embodiment of the method for preparing the recombinant HEK293f expressing GGGGG-GNRH-I recombinant protein, the eukaryotic expression vector is pcDNA3.1.

[0048] As a recombinant E. coli expressing CMV opt -A preferred embodiment of the method for preparing LPETG virus-like particles, wherein the prokaryotic expression vector is pET32a.

[0049] As recombinant CMV opt -LPETG virus-like particles preparation method preferred embodiment, the recombinant expression strain CMV opt -LPETG-pET32a-BL21(DE3) cultured to OD 600 When the expression level reaches 0.8-1.0, IPTG with a final concentration of 1 mM is added to induce expression.

[0050] GnRH-I was expressed as a recombinant HEK293f E In a preferred embodiment of the method for preparing recombinant protein, the eukaryotic expression vector is pcDNA3.1.

[0051] As a preferred embodiment of the method for preparing CMV virus-like particles expressed by recombinant Escherichia coli, the prokaryotic expression vector is pET28a.

[0052] As a preferred embodiment of the method for preparing recombinant CMV virus-like particles, the recombinant expression strain CMV-pET28a-C2566 is cultured to an OD of 600 When the expression level reaches 0.8-1.0, IPTG with a final concentration of 1 mM is added to induce expression.

[0053] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention are used in the preparation of subunit vaccines.

[0054] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration CMV virus-like particle subunit vaccine, which includes the recombinant protein as described above. The vaccine is a castration vaccine for male animals. The male animals are animals that can be castrated, including birds and mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, they are felines, canines, or rodents, such as mice. The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant, or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.

[0055] Furthermore, the method for preparing the subunit vaccine comprises mixing the recombinant protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.

[0056] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Accordingly, the present invention also provides a method for castrating animals, comprising administering the vaccine as described above. The administration method includes injection. In the present invention, the castration includes increasing the level of GnRH antibodies, reducing testosterone levels, reducing testicular volume and / or weight, and preventing animal pregnancy. In the present invention, the dosage administered is 200 μg. 10 to 100 days after immunization, the anti-GnRH recombinant protein antibody titer and testosterone level decreased.

[0057] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 3.52% of the original level.

[0058] In some tests, the weight of the mouse testicles was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, and 80% to 90%. In a specific embodiment, the weight of the mouse testicles was reduced to 18.53% of the original level.

[0059] In some tests, the testicular volume of the cat is reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the testicular volume of the cat is reduced to 90.13% of the original level.

[0060] The beneficial effects of the present invention are as follows:

[0061] First, CMV is the cucumber mosaic virus. The viral capsid protein has the ability to self-assemble into nanoparticles. It is non-infectious and has strong antigenic immunity.

[0062] Second, the antigen expressed in tandem with CMV virus-like particles showed high antigenicity, inducing high levels of specific antibodies in mice, rats, cats, dogs, and horses, and a rapid humoral immune response;

[0063] Third, the GnRH-I-CMV virus-like particles of the present invention are expressed in large quantities by HEK293f cells and Escherichia coli, the production process is simple, and the purity of the GnRH-I-CMV virus-like particles is high;

[0064] Fourth, the GnRH-I protein of the present invention is suitable for vaccine preparation: The 293f recombinant expression cell line selected in the present invention provides a eukaryotic expression environment, overcoming the potential for protein misfolding and loss of function in E. coli-expressed proteins due to the lack of specialized cofactors, molecular chaperones, and post-translational modifications. These factors disrupt protein-protein interactions within eukaryotic multi-subunit complexes, surface receptors, and secreted proteins. 293F cells are a suspension cell culture-adapted cell line derived from HEK293 cells. Expression is achieved by transient transfection of cells using an inexpensive reagent formulated with branched PEI via endocytosis. This method is suitable for both small-scale (30 mL) and large-scale (300 mL) cell transfections, yielding high yields of purified protein.

[0065] Fifth, CMV virus-like particles are connected to GnRH-I protein in vitro. The conditions are easy to control, the connection efficiency is high, the yield is higher than that of chimeric expression, it is easy to operate, and it is convenient for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. For those skilled in the art, other implementation drawings can be derived from the provided drawings without inventive effort:

[0067] FIG1 is a schematic diagram of the recombinant plasmid provided in an embodiment of the present invention, wherein A is GnRH-I Q A is a schematic diagram of the recombinant plasmid after the gene is connected to the pcDNA3.1 plasmid; B is a schematic diagram of the recombinant plasmid after the CMV gene is connected to the pET28a plasmid; C is a GNRH-I with GGGGG added to the N-terminus E Schematic diagram of the recombinant plasmid after the gene was connected to the pcDNA3.1 plasmid; D is a schematic diagram of the recombinant plasmid after the codon-optimized CMV gene C-terminus was connected to the LPETG amino acid and then connected to the pET32a plasmid;

[0068] FIG2 is a schematic diagram of GnRH-I-CMV virus-like particles and SDS-PAGE provided in an embodiment of the present invention;

[0069] Figure 3 shows the antibody titers in mice immunized with GnRH-I-CMV;

[0070] FIG4 shows the testosterone levels in mouse serum;

[0071] Figure 5 shows the testicular weights of mice in each group;

[0072] Figure 6 shows the changes in testicular volume of male cats in each group. DETAILED DESCRIPTION

[0073] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0074] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0075] The molecular biological experimental methods such as enzyme digestion and homologous recombination ligation used in the embodiments of the present invention can be referred to the second edition of "Molecular Cloning". The basic materials for preparing the GnRH-I-CMV virus-like particles of the present invention include: CMV coat protein gene nucleotide sequence (GenBank: AF523352.1), GnRH-I nucleotide sequence (SEQ ID NO.3 or SEQ ID NO.4), pET28a plasmid, pET32a plasmid, pcDNA3.1 plasmid, C2566, BL21 (DE3) Escherichia coli strain, Biyuntian TEV Protease, Tiangen Plasmid Mini-Extraction Kit, LB culture medium, IPTG, kanamycin, nickel column and imidazole, etc. The nucleotide sequence was sent to BGI to synthesize GnRH-I Q -pcDNA3.1, CMV-pET28a, GGGGG-GnRH-I E -pcDNA3.1 and CMV opt -LPETG-pET32a recombinant plasmid.

[0076] The sequences involved in the present invention include:

[0077] GnRH, also referred to herein as GnRH-I, has an amino acid sequence of:

[0078] QHWSYGLRPG (SEQ ID NO: 1, denoted as GnRH-I Q )

[0079] or EHWSYGLRPG (SEQ ID NO: 2, denoted as GnRH-I E )

[0080] The nucleic acid sequence encoding GnRH-1 is:

[0081] CAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO.3, encoding GnRH-I Q )

[0082] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4, encoding GnRH-I E )

[0083] The amino acid sequence of the CMV protein is:

[0084] The wild-type nucleic acid sequence encoding the CMV protein is:

[0085] Codon-optimized CMV (CMV opt ) nucleotide sequence:

[0086] CMV opt -linker-LPETG nucleotide sequence:

[0087] GGGGG-linker-GnRH nucleotide sequence:

[0088] The present invention provides a GnRH-I-CMV virus-like particle, firstly GnRH-I Q The gene was expressed in eukaryotic cells HEK293f using the pcDNA3.1 vector, and the CMV coat protein gene (GenBank: AF523352.1) was cloned into the prokaryotic expression vector pET28a to obtain a recombinant expression vector, which was then transformed into the Escherichia coli C2566 expression strain. The expression of the transformed Escherichia coli C2566 was obtained; then, GnRH-I was chemically coupled to the GnRH-I Q GnRH-I was obtained by coupling protein with CMV protein. Q -CMV virus-like particles for the preparation of GnRH-I Q -CMV virus-like particle subunit vaccine. The amino acid sequence of CMV is SEQ ID NO.5.

[0089] Alternatively, the present invention provides a CMV opt -GnRH-I EThe virus-like particles are prepared by adding the LPETG amino acid sequence (SEQ ID NO.8) to the C-terminus of the codon-optimized CMV coat protein gene shown in SEQ ID NO.7, cloning the sequence into the prokaryotic expression vector pET32a to obtain a recombinant expression vector, transforming the recombinant expression vector into an Escherichia coli BL21 (DE3) expression strain, expressing the transformed Escherichia coli BL21 (DE3) and purifying the recombinant protein; and E The GGGGG amino acid sequence (SEQ ID NO.9) was added to the N-terminus of the gene and expressed in eukaryotic cells HEK293f using the pcDNA3.1 vector. Then, the GGGGG-GnRH-I was converted to GGGGG-GnRH-I using the transpeptidase Sortase A. E Protein and CMV opt -LPETG protein coupling to obtain CMV opt -GnRH-I E Virus-like particles for the preparation of CMV opt -GnRH-I E Subunit vaccines.

[0090] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:

[0091] Example 1

[0092] Provide a CMV virus-like particle for preparing GnRH-I Q -CMV virus-like particles and immune comparison experiment, the virus-like particles are obtained by expressing the CMV-pET28a recombinant plasmid formed by connecting the cucumber mosaic virus CMV gene with the pET28a plasmid through an expression strain.

[0093] Specifically, the papaya mosaic virus (CMV) gene was directly synthesized by BGI between the NdeI and XhoI sites of the pET28a vector to generate the recombinant plasmid CMV-pET28a. The expression strain used was the Escherichia coli C2566 expression strain. The CMV-pET28a-C2566 recombinant expression strain was selected using 50 μg / ml of kanamycin.

[0094] The above-mentioned method for preparing CMV virus-like particles comprises the following steps:

[0095] (1) Construction of recombinant plasmid: The papaya mosaic virus (CMV) gene was ligated with the pET28a plasmid to construct the CMV-pET28a recombinant plasmid;

[0096] (2) Transforming the recombinant plasmid into an expression strain: Transforming the CMV-pET28a recombinant plasmid into the Escherichia coli C2566 expression strain to obtain the recombinant expression strain CMV-pET28a-C2566;

[0097] (3) Bacterial culture and purification of CMV virus-like particles: The recombinant expression strain CMV-pET28a-C2566 was cultured, and the biomass was separated by centrifugation to obtain CMV virus-like particles.

[0098] Specifically, the steps of plasmid sequencing and extraction are as follows:

[0099] (a1) Use a pipette to inoculate 5 μL of the glycerol stock containing the plasmid into 5 mL of 2YT medium (containing 50 μg / mL kanamycin). Incubate with shaking at 37°C for 14–16 hours. Make a replicate (send the replicates to a sequencing company for sequencing).

[0100] (a2) Centrifuge one of the tubes at 10,000 × g for 1 min at room temperature to collect the cells and remove as much of the supernatant as possible.

[0101] (a3) Add 250 μl of Buffer A1 (make sure RNase A is added) and thoroughly resuspend the bacterial cells by pipetting or vortexing.

[0102] (a4) Add 250 μl of Buffer B1, gently invert 5-10 times to mix, and let stand for 2-5 minutes until the solution becomes viscous and clear.

[0103] (a5) Add 350 μl of Buffer N1 and immediately invert several times until the solution is thoroughly mixed and a white flocculent precipitate appears.

[0104] (a6) Transfer the centrifuge tube to a high-speed centrifuge and centrifuge at 13,000 rpm for 10 min at room temperature (if there is a white precipitate in the supernatant, centrifuge again);

[0105] (a7) Add 500 μl DNA Wash Buffer (make sure anhydrous ethanol has been added) to the spin column. Centrifuge at 13,000 rpm for 1 min at room temperature. Discard the waste liquid from the collection tube and return the spin column to the collection tube.

[0106] (a8) Place the spin column back into the high-speed centrifuge and centrifuge with the lid open at 13,000 rpm at room temperature for 2 min to completely remove any residual ethanol.

[0107] (a9) Transfer the spin column to a new 1.5 mL centrifuge tube. Add 50–100 μl (volume > 50 μl) of ddH2O (pH 7.0–8.5) or Elution Buffer to the center of the DNA column. Incubate at room temperature for 2 minutes. Centrifuge at 13,000 rpm for 1 minute to elute the plasmid DNA.

[0108] The sequencing feedback results are correct.

[0109] Specifically, the steps for transforming C2566 competent cells are as follows:

[0110] (c1) Remove 4 tubes of competent C2566 and thaw on ice for 5 min;

[0111] (c2) Add 5 μL of each extracted plasmid to the competent cells and incubate on ice for 30 min;

[0112] (c3) heat shock in a 42°C water bath for 1 min;

[0113] (c4) Take out and place on ice for 5 min;

[0114] (c5) Add 900 μL of 2YT liquid medium and incubate for 1 h (37°C, 225 rpm);

[0115] (c6) Take 100 μL of each plate (containing kanamycin resistance).

[0116] Specifically, the steps for preparing 2YT medium are as follows:

[0117] (d1) adding 16 g of Bacto trypsin;

[0118] (d2) adding 10 g of Bacto yeast extract;

[0119] (d3) adding 5 g of NaCl;

[0120] (d4) adjusting the pH to 7.0 with 5 M NaOH;

[0121] (d5) Adjust to 1 L with distilled water;

[0122] (d6) or use pre-mixed powders, sterilized by autoclaving;

[0123] Specifically, the steps of inducing expression of the CMV-pET28a recombinant expression strain are as follows:

[0124] (e1) Select a single colony and place it in 50 mL of culture medium (kanamycin 50 mg / L) for 4 h.

[0125] (e2) Add 50 mL of bacterial suspension to 800 mL of culture medium (kanamycin 50 mg / L) and culture at 30°C with shaking at 200 rpm until OD 600 =0.8;

[0126] (e3) Add 0.2 mM IPTG and culture at 25°C for 24 h with shaking at 200 rpm;

[0127] (e4) Collect the cells for 10 min at 4500 rpm.

[0128] Specifically, the steps for purifying CMV virus-like particles are as follows:

[0129] (f1) Ultrasonic disruption of bacterial cells for 45 min, 3 s on, 4 s off, power 125 W. After sonication, ultrasonication was continued at 9500 rpm for 20 min at 4°C, and the supernatant was collected.

[0130] (f2) preparing sucrose solutions of 30% (w / v) and 60% (w / v) (mass ratio of sucrose to water) and ultracentrifuging them at 26,500 rpm in a swinging bucket rotor at 4°C for 3 h. Collecting the interlayers and the precipitate;

[0131] (f3) To remove sucrose, Tris-HCl-NaCl buffer (50 mM Tris-HCl, pH = 8.4, 20 mM NaCl) can be added for secondary ultracentrifugation. Centrifuge at 30,000 rpm in a swinging rotor at 4°C for 3 h. Collect the interlayers and precipitate, and ultrafilter the target protein using a 30 kDa ultrafiltration tube and replace it with PBS solvent to obtain CMV virus-like particles.

[0132] Example 2

[0133] Provide a GnRH-I Q Recombinant protein preparation method for preparing GnRH-I Q -CMV virus-like particles and immune comparison experiments, the specific implementation methods include:

[0134] (1) Construction of recombinant plasmid: The nucleotide sequence shown in SEQ ID NO.3 was sent to BGI for synthesis of GNRH-I Q -pcDNA3.1 recombinant plasmid;

[0135] (2) GnRH-I Q Expression of GnRH-I Q -pcDNA3.1 recombinant plasmid was transformed into HEK293f expression cell line to obtain GnRH-I Q -pcDNA3.1 recombinant expression cell line;

[0136] (3) Cell culture and GnRH-I Q Protein purification: Cultivation of the GNRH-I Q -pcDNA3.1 recombinant expression cell line, centrifugation to separate the supernatant, the supernatant was purified by nickel column to obtain GnRH-I Q protein;

[0137] Specifically, in step (1), the GnRH-I Q -pcDNA3.1 recombinant plasmid was transformed into bacterial DH5α competent cells, and then the extracted plasmid was transfected into HEK293f cells using PEI, and then GnRH-I was obtained by screening with bleomycin. Q -pcDNA3.1 recombinant expression cell line HEK293f.

[0138] Preparation of GnRH-I in the embodiment of the present invention Q The basic materials of protein include: GnRH-I Q Protein CDS sequence, pcDNA3.1 plasmid, PEI transfection reagent, Tiangen plasmid miniprep kit and HEK293f cells. Q The protein CDS sequence was sent to a gene company to synthesize GnRH-I Q -pcDNA3.1 recombinant plasmid. Plasmid sequencing and extraction procedures are the same as above.

[0139] Specifically, HEK293f cells in the logarithmic growth phase were sampled and counted to ensure that the cell quantity was sufficient and the viability was above 95% for transient transfection. The extracted plasmid was transfected into HEK293f cells as follows:

[0140] (1) Centrifuge the cells and replace the medium one day before transient transfection;

[0141] (2) Collect a certain amount of cell suspension according to experimental requirements and centrifuge at 1000 rpm for 5 min at room temperature;

[0142] (3) Gently resuspend the cells in RPMI1640 containing 0.1% F68 to a certain cell density;

[0143] (4) Take a 1.5 mL sterile EP tube and add a certain concentration of plasmid as needed. After it is fully mixed, add it to a certain amount of PEI, mix well and let it stand for 5 minutes;

[0144] (5) Add the DNA / PEI complex to the cell suspension to fully mix the DNA / PEI complex and cells;

[0145] (6) Place in a shaker at 37°C, 180 rpm, and culture for 3 h. Then, add EXCELL293 serum-free medium and continue culturing.

[0146] (7) Collect samples every day, test cell density and viability, and stop collecting samples when the cell viability is lower than 50%.

[0147] Specifically, GnRH-I Q The protein purification steps are as follows:

[0148] (1) The harvested cell culture medium was centrifuged at 4000 rpm for 20 min at room temperature, and the supernatant was collected and filtered through a 0.45 μm filter membrane;

[0149] (2) Rinse the nickel column with 10 column volumes of ultrapure water and then equilibrate the nickel column with 20 column volumes of PBS;

[0150] (3) Sample loading (can be repeated twice);

[0151] (4) 25 mM imidazole wash for 5 column volumes;

[0152] (5) 5 column volumes of 50 mM imidazole wash;

[0153] (6) 100 mM imidazole elution for 5 column volumes;

[0154] (7) 250 mM imidazole elution for 5 column volumes;

[0155] The protein-containing imidazole solution was concentrated to obtain high-purity GNRH-I protein.

[0156] Example 3

[0157] Provide a GnRH-I Q -CMV virus-like particles for subsequent immunization. The CMV virus-like particles and the GnRH-I Q The protein was coupled to GnRH-I by chemical coupling reagents ethyl-N, N-dimethylpropylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS). Q -CMV followed by mixing with aluminum hydroxide adjuvant to obtain GnRH-I Q -CMV vaccine.

[0158] Specifically, CMV virus-like particles are combined with GnRH-I Q The protein was prepared as GnRH-I by coupling with chemical coupling reagents EDC and NHS. Q -CMV, the steps are as follows:

[0159] CMV virus-like particles and GnRH-I Q The protein was replaced with 25 mM HEPES (pH = 7) buffer, and CMV and GnRH-I QThe mixture was mixed at a molar ratio of 1:1, and a 0.2 M EDC-0.4 M NHS mixture was added thereto. The mixture was reacted at 25°C for 24 h. 1 mM methylamine was added to terminate the coupling. The mixture was ultrafiltered using a 30 KDa ultrafiltration tube, and the buffer solution was replaced with PBS. The coupling effect was detected by SDS-PAGE.

[0160] See Figure 3, for GnRH-I Q A conjugated band (~27 kDa) was generated on the surface of VLPs by chemical cross-linking agents, which is GnRH-I. Q -CMV virus-like particles.

[0161] Example 4

[0162] Provide a CMV opt -G4SLPETG virus-like particles for the preparation of CMV op t-GnRH-I E Virus-like particles and immune comparison experiments, the virus-like particles are in cucumber mosaic virus CMV opt The CMV gene was formed by adding the G4SLPETG amino acid sequence to the C-terminus and ligating it to the pET32a plasmid. opt -G4S-LPETG-pET32a recombinant plasmid was obtained by expression of expression strain.

[0163] Specifically, the cucumber mosaic virus CMV opt -G4SLPETG gene (SEQ ID NO.5) was directly synthesized by BGI between BamHI and XhoI sites of pET32a vector to obtain recombinant plasmid CMV opt -G4SLPETG-pET32a; the expression strain used was Escherichia coli BL21 (DE3) expression strain. CMV was obtained by screening with 50 μg / ml concentration of kanamycin opt -G4SLPETG-pET32a-BL21(DE3) recombinant expression strain.

[0164] The above CMV opt -G4SLPETG virus-like particles were prepared in the same manner as in Example 1. CMV was dissolved in PBS according to the instructions. opt -G4SLPETG virus-like particles were digested with TEV protease overnight at 4°C, and the His-Trx tag was bound to the filler using a Ni column. The effluent was CMV opt -G4SLPETG virus-like particles.

[0165] Example 5

[0166] Provide a GGGGG-GnRH-I ERecombinant protein preparation method for preparing CMV opt -GnRH-I E Virus-like particles and immune comparison experiments, specific implementation methods include:

[0167] (1) Construction of recombinant plasmid: GnRH-I shown in SEQ ID NO.4 E The sequence is His-MBP-G4SG4S-TEV site-GGGGG-G4SG4S-GnRH-I E The sequence was sent to BGI for synthesis of MBP-GGGGG-GnRH-I E -pcDNA3.1 recombinant plasmid;

[0168] (2)MBP-GGGGG-GnRH-I E Expression: the MBP-GGGGG-GnRH-IE-pcDNA3.1 recombinant plasmid was transformed into the HEK293f expression cell line to obtain a recombinant expression cell line;

[0169] (3) Cell culture and GGGGG-GnRH-I E Protein purification: culture the MBP-GGGGG-GnRH-I E -pcDNA3.1 recombinant expression cell line, centrifugation to separate the supernatant, the supernatant was purified by nickel column to obtain MBP-GGGGG-GnRH-I E Protein, MBP-GGGGG-GnRH-I was converted to E Cut open, bind to nickel column, collect the effluent and concentrate the replacement buffer to obtain GGGGG-GnRH-I E protein.

[0170] Specifically, in step (1), the MBP-GGGGG-GnRH-I E -pcDNA3.1 recombinant plasmid was transformed into bacterial DH5α competent cells, and then the extracted plasmid was transfected into HEK293f cells using PEI, and then screened with bleomycin to obtain MBP-GGGGG-GnRH-I E -pcDNA3.1 recombinant expression cell line HEK293f.

[0171] Preparation of GGGGG-GnRH-I in the embodiment of the present invention E The basic materials of protein include: MBP-GGGGG-GnRH-I E Protein CDS sequence, pcDNA3.1 plasmid, PEI transfection reagent, Tiangen plasmid miniprep kit and HEK293f cells. EThe protein CDS sequence was sent to a gene company to synthesize MBP-GGGGG-GnRH-I E -pcDNA3.1 recombinant plasmid. Plasmid sequencing, extraction, expression and purification steps were the same as in Example 2. MBP-GGGGG-GnRH-I was dissolved in PBS according to the instructions. E TEV protease was added to the virus-like particles and digested overnight at 4°C. The His-Trx tag was bound to the filler using a Ni column, and the effluent was GGGGG-GnRH-I. E For virus-like particles, the buffer was exchanged into PBS using a 3K ultrafiltration tube.

[0172] Example 6

[0173] Provide a CMV opt -GnRH-I E Virus-like particles, made from CMV in Examples 4 and 5 opt -G4S-LPETG virus-like particles and GGGGG-GnRH-I E The proteins were mixed at a molar ratio of 1:1 and prepared under the catalysis of Sortase A protease, thus achieving simplified vaccine production.

[0174] Specifically, the CMV in Example 4 opt -G4SLPETG virus-like particles with GGGGG-GnRH-I E The proteins were prepared into 1 mg / mL with PBS solution, mixed at a molar ratio of 1:1, and then added with Sortase A enzyme. The mixture was shaken at 37°C for 5 h according to the ratio of 100 μg to 2 mg of mixed protein. The catalytic solution was then passed through a nickel column, and the penetrant was CMV. opt -G4S-LPETGGGGG-GnRH-I E Virus-like particles, while His-Sortase A will hang on the nickel column, and the permeate can be concentrated using a 30kDa concentrator to obtain CMV opt -GnRH-I E Virus-like particles.

[0175] Comparative Example

[0176] GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.

[0177] Example 7

[0178] Provide a GnRH-I Q -CMV or CMV opt -GnRH-IE Virus-like particle subunit vaccine immunization method:

[0179] As described in Examples 3 and 6, 50 μg GnRH-I was used on days 0, 14, and 28. Q -CMV or CMV opt -GnRH-I E Virus-like particles were mixed with aluminum hydroxide adjuvant at a volume ratio of 1:1 and used to immunize eight-week-old male C57BL / 6 mice (five mice per group). GnRH-I-AP205 VLP+aluminum hydroxide adjuvant immunization group, GnRH-I Q -CMV without adjuvant group, GnRH-I E -CMV without adjuvant group, simple CMV experimental group, simple CMV opt Experimental group, GnRH-I Q Experimental group, simple GnRH-I E The anti-GnRH-I level of these mice was measured. E Recombinant protein antibody titer and testosterone level: On day 70 after immunization, mice were sacrificed and testicular weights were measured.

[0180] Example 8 Determination of mouse anti-GnRH-I antibody titer

[0181] At different time points during the experiment, sera were collected from immunized mice and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows. Q and GnRH-I E Coat 96-well plates overnight at 4°C, adding 100 μl per well. The next day, wash the plates five times with 1:1000 PBST and block with 300 μl of 2% BSA at 37°C for 2 h. Wash the plates five times with 1:1000 PBST. Then, serially dilute mouse serum with 2% BSA at a starting concentration of 1:500, then dilute them two-fold to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. Incubate at room temperature for 45 min with shaking, adding 100 μl per well, starting at the highest dilution and moving downwards. Wash the plates five times with 1:1000 PBST. HRP-labeled goat anti-mouse polyclonal antibody was used as the secondary antibody at a dilution of 1:5000 in 2% skim milk powder. 100 μl was added to each well and incubated at room temperature with shaking for 45 minutes. TMB color development was performed for 5-10 minutes, followed by addition of 2M sulfuric acid for termination. The absorbance was read at a wavelength of 450 nm. The optical density (OD) at 450 nm was measured using an ELISA reader (BioRad Benchmark). The maximum OD was calculated using these data.450 Serum dilution.

[0182] FIG3 shows that the GnRH-I prepared in Example 3 and Example 6 Q -CMV vs CMV opt -GnRH-I E In the male mice immunized with virus-like particles without adjuvant, the average titer reached 16,000 on day 28, and after the fourth booster, the average titer briefly increased to 64,000, and then recovered to an average titer of 32,000. Q -CMV virus-like particles adjuvant group and CMV opt -GnRH-I E The antibody titer data of the adjuvant group were consistent, with the average titer reaching 32,000 on the 28th day. After the third injection, the titer remained stable at 64,000, and after the fourth booster injection, the antibody titer remained stable at 128,000. Q and GnRH-I E After three immunizations, the titer of the immune group only reached 8000, and after the fourth immunization, the antibody titer dropped to 4000; CMV mixed adjuvant, CMV opt No antibody titers were detected in the mixed adjuvant and PBS mixed adjuvant immunization groups. Q -CMV and CMV obtained by constructing Example 6 opt -GnRH-I E Can induce higher GnRH-I antibody titers.

[0183] Example 9 Determination of testosterone levels and testicular weight in mice

[0184] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using a testosterone-ELISA (IBL, Hamburg, Germany).

[0185] Figure 4 shows that the use of GnRH-I Q In mice immunized with CMV virus-like particles without aluminum hydroxide adjuvant, the average testosterone level was greatly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 2 ng / ml on day 70. Q In mice immunized with CMV+aluminum hydroxide adjuvant, the average testosterone level dropped to <2 ng / ml on the 28th day, and remained stable at around 0.19 after 42 days, which was significantly higher than that of the control group GnRH-I at the same time. Q The average level of central nervous system hormones in the group of mice immunized with aluminum hydroxide was about 28.8 times lower. opt-GnRH-I E The average testosterone level of mice in the + aluminum hydroxide adjuvant immunization group remained stable at around 0.20 after 42 days, which was significantly lower than that of the control group GnRH-I at the same time. E The average level of hormones in the central nervous system of the mice immunized with GnRH-I-CMV+adjuvant was about 26.7 times lower. This clearly proves that the GnRH-I-CMV+adjuvant immunization group has a more significant inhibitory effect on mouse testosterone. However, the testosterone level of mice immunized with GnRH-I-AP205 virus-like particles+adjuvant was only 10.3 times lower than that of the control group GnRH-I-CMV+adjuvant immunization group. Q The expression of GnRH-I-CMV in the group of mice immunized with aluminum hydroxide was about 23 times lower, and the degree of inhibition was not as good as that of GnRH-I-CMV, and a similar effect could not be achieved.

[0186] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.

[0187] Figure 5 shows that on day 70, GnRH-I Q + aluminum hydroxide adjuvant and GnRH-I E The testicular weight of mice immunized with aluminum hydroxide adjuvant was not significantly reduced, and the testicular weight of mice immunized with GnRH-I Q -CMV+adjuvant immunized mice had a 81.2% reduction in testicular weight. opt -GnRH-I E Testicular weight decreased by 80.3% in mice immunized with VLPs and aluminum hydroxide adjuvant, clearly demonstrating that the GnRH-I-CMV vaccine combined with an adjuvant has a more pronounced inhibitory effect on the mouse testicles. However, the testicular weight of mice immunized with the comparative GnRH-I-AP205 VLPs decreased by 78.3%, a lesser effect than the GnRH-I-CMV VLPs plus adjuvant vaccine.

[0188] Example 10: Testicular volume determination of experimental cats

[0189] Six healthy male rural cats aged 12 months were divided into two groups, 3 in each group, one of which was the injection group and the other was the control group. Q CMV virus-like particles (VLPs) were mixed with aluminum hydroxide adjuvant at a volume ratio of 1:1 for immunization. 200 μg was injected subcutaneously behind the ear and neck. A second injection was given 28 days later at the same dose and route. A control group received no injection. All experimental animals were housed individually under the same conditions and observation.

[0190] After the first vaccination, measure the width and length of the testicles with a vernier caliper and a tape measure every 14 days, and calculate the testicular volume according to the following formula: Testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.

[0191] As shown in Figure 6, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that GnRH-I Q -CMV vaccine combined with adjuvant has a significant inhibitory effect on the cat's testicles.

[0192] Example 11: Determination of pregnancy status in experimental cats

[0193] Six healthy rural male cats and four female dogs aged 12-24 months were divided into two groups, with three male cats and two female dogs in each group. One group was the injection group and the other was the control group.

[0194] The injection group received a subcutaneous injection of 200 μg GnRH-I behind the ear and neck. Q -CMV + adjuvant, a second injection was given 28 days later by the same route, while the control group was not injected. All experimental cats were housed and observed under the same conditions, and all cats were housed individually.

[0195] Eight healthy male dogs aged 12 to 24 months and 12 healthy female cats aged 12 to 14 months were cage-paired with the injected and control groups. Fourteen days after the second injection, the three male cats in the injected and control groups were cage-paired with two healthy female cats, respectively; and the four female dogs in the injected and control groups were cage-paired with two healthy male dogs, respectively. The groups were rotated to breed to minimize behavioral incompatibilities between cats and dogs that could affect successful pairing.

[0196] After the cohabitation test begins, examine the females in the experimental group and their cohabiting females for pregnancy. After 30 days of observation, perform ultrasound to check for pregnancy.

[0197] As can be seen from Table 1, none of the female animals in the injection group and the paired female animals became pregnant, while the female animals in the control group and the paired female animals became pregnant, indicating that GnRH-I Q -CMV+adjuvant has a good castration effect on cats and dogs and is suitable for the development of castration vaccines for cats and dogs.

[0198] Table 1 Pregnancy status of experimental animals

Claims

1. GnRH-VLP recombinant protein, characterized in that Includes GnRH and the capsid protein of cucumber mosaic virus.

2. The recombinant protein according to claim 1, characterized in that From N-terminus to C-terminus: Connect GnRH and the capsid protein of cucumber mosaic virus in sequence; or connect the capsid protein of cucumber mosaic virus, G4S, LPETGGGGG, and GnRH in sequence; wherein GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; The capsid protein of cucumber mosaic virus has the amino acid sequence shown in SEQ ID NO:

5.

3. Biomaterial, characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.

4. The method for preparing the recombinant protein according to claim 1 or 2, characterized in that: The method comprises culturing the host cell described in claim 3 to obtain a culture product containing the recombinant protein described in claim 1; Or it includes preparing GNRH-I protein and capsid protein of cucumber mosaic virus separately, and obtaining the recombinant protein of claim 1 or 2 through coupling.

5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.

6. A vaccine, characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.

7. The vaccine according to claim 6, characterized in that The adjuvant is aluminum hydroxide adjuvant.

8. The method for preparing the vaccine according to claim 6 or 7, characterized in that: The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.

9. The preparation method according to claim 8, characterized in that: The volume ratio of the mixture is 1:

1.

10. A method for castration of an animal, characterized in that: Comprising administration of the vaccine of claim 6 or 7.

Images