Castration CPMV virus-like particle subunit vaccine and preparation method thereof

Abstract

Relates to the technical field of biology, in particular to a castrated CPMV virus-like particle subunit vaccine and a preparation method thereof. The invention provides the GnRH-I-CPMV recombinant protein which is high in purity and good in specificity. A vaccine prepared from the GnRH-I-CPMV recombinant protein is high in antigen purity and good in safety, and has a good castration effect.

Description

Castrated CPMV virus-like particle subunit vaccine and preparation method thereof

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biotechnology, in particular to a castrated CPMV virus-like particle subunit vaccine and a preparation method thereof. Background Art

[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.

[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can increase gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promote the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), and promote follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.

[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated components. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, in turn inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.

[0006] Virus-like particles are the main capsid protein of an RNA bacteriophage. They are self-assembled from multiple monomers into a new type of highly immunogenic virus-like particles (VLPs). These VLPs do not contain the phage RNA genome and cannot replicate. However, studies have found that a variety of polypeptides can be fused to the N- or C-terminus of the virus-like particle protein, and the resulting fusion protein forms virus-like particles when expressed in a host, typically and preferably in Escherichia coli. In addition, it has been found that if the polypeptide contains at least one antigen, the antigen or at least one antigenic site of the antigen is displayed on the outer surface of the assembled VLP, the assembled VLP can effectively improve the immunogenicity of the target antigen. In addition to the virus-like particles AP205 and Qβ that have been reported, there are also a variety of VLP platforms such as CuMV and tobacco mosaic virus VLP, all of which have the potential to be developed into castration vaccines.

[0007] Cowpea mosaic virus (CPMV) belongs to the genus Comovirus in the family Comoviridae and is composed of two independently encapsulated positive-strand RNAs. The CPMV virus has an icosahedral shape and is composed of 60 copies of the large (L) and small (S) capsid proteins. The CPMV capsid can be specifically modified to have neatly arranged functional residues, providing precise sites for the insertion of other molecules. By introducing one cysteine ​​residue per capsid protein molecule, a single CPMV capsid provides 60 insertion sites. Using plant viruses for vaccine development is an important avenue for vaccine development. CPMV as a carrier allows for highly organized surface display of antigens, which in turn promotes early B cell proliferation and elicits a strong IgM antibody response, as well as improving the efficiency of switching to IgG. Covalently conjugating weakly immunogenic antigens to plant viruses can elicit a strong humoral immune response. However, there are no reports on the use of CPMV to construct a GnRH castration vaccine.

[0008] Summary of the Invention

[0009] In view of this, the technical problem to be solved by the present invention is to provide a castrated CPMV virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.

[0010] The present invention provides a GnRH-VLP recombinant protein, which comprises GnRH and a capsid protein of cowpea mosaic virus.

[0011] The GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0012] The capsid protein of the cowpea mosaic virus (CPMV) has the amino acid sequence shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced on the basis of the amino acid sequence shown in SEQ ID NO: 5; or a sequence with a homology of more than 90% to the amino acid sequence shown in SEQ ID NO: 5.

[0013] In some embodiments, the C-terminus of GnRH in the GnRH-VLP recombinant protein provided by the present invention is coupled to the N-terminus of the capsid protein of cowpea mosaic virus.

[0014] The present invention also provides:

[0015] 1), a nucleic acid encoding the GnRH-VLP recombinant protein;

[0016] II), an expression unit containing a nucleic acid encoding GnRH-VLP;

[0017] III), a recombinant vector containing a nucleic acid encoding GnRH-VLP or an expression unit as described above;

[0018] IV), transforming or transfecting host cells with an expression vector for GnRH-VLP;

[0019] V) The culture product of the host cells as described above.

[0020] The nucleic acid can be DNA, RNA, cDNA or PNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (such as promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be, for example, a part of a vector (such as an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc. The gene sequence can use a wild-type sequence or can be codon-optimized, and the present invention is not limited to this. The nucleic acids of the present invention encode GnRH and CPMV respectively. The nucleic acid encoding CPMV is a nucleic acid encoding the full length or partial fragment of CPMV. In some embodiments, its nucleic acid sequence is shown in SEQ ID NO: 6.

[0021] The expression units provided by the present invention include GnRH expression units and CPMV expression units. The expression units include the nucleic acid of the present invention in a single or multiple tandem form with a promoter and a terminator, and the present invention does not limit this.

[0022] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for expression of the operably linked coding gene in a specific host organism. Nucleic acid sequences or elements necessary for expression in bacteria include promoters, ribosome binding sites, and possibly other sequences. The recombinant expression vector is selected based on the host organism. The expression vector described in the present invention can be circular or linear, and this is not a limitation of the present invention. For example, a prokaryotic host can be Escherichia coli, Bacillus, Streptomyces, or cyanobacteria; its backbone vector can be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid, or a pcDNA series plasmid. For example, the recombinant backbone vector is a pET series vector, and optionally, the backbone vector of the recombinant vector is pET-21(+), pET-24(+), pET-23(+), or pET-28a(+).

[0023] The construction of the recombinant vector provided by the present invention comprises cloning the nucleic acid fragment encoding the fusion protein as described above into the prokaryotic expression vector pETM41 by homologous recombination method.

[0024] In some embodiments, the insertion site is between the BamHI site and the EcoRI site. The present invention provides a recombinant vector for CPMV and a recombinant vector for GnRH-I, respectively. Among them, the encoding vector for CPMV is an in vitro transcription plasmid containing full-length infectious CPMV RNA1 (Genbank: NC_003549.1) and RNA2 (Genbank: NC_003550.1), respectively named pCPMV-RNA1 and pCPMV-RNA2. The recombinant vector for GNRH-I includes a TEV restriction site and the GnRH-I gene, and the backbone vector is pETM41.

[0025] Furthermore, the present invention also provides a host cell transformed or transfected with the aforementioned recombinant vector, or with the aforementioned nucleic acid integrated into its genome.

[0026] The hosts described in the present invention include bacteria, fungi, viruses or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeasts include Saccharomyces cerevisiae, Saccharomyces cerevisiae, Pichia pastoris, and Candida. The viruses include but are not limited to adenoviruses, adeno-associated viruses, lentiviruses, and prions. The animals include humans, mice, rabbits, pigs, zebrafish, and the like. The expression of the nucleic acid encoding the recombinant protein in the host can be either integrated or episomal, and the present invention does not limit this. In the embodiment of the present invention, CMPV is expressed using cowpea plants as hosts, and GnRH-I is expressed using Escherichia coli as a host. The Escherichia coli is Escherichia coli T7 shuffle.

[0027] Furthermore, the present invention also provides a culture product of the host cell.

[0028] The method for preparing the GnRH-CPMV recombinant protein of the present invention comprises: culturing the host cell as described above to obtain a culture product containing the recombinant protein;

[0029] Alternatively, the method comprises preparing GnRH-I protein and capsid protein of cowpea mosaic virus separately, and obtaining the recombinant protein through coupling.

[0030] As described above, the method for preparing the fusion protein includes:

[0031] GnRH-I protein and CPMV protein were prepared separately, and fusion protein was obtained by coupling.

[0032] Or include:

[0033] (1) Synthesize GnRH polypeptide according to the GnRH-I gene sequence; Infect cowpea with a virus containing CMPV nucleic acid to produce CPMV protein;

[0034] (2) coupling the GnRH-I polypeptide with CPMV protein to obtain GnRH-I-CPMV VLPs;

[0035] (3) Purify GnRH-I-CPMV VLPs by ultracentrifugation.

[0036] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention are used in the preparation of subunit vaccines.

[0037] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration CPMV virus-like particle subunit vaccine, which includes the recombinant protein as described above. The vaccine is a castration vaccine for male animals. The male animals are animals that can be castrated, including birds and mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, they are felines, canines, or rodents, such as mice. The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant, or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.

[0038] Furthermore, the method for preparing the subunit vaccine comprises mixing the recombinant protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.

[0039] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Correspondingly, the present invention also provides a method for castrating animals, comprising administering the vaccine as described above. In the present invention, the castration includes increasing the level of GnRH antibodies, reducing testosterone levels, reducing testicular volume and / or weight, and preventing animal pregnancy. In the present invention, the administration method includes injection. The dosage administered is 200 μg. 10 to 100 days after immunization, the anti-GnRH recombinant protein antibody titer and testosterone level decreased.

[0040] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 2.23% of the original level.

[0041] In some tests, the weight of the mouse testicles was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, and 80% to 90%. In a specific embodiment, the weight of the mouse testicles was reduced to 22.34% of the original level.

[0042] In some tests, the cat's testicular volume is reduced to 50% to 90% of its original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the cat's testicular volume is reduced to 89.4% of its original level.

[0043] The beneficial effects of the present invention are as follows:

[0044] First, CPMV is a cowpea mosaic virus. The viral capsid protein has the ability to self-assemble into nanoparticles. It is non-infectious and has strong antigenic immunity.

[0045] Second, the GnRH antigen coupled to CPMV virus-like particles showed high antigenicity, inducing high levels of specific antibodies in mice, rats, cats, dogs, and horses, with a rapid humoral immune response;

[0046] Third, expressing CPMV in a plant expression system allows for large-scale, cost-effective production without the traditional animal cell culture and viral amplification processes, reducing production costs and safety risks. Furthermore, plant expression systems exhibit enhanced protein folding and glycosylation capabilities, facilitating the production of properly folded and functionally active proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. For those skilled in the art, other implementation drawings can be derived from the provided drawings without inventive effort:

[0048] FIG1 is a schematic diagram of a recombinant plasmid after the GnRH-I gene provided in an embodiment of the present invention is connected to the pETM41 plasmid;

[0049] FIG2 is a schematic diagram of SDS-PAGE of GnRH-I-CPMV virus-like particle protein provided in an embodiment of the present invention;

[0050] FIG3 shows the serum antibody titer of mice immunized with GnRH-I-CPMV virus-like particles provided in an embodiment of the present invention;

[0051] Figure 4 shows the average testicular weight of mice;

[0052] Figure 5 Changes in testicular volume in male cats. DETAILED DESCRIPTION

[0053] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0055] The molecular biology experimental methods used in the examples of the present invention, such as enzyme digestion and homologous recombination ligation, can be found in the second edition of Molecular Cloning. The basic materials for preparing the GnRH-I-CPMV virus-like particles of the present invention include: CPMV protein nucleotide sequence, GnRH-I nucleotide sequence, pETM41 plasmid, T7shuffle Escherichia coli strain, Tiangen Plasmid Miniprep Kit, LB medium, IPTG, kanamycin, nickel column, and imidazole. The nucleotide sequence was sent to BGI for synthesis of the his-MBP-TEV-GnRH-I-pETM41 recombinant plasmid.

[0056] The method for preparing GnRH-I-CPMV virus-like particles provided by the present invention comprises the following steps:

[0057] (1) According to the experimental method in PMID: 3388776, CPMV virus-like particles were expressed in cowpea plants and purified;

[0058] (2) The GnRH-I gene nucleotide sequence was sent to BGI for synthesis to obtain the his-MBP-TEV-GnRH-I-pETM41 recombinant plasmid. The correctly sequenced recombinant plasmid was transformed into Escherichia coli T7shuffle. After expression and purification, the GnRH-I protein was digested with TEV protease and purified using a Ni chromatography column.

[0059] (3) The CMPV virus-like particles and GnRH-I protein in the culture steps (1) and (2) are reacted with SMPH and TCEP respectively and then mixed to obtain the coupling product GnRH-I-CPMV virus-like particles.

[0060] The sequences involved in the present invention include:

[0061] GnRH is also referred to herein as GnRH-I, and its amino acid sequence is:

[0062] QHWSYGLRPG (SEQ ID NO: 1, denoted as GnRH-I Q )

[0063] or EHWSYGLRPG (SEQ ID NO: 2, denoted as GnRH-I E )

[0064] The nucleic acid sequence encoding GnRH-1 is:

[0065] CAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO.3, encoding GnRH-I Q )

[0066] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4, encoding GnRH-I E )

[0067] The amino acid sequence of the CPMV protein is:

[0068] The nucleic acid sequence encoding the CPMV protein is:

[0069] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0070] Cowpea mosaic virus (CPMV) displays exogenous peptides on its surface, making it well-suited for development as a subunit vaccine. CPMV RNA and his-MBP-TEV-GnRH-I-pETM41 recombinant plasmids were constructed, respectively. CPMV VLPs were expressed in cowpea leaves, while GnRH-I was expressed in Escherichia coli. After in vitro coupling, GnRH-I-CPMV VLPs were generated to create a subunit vaccine.

[0071] Example 1

[0072] Provided is a method for preparing CPMV virus-like particles, the method comprising the following steps:

[0073] (1) Expression of CPMV virus-like particles: According to the experimental method in the literature PMID: 17227681, in vitro transcription plasmids containing full-length infectious CPMV RNA1 (Genbank: NC_003549.1) and RNA2 (Genbank: NC_003550.1) were constructed and named pCPMV-RNA1 and pCPMV-RNA2, respectively. Cowpea was grown at 25°C with a 16 / 8 h photoperiod. Approximately 7 days after planting, primary leaves were mechanically inoculated at the two-leaf stage with 2 μg of CMPV RNA1 and 2 μg of CMPV RNA2 transcripts per cowpea plant. After 14 days, leaf tissue was harvested and stored at −80°C until processing.

[0074] (2) Purification of CPMV virus-like particles: 40 g of frozen leaf tissue was mixed in 150 ml of cold 30 mM Tris (pH = 7.5) containing 0.2 mM phenylmethylsulfonyl fluoride (PMSF), and the leaves were ground at high speed twice for 15 seconds. The plant slurry was centrifuged at 15,000 × g for 30 minutes to remove plant cell debris and obtain active VLPs. To recover inactivated VLPs, 40 g of frozen leaf tissue was mixed in 150 ml of cold 30 mM Tris, 0.5 M ammonium sulfate, 0.2 mM PMSF (pH = 9.0) solution, and the extract was inactivated at 22°C for 20 hours. Cold 20% PEG 6000, 1 M NaCl solution was added to the extract to a final concentration of 5% PEG 6000 and 0.25 M NaCl. After incubation at 4°C for 1 hour, the solution was centrifuged at 15,000 × g for 30 minutes. Resuspend the pellet in 30 ml of 30 mM Tris (pH 7.5) and centrifuge at 15,000 × g for 30 minutes. Collect the supernatant, dilute to 100 ml with ultrapure water, and filter using a 0.45 μm filter. Centrifuge the supernatant and purify it on a nickel column. Equilibrate the nickel column with PBS for 5 column volumes. Load the sample, wash the column with PBS for 5 column volumes, wash it with PBS containing 25 mM imidazole for 2 column volumes, and then wash it with PBS containing 25 mM imidazole for 5 column volumes. Then, elute it with PBS containing 50, 100, 250, and 500 mM imidazole for 5 column volumes, and collect the flow-through.

[0075] Aspirate 10 μL of each collected solution and add 10 μL of 2× protein electrophoresis loading buffer. Heat at 100°C for 4 minutes. Then, perform protein electrophoresis and stain the collected solution to determine the concentration of the target band. Ultrafiltration of the target protein using a 30 kDa ultrafiltration tube and replacement with PBS was performed. The resulting product contained 1.17 mg / mL of CPMV VLPs.

[0076] Example 2

[0077] Provided is a method for preparing GnRH-I, comprising the following steps:

[0078] (1) Construction of recombinant plasmid: The TEV restriction site and GnRH-I gene (SEQ ID NO.3 and SEQ ID NO.4) were directly synthesized by BGI into the pETM41 vector BamHI restriction site and EcoRI restriction site to obtain the recombinant plasmid his-MBP-TEV-GnRH-I Q -pETM41 and his-MBP-TEV-GnRH-I E -pETM41 ( Figure 1 );

[0079] (2) Transform the recombinant plasmid into the expression strain: the his-MBP-TEV-GnRH-I Q -pETM41 and his-MBP-TEV-GnRH-I E -pETM41 recombinant plasmid was transformed into Escherichia coli T7shuffle expression strain to obtain his-MBP-TEV-GnRH-I Q -pETM41-T7shuffle and his-MBP-TEV-GnRH-I E -pETM41-T7 shuffle recombinant expression strain;

[0080] (3) Bacterial culture and purification of his-MBP-TEV-GnRH-I recombinant protein: Cultivate the his-MBP-TEV-GnRH-I Q -pETM41-T7 shuffle and his-MBP-TEV-GnRH-I E -pETM41-T7 shuffle recombinant expression strain, IPTG-induced expression to obtain his-MBP-TEV-GnRH-I Q and his-MBP-TEV-GnRH-I E Recombinant protein.

[0081] The specific steps for expression and purification of his-MBP-TEV-GnRH-I recombinant protein are as follows:

[0082] (c1) Preparation of his-MBP-TEV-GnRH-I-pETM41 recombinant plasmid

[0083] Use a pipette to inoculate 5 μl of the glycerol stock containing the plasmid into 5 mL of LB medium (containing 50 μg / mL kanamycin). Incubate at 37°C with shaking for 14-16 hours. After incubation, remove 1 mL of the culture medium for sequencing. Use a plasmid extraction kit to extract the plasmid from the remaining culture medium, and measure the nucleic acid concentration using a protein nucleic acid detector.

[0084] (c2) Expression of his-MBP-TEV-GnRH-I recombinant protein

[0085] Transform the T7 shuffle expression strain, shake the bacteria, concentrate by centrifugation, spread on kanamycin-resistant plates, culture at 37°C overnight, scrape the colonies, inoculate 10 mL of LB medium containing kanamycin, and shake at 37°C at 180 rpm until the bacterial solution OD 600 = 0.8. Transfer it to 500 mL of LB medium containing ampicillin and shake at 37°C 180 rpm until the bacterial solution OD 600 = approximately 0.8. Add IPTG inducer to a final concentration of 0.8 mM and express overnight at 30°C. On the third day, harvest the cells by centrifugation at 4500 rpm for 15 minutes. Ultrasonicate the cells for 45 minutes (3 seconds on, 4 seconds off) at 125W. After sonication, sonicate at 9500 rpm for 20 minutes at 4°C and collect the supernatant.

[0086] (c3) Purification of his-MBP-TEV-GnRH-I recombinant protein

[0087] The supernatant was centrifuged and purified by passing it through a nickel column. The column was equilibrated with PBS for 5 column volumes. Sample was loaded, washed with PBS for 5 column volumes, then washed with PBS containing 25 mM imidazole for 2 column volumes, and then washed again with PBS containing 25 mM imidazole for 5 column volumes. Elution was then performed with PBS containing 50, 100, 250, and 500 mM imidazole for 5 column volumes, and the flow-through was collected.

[0088] Aspirate 10 μL of each collected solution and add 10 μL of 2× protein electrophoresis loading buffer. Heat at 100°C for 4 minutes. Perform protein electrophoresis and stain to determine the concentration of the target band. Ultrafilter the target protein using a 30 kDa ultrafiltration tube and replace the solvent with PBS.

[0089] (c4) Preparation of GnRH-I recombinant protein

[0090] The enzymatic digestion reaction was carried out at a ratio of 10 μg TEV enzyme to 1 mg recombinant protein, and the reaction was shaken at 30°C for 3 hours. The reaction solution was then passed through a nickel column. The flow-through solution was the GnRH-I recombinant protein, while the his-TEV enzyme and the incompletely digested recombinant protein would be attached to the nickel column. The GnRH-I recombinant protein was concentrated using a 30 kDa concentrator.

[0091] Example 3

[0092] Provided is a method for preparing GnRH-I-CPMV virus-like particles, comprising the following steps:

[0093] CPMV dosage: molecular weight 30.7 kDa, i.e. 30.7 mg / ml = 1 mM;

[0094] SMPH dosage: succinimidyl 6-(BETA-maleimidopropionamido) hexanoate, molecular weight 378.4 g / mol, prepared at 10 mg / ml;

[0095] GnRH-I dosage: prepared in Example 2, molecular weight 1.1 kDa, i.e. 1.1 mg / ml = 1 mM;

[0096] TCEP dosage: tris-(2-carboxyethyl)phosphine hydrochloride, molecular weight 286.65 g / mol, preparation concentration 0.5 M;

[0097] CPMV and SMPH were mixed (molar ratio 1:10), placed in a shaker at 25°C, 200 rpm, and incubated for 25 minutes. After the reaction, a desalting column was used to remove the side reaction products. GnRH-I was mixed with TCEP (molar ratio 1:1), placed in a shaker at 25°C, 200 rpm, and incubated for 25 minutes. After the reaction, a desalting column was used to remove the side reaction products. The desalted CPMV+SMPH was mixed with GnRH-I+TCEP at a molar ratio of 1:1, placed in a shaker at 25°C, 200 rpm, and incubated for 3 hours. 10 μl of the sample was used for SDS-PAGE identification to check the coupling effect. As shown in Figure 2, there is a single band at around 35 kDa, which is GnRH-I. Q -CPMV and GnRH-I E -CPMV virus-like particles, the resulting product, GnRH-I Q -CPMV VLP concentration was 0.87 mg / mL, GnRH-I E -The concentration of CPMV VLPs was 0.82 mg / mL.

[0098] Comparative Example

[0099] At the same time, GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.

[0100] Example 4

[0101] GnRH-I-CPMV virus-like particle subunit vaccine immunization method

[0102] GnRH-I prepared in Example 3 Q -CPMV and GnRH-I E-CPMV virus-like particles virus-like particles and aluminum hydroxide adjuvant were mixed at a volume ratio of 1:1 for immunization. On day 0, day 14, and day 28, 50 μg GnRH-I Q -CPMV and GnRH-I E Eight-week-old male C57BL / 6 mice were immunized with CPMV virus-like particles vaccine (five mice per group), and the GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant immunization group, GnRH-I Q -CPMV without adjuvant group, GnRH-I E The mice were divided into a CPMV-unadjuvanted group, an adjuvanted PBS-negative group, a CPMV-only experimental group, and a GnRH-I-only experimental group. Anti-GnRH-I recombinant protein antibody titers and testosterone levels were measured in these mice. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.

[0103] Example 5

[0104] Determination of mouse anti-GnRH-I antibody titer

[0105] At various time points during the experiment, serum was collected from immunized and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows. 96-well plates were coated with 2 μg / ml GnRH-I overnight at 4°C, with 100 μl per well added. The next day, the plates were washed five times with 1:1000 PBST and blocked with 300 μl of 2% BSA at 37°C for 2 h. The plates were then washed five times with 1:1000 PBST. Mouse serum was serially diluted with 2% BSA at an initial concentration of 1:500, followed by two-fold dilutions to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. From the highest to the lowest dilution, 100 μl per well was added, and the plates were incubated at room temperature with shaking for 45 min. Wash the plate five times with 1:1000 PBST. Use HRP-conjugated goat anti-mouse polyclonal antibody as a secondary antibody at a dilution of 1:5000 in 2% skim milk powder, 100 μl per well, and incubate at room temperature with shaking for 45 minutes. TMB color development takes 5-10 minutes, followed by addition of 2M sulfuric acid to terminate the color development. Read the absorbance at 450 nm. Optical density (OD) at 450 nm is measured using an ELISA reader (BioRad Benchmark). The maximum OD is calculated using these data. 450 Serum dilution.

[0106] FIG3 shows that, when GnRH-I prepared in Example 3 Q -CPMV and GnRH-I EIn male mice immunized with CPMV virus-like particles without adjuvant, the average titer reached 16,000 on day 28, and remained at 32,000 after the third booster. Q -CPMV and GnRH-I E The average titer of the CPMV virus-like particles adjuvant group reached 32,000 on day 28, and then remained at 128,000 after the third injection. Q and GnRH-I E The titer of the adjuvant-immunized group was only 8,000 at 28 days, and no antibody titer was detected in the CPMV mixed adjuvant and PBS mixed adjuvant immunization groups. Compared with the GnRH-I-CPMV group and the GnRH-I + adjuvant group, the GnRH-I-CPMV + adjuvant group was able to significantly increase the antibody titer of GnRH-I in the mouse blood. Compared with the comparative example GnRH-I-AP205, the GnRH-I-CPMV constructed in Example 3 can stimulate the body's immune response more sustainably and is more suitable for the preparation of GnRH-I-CPMV subunit vaccines.

[0107] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using a testosterone-ELISA (IBL, Hamburg, Germany).

[0108] Table 1 shows the GnRH-I constructed using Example 4. Q -CPMV and GnRH-I E In mice immunized with CPMV virus-like particles without aluminum hydroxide adjuvant, the average testosterone level was greatly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 2 ng / ml on day 70. Q In mice immunized with -CPMV supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to <2 ng / ml on the 28th day, and remained stable at around 0.13 after 42 days, which was significantly higher than that of the control group GnRH-I at the same time. Q The average level of hormones in the central nervous system of mice immunized with aluminum hydroxide was about 42 times lower. E In mice immunized with -CPMV supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to <2 ng / ml on the 28th day, and remained stable at around 0.146 after 42 days, which was significantly higher than that of the control group GnRH-I at the same time. E The average level of hormones in the central nervous system of mice immunized with GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant was about 38 times lower. EThe average hormone level of the mice immunized with aluminum hydroxide was about 35 times lower, which clearly proved that the GnRH-I-CPMV+adjuvant immunization group had a stronger inhibitory effect on mouse testosterone, among which GnRH-I Q -CPMV+adjuvant had a more obvious inhibitory effect.

[0109] Table 1 Testosterone levels in mouse serum

[0110] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.

[0111] Figure 4 shows that on day 70, GnRH-I Q and GnRH-I E The testicular weight of the immunized mice was not significantly reduced, while the testicular weight of the mice receiving the GnRH-I constructed in Example 3 was significantly reduced. Q -The testicular weight of mice immunized with CPMV virus-like particles and aluminum hydroxide adjuvant was reduced by 77.66%, and mice receiving GnRH-I E The testicular weight of mice immunized with GnRH-I-CPMV virus-like particles and aluminum hydroxide adjuvant decreased by 76.42%, and the testicular weight of mice immunized with GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant decreased by 72.7%. This shows that the vaccine combined with GnRH-I-CPMV and adjuvant has a more significant inhibitory effect on the testicles of mice, among which GnRH-I Q -CPMV+adjuvant has a stronger immunosuppressive effect.

[0112] Example 6: Testicular volume determination of experimental cats

[0113] Six healthy male rural cats aged 12 to 24 months were divided into two groups, with 3 cats in each group. One group was the injection group and the other was the control group. Q Immunization was performed with a mixture of CPMV virus-like particles and aluminum hydroxide adjuvant at a volume ratio of 1:1. 200 μg was injected subcutaneously behind the ear and neck. A second injection was given 28 days later at the same dose and route. A control group received no injection. All experimental animals were housed individually under the same conditions and observation.

[0114] After the first vaccination, measure the width and length of the testicles with a vernier caliper or tape measure every 14 days and calculate the testicular volume using the following formula:

[0115] Testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.

[0116] As shown in Figure 5, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that GnRH-I Q-CPMV combined with adjuvant immunization vaccine has a significant inhibitory effect on the testicles of cats.

[0117] Example 7: Determination of pregnancy status of experimental cats

[0118] Ten healthy rural cats aged 12-24 months (6 male cats and 4 female cats) were divided into two groups, with 3 male cats and 2 female cats in each group. One group was the injection group and the other was the control group.

[0119] The injection group received a subcutaneous injection of 200 μg GnRH-I behind the ear and neck. Q -CPMV + adjuvant, 28 days later, the second injection was administered by the same route, while the control group was not injected. All experimental cats were housed and observed under the same conditions, and all cats were housed individually.

[0120] Eight healthy male cats aged 12 to 24 months and 12 healthy female cats aged 12 to 14 months were cage-paired with the injected and control groups. Fourteen days after the second injection, three male cats from the injected and control groups were cage-paired with two healthy female cats, respectively; and four female cats from the injected and control groups were cage-paired with two healthy male cats, respectively. Male cats from each group were rotated to breed to minimize behavioral incompatibilities that could affect successful pairing.

[0121] After the cohabitation test begins, check whether the female cats in the experimental group and the male cats in the same cage are pregnant. After 30 days of observation, ultrasound is used to check for pregnancy.

[0122] As can be seen from Table 2, none of the female cats in the injection group and the paired female cats became pregnant, while the female cats in the control group and the paired female cats became pregnant, indicating that GnRH-I Q -CPMV+adjuvant is very effective for castration of cats and is suitable for the development of castration vaccines.

[0123] Table 2 Pregnancy status of experimental animals

Claims

1. GnRH-VLP recombinant protein, characterized in that Includes GnRH and capsid protein of cowpea mosaic virus.

2. The recombinant protein according to claim 1, characterized in that The C-terminus of GnRH is coupled to the N-terminus of the capsid protein of cowpea mosaic virus; wherein GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; The capsid protein of cowpea mosaic virus has the amino acid sequence shown in SEQ ID NO:

2.

3. Biomaterial, characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.

4. The method for preparing the recombinant protein according to claim 1 or 2, characterized in that: The method comprises culturing the host cell described in claim 3 to obtain a culture product containing the recombinant protein described in claim 1; Or it comprises preparing GNRH-I protein and capsid protein of cowpea mosaic virus separately, and obtaining the recombinant protein of claim 1 or 2 through coupling.

5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.

6. A vaccine, characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.

7. The vaccine according to claim 6, characterized in that The adjuvant is aluminum hydroxide adjuvant.

8. The method for preparing the vaccine according to claim 6 or 7, characterized in that: The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.

9. The preparation method according to claim 8, characterized in that: The volume ratio of the mixture is 1:

1.

10. A method for castration of an animal, characterized in that: Comprising administration of the vaccine of claim 6 or 7.

Images