Application of ITGB2 target and pharmaceutical composition
By identifying ITGB2 as a key molecule in TNBC exosomes, we developed inhibitors targeting ITGB2 to block CAF activation, thus solving the problem of lack of specific targets for TNBC treatment, achieving inhibition of tumor growth and metastasis and prognosis assessment, and improving patient survival rate.
Patent Information
- Application Number
- CN202511025706.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-24
- Publication Date
- 2025-10-14
AI Technical Summary
Existing technologies lack specific targets for triple-negative breast cancer (TNBC) exosomes, resulting in a lack of targeted treatment strategies and possible interference with normal cell-to-cell communication, leading to poor patient prognosis.
By identifying ITGB2 as a key molecule in TNBC exosomes regulating the tumor microenvironment, inhibitors targeting ITGB2, such as shRNA, antibodies, or small molecule compounds, are developed to block exosome-mediated activation of tumor-associated fibroblasts (CAFs). Combined with chemotherapy, immunotherapy, or radiotherapy, pharmaceutical compositions are prepared to enhance anti-tumor efficacy, and the prognosis of TNBC is evaluated by detecting ITGB2 expression levels.
Significantly reduce CAF activation, inhibit tumor growth and metastasis, provide personalized treatment guidance, and improve the survival rate of TNBC patients.
Smart Images

Figure CN120771289A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biological medicine, and in particular to the application of ITGB2 target and pharmaceutical composition. BACKGROUND
[0002] Triple negative breast cancer (TNBC) is lack of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) expression, and has limited clinical treatment means, easy recurrence and metastasis, and poor prognosis. In recent years, it has been found that tumor exosomes remodel tumor microenvironment by delivering bioactive molecules to promote tumor progression. However, the key regulatory factors in TNBC exosomes and their specific mechanisms are not clear. In the prior art, the treatment strategies for exosomes are mostly focused on inhibiting exosome secretion or removing exosomes, which lack specific targets and may interfere with normal cell communication. Therefore, it is urgent to find key molecules in TNBC exosomes that specifically regulate tumor microenvironment and develop targeted intervention means. In view of this, the present application provides the application of ITGB2 target and pharmaceutical composition. SUMMARY
[0003] The technical problem to be solved by the present application is to provide the application of ITGB2 (integrin beta 2) target and pharmaceutical composition. The purpose is to first identify ITGB2 as a key molecule for TNBC exosome to regulate tumor microenvironment, and to provide a new strategy for TNBC treatment by targeting ITGB2 to block exosome-mediated activation of tumor-associated fibroblasts (CAF), and to use the detection of ITGB2 expression level for TNBC prognosis evaluation and personalized treatment guidance.
[0004] The technical solution of the present application to solve the above technical problem is as follows: In the first aspect, the application of ITGB2 target inhibiting agent for triple negative breast cancer in the preparation of drugs for treating triple negative breast cancer.
[0005] On the basis of the above technical solution, the present application can also be improved as follows.
[0006] Further, the inhibiting agent includes at least one of ITGB2 gene silencing agent, antibody and small molecule compound.
[0007] Further, the ITGB2 gene silencing agent includes at least one of shRNA targeting ITGB2 and recombinant vector containing shRNA targeting ITGB2.
[0008] Further, the nucleotide sequence of the shRNA targeting ITGB2 is shown in SEQ ID NO: 1-3. The nucleotide sequence of the shRNA is as follows: ITGB2-homo-635 (SEQ ID NO: 1): CCUCUCCUACUCCAUGCUUTT; ITGB2-homo-1282 (SEQ ID NO: 2): GCAAUGUGGUCCAUCUCAUTT ITGB2-homo-1726 (SEQ ID NO: 3): GGAAGGACAACAACUCCAUTT Further, by inhibiting the expression of ITGB2 or blocking its function, the activation of tumor-associated fibroblasts (CAF) is significantly reduced, and tumor growth and metastasis are inhibited.
[0009] In a second aspect, a pharmaceutical composition for triple-negative breast cancer targeting therapy based on inhibition of ITGB2, the pharmaceutical composition comprising the inhibiting agent for the ITGB2 target of triple-negative breast cancer in the use.
[0010] Further, the pharmaceutical composition further comprises a chemotherapeutic agent. In combination with chemotherapy, immunotherapy or radiotherapy, the anti-tumor efficacy is enhanced by inhibiting the ITGB2 signaling pathway.
[0011] Further, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or auxiliary ingredient.
[0012] The pharmaceutically acceptable carrier and / or auxiliary ingredient includes at least one of a filler, a lubricant, a dispersant, a wetting agent, a binder, a regulator, a solubilizer, an antioxidant, a bacteriostatic agent, an emulsifier, a disintegrant. The pharmaceutically acceptable excipient or auxiliary ingredient is a commonly used excipient or excipient for preparing the above-mentioned preparation in the art.
[0013] The dosage form of the pharmaceutical composition of the present application is a clinically acceptable pharmaceutical preparation. The dosage form of the pharmaceutical composition includes any one of a capsule, a granule, a tablet, a pill, a syrup, a powder, a powder, a suppository, a drop, an emulsion. The pharmaceutical composition of the present application can be prepared as a pharmaceutical composition according to the method known in the art, and can be prepared into any dosage form suitable for human or animal use by combining the pharmaceutical composition of the present application with one or more pharmaceutically acceptable solid or liquid excipients and / or adjuvants.
[0014] In a third aspect, the use of an ITGB2 target detection reagent for triple-negative breast cancer in the preparation of a diagnostic kit for the prognosis evaluation of triple-negative breast cancer.
[0015] The ITGB2 expression level in the serum exosome or tumor tissue of the patient is detected to evaluate the metastasis risk and prognosis of TNBC.
[0016] Further, the diagnostic kit comprises an antibody or primer pair specifically recognizing ITGB2. The primer pair specifically recognizing ITGB2 is as follows: ITGB2-F (SEQ ID NO: 4): CTCACCGAGATCATCCCCAAG; ITGB2-R (SEQ ID NO: 5): CTGCAGAAGGAGTCGTAGGTG.
[0017] The present application discloses for the first time that ITGB2 is a core regulatory factor in TNBC exosomes, which promotes tumor metastasis through the following mechanisms: (1) TNBC exosomes highly express ITGB2, which is phagocytosed by normal fibroblasts (NF) and releases ITGB2 to activate NF to transform into tumor-associated fibroblasts (CAF); (2) CAF enhances the proliferation, invasion and metastasis of tumor cells by secreting cytokines and remodeling the extracellular matrix; (3) inhibiting the expression or function of ITGB2 can significantly reduce CAF activation and inhibit tumor growth and metastasis.
[0018] The present application has the beneficial effects that: the present application identifies for the first time that ITGB2 is a key molecule for TNBC exosomes to regulate the tumor microenvironment; proposes to block the activation of CAF mediated by exosomes by targeting ITGB2 (such as shRNA, antibody or small molecule inhibitor) to provide a new strategy for TNBC treatment; the detection method based on the expression level of ITGB2 can be used for TNBC prognosis evaluation and personalized treatment guidance. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 Figure 1 is a characteristic map of TNBC exosomes of the present application; wherein (A) WB identifies exosome markers CD63, CD81 and CD9; (B) the size of healthy control serum exosomes; (C) the size of TNBC patient serum exosomes; Figure 2 Figure 2 is a diagram of proteomics screening ITGB2 of the present application; wherein (A) volcano plot of differentially expressed genes in GEO database, the horizontal coordinate represents the fold change of gene expression in different samples; the vertical coordinate represents the statistical significance of gene expression change, wherein the red dot represents the differentially expressed gene, and the blue dot represents the gene with no obvious difference; (B) DAVID database enrichment analysis of differential genes: the horizontal coordinate is the enrichment fold, the vertical coordinate is the enrichment pathway name, the bubble size represents the number of genes, and the bubble color represents the p value; (C) CIBERSORTx calculates the immune cell infiltration score of differentially expressed genes and differentially expressed proteins; (D) ITGB2 expression level in multiple data sets of GEO database; Figure 3 Figure 3 is an ITGB2 expression verification diagram of the present application; wherein (A) exosomes; (B) TNBC tissue; (C) cells; Figure 4 Figure ITGB2 modulated exosomes and fibroblast interaction diagram of the application; wherein, (A) WB detects the expression level of ITGB2 in TNBC serum exosomes; (B) qRT-PCR and WB detect the expression level of ITGB2 in TNBC tissue and paracancerous tissue; (C) qRT-PCR and WB detect the expression level of ITGB2 in TNBC cell MDA-MB-231 and normal breast epithelial cell MCF-10A; Figure 5 Figure TNBC exosome transmission ITGB2 activates fibroblasts diagram of the application; Figure 6 Figure Tumor volume change diagram of the application after injecting cells into nude mice; wherein, (A) tumor mass diagram, (B) tumor volume diagram, (C) tumor weight diagram; Figure 7 Figure CAF marker expression diagram in tumor tissue of the application in nude mice; wherein, (A) WB detects the expression of CAF marker respectively; (B) WB detects the expression level of CAF marker respectively; Figure 8 Figure Survival analysis diagram of the application. DETAILED DESCRIPTION
[0020] The principles and characteristics of the application are described below, and the examples are only used to explain the application and not to limit the scope of the application. If the specific technology or condition is not specified in the examples, it is performed according to the technology or condition described in the literature in the art, or according to the product manual. If the reagent or instrument is not specified by the manufacturer, it is a conventional product that can be purchased through a regular channel.
[0021] Source of materials and reagents: NF cells were purchased from Beijing Fenghui Biology; MDA-MB-231 cells were purchased from Punsai Biology; ITGB2 lentivirus was purchased from Jikai Biology; EMBODIMENT 1, TNBC exosome characteristics and proteomics screening ITGB2.
[0022] 1.1 Experimental method.
[0023] (1) Exosome separation: Serum exosomes were extracted using the exoRasy Maxi kit (Qiagen, Germany). The following steps were performed: 4 ml of buffer XBP was added, gently mixed five times, and the mixture was warmed to room temperature. 8 ml of the mixture was applied to a spin column and centrifuged at 500 x g for 1 minute to obtain the lower suspension. 10 ml of buffer XWP was added to the suspension, and the excess buffer was removed by centrifugation at 5000 x g for 5 minutes. 400 μl of buffer XE was added, incubated for 1 minute, and the exosome suspension was obtained by centrifugation at 500 x g for 5 minutes. The exosome suspension was then frozen at −80°C for subsequent studies.
[0024] (2) Proteomic analysis: A 200 μg sample was isotopically labeled according to the instructions of the AB iTRAQ Reagent-8plex Multiplex Kit (ABSCIEX). Separation was performed using an Easy nLC HPLC system and capillary high-performance liquid chromatography followed by mass spectrometry analysis using a Q-Exactive mass spectrometer (Thermo Finnigan). Mascot 2.2 and Proteome Discoverer 1.4 (Thermo) software were used for library identification and quantification. Peptide reporter ion peak intensities were quantified using Proteome Discoverer 1.4 software. Principal component analysis (PCA) was performed based on gene expression, and p-values were calculated using the T test. Unsupervised hierarchical clustering was performed to determine sample dispersion for differentially expressed proteins. GO and pathway analyses were performed on these differentially expressed proteins to characterize their functions.
[0025] 1.2 Experimental results
[0026] WB results showed that the extracted vesicles expressed exosome-specific markers CD9, CD81 and CD63 ( Figure 1 Middle A), indicating that the exosome extraction efficiency is high. There are differences in the physical properties of exosomes from TNBC patients and healthy individuals. The main peak of the size of exosomes in the serum of TNBC patients is around 222nm, while the main peak of the size of exosomes in the serum of healthy controls is around 146nm. The diameter of exosomes from TNBC patients is larger ( Figure 1 Middle B, Figure 1 Middle C). The exosome concentration of TNBC patients was (17.0±0.524)×10 8 particles / ml, and the serum exosome concentration of healthy controls was (14.3±1.25)×10 8 particles / ml, and the secretion of serum exosomes in TNBC patients was higher. Compared with the control group, a total of 3505 differentially expressed genes were identified in the TNBC group. The enrichment results of the DAVID database showed that the 3505 differentially expressed genes were mainly enriched in 45 signaling pathways, among which the inflammatory pathways such as regulatory T cell differentiation and PD-1 / PD-L1 immune checkpoint pathways had the highest enrichment scores. The immune infiltration scores of TNBC and the control group were calculated using CIBERSORTx software based on gene and protein expression, indicating that immune inflammation is an important link in the occurrence and development of TNBC. The association analysis of 90 differentially expressed proteins with 3505 differentially expressed genes using R software revealed that ITGB2 was particularly significant at both the gene and protein levels ( Figure 2 (in AD).
[0027] Combined with bioinformatics results, we studied ITGB2, a protein closely related to the tumor microenvironment. qRT-PCR and WB were used to detect the expression of ITGB2 in exosomes, triple-negative tissues, and cells of TNBC patients. Figure 3 The AC results showed that ITGB2 was highly expressed in TNBC exosomes, TNBC tissues, and cells.
[0028] Table 1 Primers used in qRT-PCR Among them, qRT-PCR detection of ITGB2: RNA of the cells was extracted and collected by the Trizol method, and the reference reaction system was: Total RNA: 7ul, Or Random Primer (0.1ug / ul): 1ul, 2×TS Reaction Mix: 10ul, TransScript@RT / RI Enzyme Mix: 1ul, gDNA Remover: 1ul, RNase-free Water Up to 20ul, for cDNA synthesis; fluorescence quantitative detection was performed by the SYBR method.
[0029] TNBC exosomes were co-cultured with NFs, and laser confocal microscopy revealed that NFs could phagocytize exosomes secreted by tumors. Furthermore, when ITGB2 was silenced, the ability of NFs to phagocytize exosomes was weakened ( Figure 4 A and C). To further confirm that ITGB2 is an important mediator involved in the phagocytosis of exosomes and NFs, exosomes secreted by ITGB2-silenced MDA-MB-231 cells and control MDA-MB-231 cells were co-cultured with NFs to detect the migration and invasion abilities of NFs. The results suggest that tumor cell-derived exosomes promote the migration and invasion abilities of NFs. When ITGB2 is reduced in exosomes, the migration and invasion abilities of cells are weakened (e.g., Figure 4 B).
[0030] WB detection of the expression of CAF activation markers a-SMA, FAP, and FSP after co-culture of TNBC exosomes and NFs showed that TNBC exosomes can significantly activate CAFs, and a-SMA, FAP, and FSP are significantly highly expressed Figure 5 ). It is suggested that TNBC exosomes release ITGB2 to activate NFs to CAFs after being phagocytosed by NFs.
[0031] The above research results suggest that exosomes secreted by tumor cells bind to NFs in the tumor microenvironment through ITGB2, release the carried genetic material to participate in the regulation of the tumor microenvironment, and promote tumor development and metastasis.
[0032] 2. Preparation and verification of ITGB2 inhibitors.
[0033] 2.1 Experimental method.
[0034] ① Synthesis of shRNA targeting ITGB2 Design and synthesize shRNA sequences targeting ITGB2 (such as SEQ ID NO: 1-3), and transfect TNBC cell lines (such as MDA-MB-231) through lentiviral vectors. Among them, ITGB2 shRNA high expression and low expression lentivirus are purchased from Shanghai Jikai Gene Co., Ltd. ② Virus transfection Take MDA-MB-231 cells with good growth state and a confluence rate of 90%, trypsinize the cells, and prepare 5x10 4 cells / ml single cell suspension with complete culture medium, add to 96-well plates according to experimental grouping (100 μl / well), and culture at 37℃ for 24 h until the cell confluence degree is about 30%.
[0035] Take the virus from the-80℃ refrigerator, slowly thaw on ice, and sequentially dilute the virus with serum-free culture medium to a titer of 1x10 7 TU / ml 50 μl. Remove the supernatant in each well, replace the culture medium according to the table below, add the virus and the corresponding infection enhancer, mix well, and continue to culture. Replace the normal culture medium after 72 h of infection. Replace the medium during the continued culture according to the growth status of the cells to maintain cell activity.
[0036] 2.2 Experimental results.
[0037] In vitro experiments confirmed that ITGB2 knockout significantly reduced exosome-induced fibroblast migration, invasion, and CAF marker (a-SMA, FAP, FSP) expression; Compared with the control group and the negative control group, the tumor growth of the ITGB2 silencing group was obviously inhibited, and the tumor size and diameter were obviously reduced, suggesting that ITGB2 inhibited tumor growth and development. Figure 7 Compared with the control group and the negative control group, the tumor growth of the ITGB2 silencing group was obviously inhibited, and the tumor size and diameter were obviously reduced, suggesting that ITGB2 inhibited tumor growth and development. Figure 6 Compared with the control group and the negative control group, the tumor growth of the ITGB2 silencing group was obviously inhibited, and the tumor size and diameter were obviously reduced, suggesting that ITGB2 inhibited tumor growth and development. Figure 7 Compared with the control group and the negative control group, the tumor growth of the ITGB2 silencing group was obviously inhibited, and the tumor size and diameter were obviously reduced, suggesting that ITGB2 inhibited tumor growth and development.
[0038] 3、ITGB2 and TNBC poor prognosis related verification and detection kit.
[0039] 3.1 Experimental method.
[0040] Based on WB or qRT-PCR technology, a kit for detecting the expression level of ITGB2 in serum exosomes or tissues is developed. 200 cases of TNBC patient cancer tissue specimens are detected by immunohistochemistry, the expression level of ITGB2 in TNBC patient tissues is analyzed, and prognosis analysis is carried out.
[0041] 3.2 Experimental results.
[0042] 200 cases of TNBC patient cancer tissue specimens are detected by immunohistochemistry, the expression level of ITGB2 in TNBC patient tissues is analyzed, and prognosis analysis is carried out, and clinical data analysis shows that the 5-year survival rate of patients with high expression of ITGB2 is significantly lower than that of the low expression group (74.36% vs 86.89%, p<0.05, Figure 8 ).
[0043] The results show that ITGB2 is significantly highly expressed in TNBC cancer tissues, and the survival rate of patients in the high expression group is significantly lower than that in the low expression group ( Figure 8 ), suggesting that ITGB2 is related to the poor prognosis of TNBC.
[0044] In summary, the present application first identifies ITGB2 as a key molecule for exosome regulation of tumor microenvironment in TNBC; proposes to block CAF activation mediated by exosomes by targeting ITGB2 (such as shRNA, antibody or small molecule inhibitor) to provide a new strategy for TNBC treatment; and the detection method based on the expression level of ITGB2 can be used for prognosis evaluation and personalized treatment guidance of TNBC.
[0045] Although the embodiments of the present application have been shown and described above, it should be understood that the above embodiments are exemplary and should not be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present application.
Claims
1. Use of inhibitory agents targeting ITGB2 in triple-negative breast cancer in the preparation of drugs for the treatment of triple-negative breast cancer.
2. The use according to claim 1, characterized in that The inhibitory agent includes at least one of an ITGB2 gene silencing agent, an antibody, and a small molecule compound.
3. The use according to claim 1, characterized in that The ITGB2 gene silencing reagent includes at least one of shRNA targeting ITGB2 and a recombinant vector containing shRNA targeting ITGB2.
4. The use according to claim 3, characterized in that The nucleotide sequences of the shRNA targeting ITGB2 are shown in SEQ ID NOs: 1-3.
5. The use according to claim 1, characterized in that By inhibiting the expression of ITGB2 or blocking its function, the activation of tumor-associated fibroblasts can be significantly reduced, inhibiting tumor growth and metastasis.
6. A pharmaceutical composition for the targeted treatment of triple-negative breast cancer based on inhibition of ITGB2, characterized in that: The pharmaceutical composition comprises the inhibitory agent for the ITGB2 target of triple-negative breast cancer according to claim 1.
7. The pharmaceutical composition for targeted treatment of triple-negative breast cancer based on inhibition of ITGB2 according to claim 6, characterized in that: The pharmaceutical composition also includes a chemotherapeutic agent.
8. The pharmaceutical composition for targeted treatment of triple-negative breast cancer based on inhibition of ITGB2 according to claim 6, characterized in that: The pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or auxiliary components.
9. Use of a detection reagent for the ITGB2 target of triple-negative breast cancer in the preparation of a diagnostic kit for the prognosis assessment of triple-negative breast cancer.
10. The use according to claim 9, characterized in that The diagnostic kit includes an antibody or a primer pair that specifically recognizes ITGB2.