Gene gmscamp3 for regulating symbiotic nitrogen fixation ability of soybean root nodule and application thereof

By providing the soybean root nodule symbiotic nitrogen fixation gene GmSCAMP3 and its application, the problem of regulating the symbiotic nitrogen fixation capacity of soybean root nodules was solved, thereby improving soybean yield and quality, and providing technical support for efficient nitrogen fixation in non-leguminous plants.

CN120775016BActive Publication Date: 2026-07-14XIANGHU LABORATORY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
XIANGHU LABORATORY
Filing Date
2025-07-21
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the nitrogen-fixing capacity of soybean root nodules, thus affecting soybean yield and quality.

Method used

This study provides the gene GmSCAMP3, which regulates the symbiotic nitrogen fixation ability of soybean root nodules, and its application. By constructing an expression vector and host cells, the gene is introduced into soybean cells to regulate the symbiotic nitrogen fixation process of soybean root nodules.

Benefits of technology

Enhancing the symbiotic nitrogen fixation capacity of soybeans will improve soybean yield and quality, providing technical support for efficient nitrogen fixation in non-leguminous plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The application discloses a gene GmSCAMP3 for regulating soybean root nodule symbiotic nitrogen fixation ability and application thereof. Specifically, the application provides a protein for regulating soybean root nodule symbiotic nitrogen fixation ability, and the amino acid sequence of the protein is shown as SEQ ID NO: 2. The application also provides a method for improving soybean yield or changing soybean root nodule symbiotic nitrogen fixation ability, which comprises the step of introducing a polynucleotide encoding the protein into a soybean cell or tissue to obtain transgenic soybean. It is found that the nitrogenase activity of Gmscamp3 mutant root nodule is only 65.79% of that of wild type root nodule, indicating that the GmSCAMP3 protein plays an important role in regulating the soybean root nodule symbiotic nitrogen fixation ability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and botany, and specifically relates to a gene GmSCAMP3 that regulates the nitrogen-fixing ability of soybean root nodules and its application. Background Technology

[0002] How legumes fix nitrogen through symbiotic relationships with rhizobia is a fundamental question in natural science and a potentially valuable economic and ecological issue. Through this symbiotic process, legumes and rhizobia can fix nearly 60 million tons of nitrogen from the atmosphere annually, meeting the nitrogen requirements of legumes while significantly reducing the use of chemically synthesized nitrogen fertilizers in agricultural production. Therefore, a thorough understanding of the molecular mechanisms underlying symbiotic nitrogen fixation is crucial for optimizing nitrogen utilization in legumes and achieving increased yields and improved quality. It also provides a theoretical basis for biological nitrogen fixation in non-legume plants.

[0003] Symbionts are nitrogen-fixing sites formed by the host plant membrane enveloping rhizobia. Their development, formation, and function all depend on the host cell's vesicle transport system. On one hand, the development of symbionts involves the transport and redistribution of plant-host membrane components. On the other hand, the symbiotic membrane, as the core interface for material and energy exchange between the symbiotic organisms, contains a large number of vesicle transport proteins, transporter proteins, and channel proteins. SCAMP (Secretory Carrier Membrane Protein) is an important vesicle transport component, widely found in plants, animals, and eukaryotes such as yeast. Unlike other vesicle transport components, SCAMP participates in multiple vesicle transport pathways, playing important roles in secretion / exocytosis, endocytosis, and circulation. Simultaneously, SCAMP plays a crucial role in host-microbe interactions. Therefore, studying the molecular mechanism of soybean symbiotic nitrogen fixation regulated by the inner membrane transport system with SCAMP protein as a breakthrough is of great significance. It can not only help improve the symbiotic nitrogen fixation capacity of soybean, increase soybean yield and quality, but also use genetic engineering to develop new biological nitrogen fixation efficiency-enhancing technologies, providing support for achieving efficient nitrogen fixation in non-leguminous plants. Summary of the Invention

[0004] In view of the above problems, the present invention provides a gene GmSCAMP3 that regulates the nitrogen fixation ability of soybean root nodules and its application, so as to provide further support for improving soybean yield and quality.

[0005] Specifically, the present invention provides the following technical solutions.

[0006] On the one hand, the present invention provides a protein that regulates the nitrogen-fixing ability of soybean root nodules, the amino acid sequence of which is shown in SEQ ID NO:2.

[0007] On the other hand, the present invention provides a gene that regulates the nitrogen-fixing ability of soybean root nodules, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0008] On the other hand, the present invention provides an expression vector comprising a polynucleotide encoding a protein as described above or a gene as described above.

[0009] In some embodiments, the expression vector comprises a marker, optionally selected from luminescent markers, antibiotic markers, and chemical resistance markers. Optionally, the luminescent marker is selected from red fluorescent protein and green fluorescent protein, the antibiotic marker is selected from ampicillin markers, chloramphenicol markers, kanamycin markers, neomycin markers, rifampin markers, spectinomycin markers, hygromycin markers, streptomycin markers, and tetracycline markers, and the chemical resistance marker is a herbicide resistance marker.

[0010] On the other hand, the present invention provides a host cell containing the expression vector as described above.

[0011] In some embodiments, the vector is a plant expression vector, including binary Agrobacterium rhizogenes vectors and / or vectors that can be used for plant micro-bombardment.

[0012] In some embodiments, the host cell is selected from Escherichia coli cells and Agrobacterium cells (e.g., Agrobacterium rhizogenes cells).

[0013] In some embodiments, the Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402, and R1601.

[0014] On the other hand, the present invention provides the use of polynucleotides encoding proteins as described above or genes as described above in the cultivation of legumes such as soybeans with increased yields or altered symbiotic nitrogen-fixing capabilities.

[0015] On the other hand, the present invention provides a method for increasing soybean yield or altering the symbiotic nitrogen fixation capacity of soybean root nodules, comprising the step of introducing a polynucleotide encoding a protein as described above, or a gene as described above, or an expression vector or host cell as described above into soybean cells or tissues to obtain transgenic soybeans.

[0016] definition

[0017] Acetylene reduction method: The detection principle of the acetylene reduction method is based on the reducing property of nitrogenase, that is, it can reduce acetylene (C2H2), which has a similar structure to N2, to ethylene (C2H4). Therefore, C2H2 can be used as a substitute substrate for N2, and the nitrogenase activity can be estimated by measuring the amount of C2H4 produced.

[0018] SPAD value: It represents the relative amount of chlorophyll in a plant, or the degree of greenness of the plant. Chlorophyll content is positively correlated with the nitrogen content in leaves.

[0019] ATS1: Its full name is ATP synthase β subunit. Attached Figure Description

[0020] Figure 1 The functional verification results of the GmSCAMP3 gene of this invention are shown. A shows the specific expression of GmSCAMP3 in the root nodule infection area; B further shows the specific expression of GmSCAMP3 in the root nodule infection area; C shows that the green fluorescence signal of the GFP-GmSCAMP3 fusion protein is mainly concentrated on the cell membrane and cytoplasmic punctate structures of leaf cells, which is very similar to the red fluorescence signal of plant endosome marker proteins; D shows the acquisition of the Gmscamp3 mutant; E shows the yellowish leaf color of the mutant plants 14 days after inoculation with rhizobia (NN represents normal nitrogen culture medium, Ino represents nitrogen-deficient culture medium after inoculation with rhizobia); F shows the SPAD values ​​of leaves of wild type and mutant; G shows the nitrogenase activity of wild type and mutant; H shows the vesicular structure in the infected cells of wild type and mutant root nodules; I shows the statistical analysis results of the vesicular structure in the infected cells of wild type and mutant root nodules; J shows the statistical analysis results of the number of rhizobia colonizing cells in the infected cells of wild type and mutant root nodules.

[0021] Figure 2 The pDEST-GUS vector is shown in the diagram. It uses spectinomycin as bacterial resistance, AtUBQ10 to drive DsRed as a positive plant selection marker, and inserts the relevant promoter sequence at a suitable restriction site before the ATG of the GUS sequence.

[0022] The statistical test method of this invention is Student's t test. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0024] Example 1: Cloning of a gene

[0025] In agricultural production, the efficiency of symbiotic nitrogen fixation significantly affects the yield and quality of soybeans, thus requiring precise regulation of nitrogen fixation efficiency. The purpose of this invention is to provide a gene that regulates the efficiency / capacity of soybean symbiotic nitrogen fixation and its application. Using molecular biology and comparative genomics, the inventors cloned a gene, Glyma.06G296900 (referred to as GmSCAMP3 in this paper), from the US soybean line Williams 82 (W82), which regulates the symbiotic nitrogen fixation capacity of soybean (Glycine max). The location of the GmSCAMP3 encoding gene in the Williams 82a4.V1 genome sequencing version is Gm06:48197353..48204403. The cloning of GmSCAMP3 provides a theoretical basis and genetic resource for subsequent molecular-assisted breeding and molecular design breeding.

[0026] Example 2: Analysis of the expression site of the GmSCAMP3 gene

[0027] Leguminous root nodule tissue can be mainly divided into two parts: the infection region (IR) and the cortex region (CR), with the infection region being the most important nitrogen-fixing area. We used micromanipulation to separate soybean root nodule IR and CR tissues, extracted RNA, and then used RT-qPCR to detect the gene expression level of GmSCAMP3 in each tissue. We found that GmSCAMP3 was specifically expressed in the root nodule infection region. Figure 1 A).

[0028] The RNA extraction kit used in this invention is the Kangwei Century CW0581 ultrapure RNA nucleic acid extraction kit.

[0029] The RT-PCR primers are as follows:

[0030] GmSCAMP3-qF CCTAAATAATGCAAAGGACGCAAA (SEQ ID NO:4)

[0031] GmSCAMP3-qR CCTCTATAACTATTCCAGCTCGTG (SEQ ID NO:5)

[0032] Internal reference primers

[0033] GmATS1-qFGCGATTCTTAAGCCAGCCTTT (SEQ ID NO:6)

[0034] GmATS1-qRACACACCCTGGAAACTGGTGA (SEQ ID NO:7)

[0035] This invention utilizes the Tiangen Talent qPCR PreMix (SYBR Green) kit for real-time quantitative PCR. First, the soybean cDNA obtained from reverse transcription was diluted 20-fold and used as an RT-qPCR template, then placed on ice. Simultaneously, the reagents in the kit were thawed, vortexed, and placed on ice for later use. The reaction is as follows:

[0036] 2 × Talent qPCR PreMix 10 μL

[0037] 0.6 μL each of 10 µM primers

[0038] 4 μL of diluted cDNA template

[0039] RNase-Free ddH2O 2.8 μL

[0040] Cap the tube, mix gently, and centrifuge briefly for 30 seconds until the bottom is reached. Place the reaction mixture in a real-time PCR instrument for the reaction. The reaction steps are as follows:

[0041] Step 1: 95 ℃ for 3 min;

[0042] Step 2: 95℃ for 5 seconds;

[0043] Step 3: 60 ℃ for 15 s;

[0044] Step 4: 72 ℃ for 15 s;

[0045] Step 5: Repeat steps 2-4 40 times.

[0046] Step 6: Dissolution curve analysis.

[0047] Example 3: Further validation of the expression specificity of the GmSCAMP3 gene in the root nodule infection region.

[0048] To further confirm the expression specificity of GmSCAMP3 in the root nodule infection region and to visualize its expression pattern, we constructed a vector pDEST-GUS that linked the GmSCAMP3 gene promoter sequence (the region 3000 bp before the ATG translation start site) to the β-glucuronidase (GUS) encoding gene. After transforming it into Agrobacterium rhizogenes K599 (Zhuangmeng Biotechnology (ZC1506D)), we obtained pGmSCAMP3-GUS transiently transformed roots using the soybean hairy root transformation system. After inoculation with rhizobium USDA110 (a gift from Professor Hans-Martin Fischer of ETH Zurich (Ledermann et al., 2015). Stable fluorescent and enzymatic tagging of Bradyrhizobium diazoefficiens to analyze host-plant infection and colonization. Mol. Plant-Microbe Interact. 28, 959-967), pGmSCAMP3A-GUS transformed root nodules were collected 28 days later, subjected to GUS histochemical staining, and observed under a microscope. Figure 1 (B) The results showed that the blue GUS staining signal specifically appeared in the soybean root nodule infection area, while almost no GUS signal was observed in the root tissue and root nodule cortex. This result further confirms that GmSCAMP3 is indeed a soybean root nodule infection-specific gene. These results indicate that GmSCAMP3 plays an important role in soybean symbiotic nitrogen fixation, especially in the infection process.

[0049] The carrier construction method is as follows:

[0050] The GmSCAMP3 promoter sequence was amplified using wild-type Williams 82 genomic DNA as a template. Simultaneously, the pDEST-GUS plasmid was thawed at -20°C on ice and subjected to a double enzyme digestion reaction to obtain a linear plasmid. After the reaction, the amplification and digestion products were subjected to agarose gel electrophoresis, and the gel containing the target band was excised under UV light and placed into a 2 mL centrifuge tube. The PCR-amplified DNA fragment and enzyme digestion products were recovered using the Promega agarose gel recovery kit. The vector was constructed using the TransGen Biotech Seamless Cloning and Assembly Kit (pEASY-Uni Seamless Cloning and Assembly Kit). Finally, the pGmSCAMP3-GUS vector was constructed by transformation with *E. coli*.

[0051] Reference for hairy root transformation experiment: Toth, K., Batek, J., and Stacey, G. (2016). Generation of soybean (Glycine max) transient transgenic roots. Curr ProtocPlant Biol 1, 1-13. 10.1002 / cppb.20017.

[0052] Example 4: Validation of GmSCAMP3A's role in intracellular endomembrane transport.

[0053] To clarify the role of GmSCAMP3 in intracellular endomembrane transport, we constructed an N-segment expression vector GFP-GmSCAMP3 fused with green fluorescent protein (GFP). Using an Agrobacterium-mediated transient transformation system, we co-expressed GmSCAMP3 with an RFP-tagged plant endosome marker vector (Yu, F., Lou, L., Tian, ​​M., Li, Q., Ding, Y., Cao, X., Wu, Y., Belda-Palazon, B., Rodriguez, PL, Yang, S., et al. (2016a). ESCRT-Icomponent VPS23A affects ABA signaling by recognizing ABA receptors for endosomal degradation. Mol. Plant 9:1570–1582.) in Nicotiana benthamiana leaves. Three days later, fluorescence signals in the leaves were observed using a laser scanning confocal microscope (CLSM). We found that the green fluorescence signal of the GFP-GmSCAMP3 fusion protein was mainly concentrated on the cell membrane and cytoplasmic punctate structures of leaf cells, which is very similar to the red fluorescence signal of plant endosome marker proteins. Figure 1 C). Subsequently, we superimposed the two fluorescence signals, and the results showed that the green fluorescence signal of GmSCAMP3 and the red fluorescence signal of the plant endosome marker protein could overlap well. Based on the localization characteristics of endosome proteins, the dotted structures indicated by the arrows in the figure are cytoplasmic endosome structures. The results suggest that GmSCAMP3A participates in the intracellular endomembrane transport process, that is, it is an important component of soybean symbiotic nitrogen fixation specific endomembrane transport.

[0054] The carrier is constructed as follows:

[0055] The GmSCAMP3 CDS sequence was amplified using wild-type Williams 82 cDNA as a template. Simultaneously, the pCambia1300-221-GFP.3 plasmid (Yu, F., Lou, L., Tian, ​​M., Li, Q., Ding, Y., Cao, X., Wu, Y., Belda-Palazon, B., Rodriguez, PL, Yang, S., et al. (2016a). ESCRT-I component VPS23A affects ABA signaling by recognizing ABA receptors for endosomal degradation. Mol. Plant 9:1570–1582) was removed from -20°C and thawed on ice. A double enzyme digestion system was then used to obtain the linear plasmid. After the reaction, the amplified and digested products were subjected to agarose gel electrophoresis, and the gel containing the target band was excised under UV light and placed in a 2 mL centrifuge tube. The PCR-amplified DNA fragments and enzyme digestion products were recovered using the Promega agarose gel recovery kit. The vector was constructed using the pEASY-Uni Seamless Cloning and Assembly Kit from TransGen. Finally, the pCambia1300-221-GFP-GmSCAMP3 vector was constructed by transformation with E. coli.

[0056] Tobacco co-expression experiment reference: Yu, F., Lou, L., Tian, ​​M., Li, Q., Ding, Y., Cao, 9:1570–1582.

[0057] Example 5: Verification of GmSCAMP3 regulation of soybean root nodule symbiotic nitrogen fixation

[0058] To clarify the regulation of nitrogen fixation in soybean root nodules by GmSCAMP3, we used the CRISPR-Cas9 gene editing system to edit the coding sequence of the GmSCAMP3 gene (sgRNA: GGACGCAAAAGCAAAGGAGAAGG, SEQ ID NO: 8), and obtained soybean W82 mutant Gmscamp3 plants with premature termination of GmSCAMP3 protein translation. Figure 1 D). Seeds of W82 wild-type and Gmscamp3 mutant were sown in greenhouse pots using vermiculite as a substrate and irrigated with nitrogen-deficient culture medium (1 / 2 Hoagland solution (nitrogen-free)). Three days after germination, the plants were inoculated with rhizobium USDA110. Compared to the W82 wild-type plants, the mutant plants showed a generally yellowish leaf color 14 days after inoculation with rhizobium, especially the first trifoliate leaf. Figure 1 (E and 1F), the mutant SPAD value was 19.56 / wild-type SPAD value 30.3867 = 64.37%. When the plants were watered with a complete nutrient medium (1 / 2 Hoagland solution (nitrogen-free) with 2.5 mM KNO3 added), the mutant leaves showed a similar yellowing phenotype to the wild type. The results indicate that the yellowing of Gmscamp3 plant leaves is caused by nitrogen deficiency, suggesting that the symbiotic nitrogen fixation ability of Gmscamp3 nodules is defective compared to the wild type. Subsequently, we used the acetylene reduction method to clarify that the symbiotic nitrogen fixation ability of Gmscamp3 mutant nodules is significantly defective compared to the wild type. Figure 1 (G) First, we collected root nodules from wild-type and Gmscamp3 mutants inoculated with rhizobium for 21 days, placed them in 20 mL sample vials, replaced an equal volume of air with 2 mL of acetylene, and incubated at room temperature for 1 h before analyzing them using gas chromatography. The results showed that the nitrogenase activity of Gmscamp3 mutant root nodules was only 65.79% of that of wild-type root nodules, indicating that the GmSCAMP3 protein plays an important role in regulating the symbiotic nitrogen fixation capacity of soybean root nodules.

[0059] We then used cellular experiments to elucidate the mechanism of reduced nitrogen fixation capacity in Gmscamp3 nodules. We observed the results of semi-thin sections of nodules from W82 wild-type soybean and the Gmscamp3 mutant under a microscope. Compared with wild-type nodules, the Gmscamp3 mutant nodules showed a significant increase in vesicular structures in the infected cells. Figure 1The mutant had 17.4% vesicular structures per infected cell compared to the wild-type (5.2% per infected cell) = 334.6%. Observation revealed that nearly half the volume of infected cells in the mutant root nodules was occupied by vesicular structures, while control root nodules showed only a small amount of vesicular structures. These results indicate that the Gmscamp3 mutant root nodules exhibit significant developmental defects compared to the wild-type W82. Furthermore, compared to wild-type W82 root nodule infected cells, the number of rhizobia colonizing the Gmscamp3 mutant root nodule infected cells was significantly reduced. Figure 1 (H and 1J), the number of rhizobia colonizing each infected cell in the mutant was 12.9 / the number of rhizobia colonizing each infected cell in the wild type was 51.1 = 25.2%. These results indicate that the reduced symbiotic nitrogen fixation capacity of Gmscamp3 nodules is due to defects in the development of infected cells and rhizobia colonization in the mutant nodules. In conclusion, the soybean nodule-specific inner membrane transport component GmSCAMP3 can regulate the symbiotic nitrogen fixation capacity of soybean nodules. This research contributes to improving the symbiotic nitrogen fixation capacity of soybean from a new perspective, increasing soybean yield and quality. It can also be used to develop novel bio-nitrogen fixation efficiency enhancement technologies using genetic engineering, providing support for achieving efficient nitrogen fixation in non-leguminous plants.

[0060] 1 / 2 Hoagland solution formulation (nitrogen-free)

[0061]

[0062]

[0063] SEQ ID NO:1 GmSCAMP3 CDS sequence

[0064] ATGAGTCGCTACGATCCCAATCCCTTCGACGAAGAACCGGTCGAGGTTAATCCCTTCGCGGATGGAGCAGCTAAAGGAAAAGGCTCAGGGCAATCAAGTTATAGTGGAGGTGCATTTTATACTACTAACACTGGAAGTGTTCCCTCCTCAAACTCAAGGCTCTCACCCCTTCCACCAGAGCCTTATGATCGTGGGGCAACTATTGACATCCCCCTAAATAATGCAAAGGACGCAAAAGCAAAGGAGAAGGAACTTCAAGCTAAAGAGGCTGAATTGAAAAGAAGGGAACAGGAACTAAAACGAAGGGAAGATGCTATAGCACGAGCTGGAATAGTTATAGAGGAGAAAAATTGGCCACCTTTTTTCCCCATCATTCATCATGACATTGCAAAGGAAATACCAGTACATCTTCAAAGGATCCAGTACATTGCATTTACAACATGGTTGGGTTTGGTTCTGTGTCTTTTGTGGAATATTGTGGCAGTTACTACTGCTTGGATCAAAGGAGAAGGTCCAACCATCTGGTTTCTTGCTATTATCTATTTTATTTCTGGTGCTCCAGGATCCTATGTGTTGTGGTATCGCCCTCTTTATCGTGCTATGAGGACTGACAGTGCTCTGAAATTTGGCTGGTTCTTCTTGCTTTACATGTTGCACATTGCCTTTTGCATTTTAGCTGCAGTTGCTCCACCAATTATCTTCAAAGGAAAATCTCTCACAGGCATTTTGGCTGCGATTGATGTGTTGGGAGACAATGCATTGGTTGGGATATTCTACTTCATTGGATTTGGCCTTTTCTGTCTCGAGTCAGTGCTGAGCATCTGGGTTATACAGCAAGTATATATGTACTTCCGTGGCAGTGGCAAGGCTGCAGTTTTAAAGCGTGAGGCTGCGAGAGGGACAATGATGGCAGCTCTATAA

[0065] SEQ ID NO:2 Amino acid sequence of GmSCAMP3

[0066] MSRYDPNPFDEEPVEVNPFADGAAKGKGSGQSSYSGGAFYTTNTGSVPSSNSRLSPLPPEPYDRGATIDIPLNNAKDAKAKEKELQAKEAELKRREQELKRREDAIARAGIVIEEKNWPPFFPIIHHDIAKEIPVHLQRIQYIAFTTWLGLVLCLLWNIVAVTTAWIKGEGPTIWFLAIIYFISGAPGSYVLWYRPLYRAMRTDSALKFGWFFLLYMLHIAFCILAAVAPPIIFKGKSLTGILAAIDVLGDNALVGIFYFIGFGLFCLESVLSIWVIQQVYMYFRGSGKAAVLKREAARGTMMAAL*

[0067] SEQ ID NO:3 Nucleotide sequence of the promoter of the GmSCAMP3 gene

[0068]

[0069] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of the GmSCAMP3 gene knockout in obtaining soybeans with reduced nitrogen fixation capacity, wherein the amino acid sequence of the protein encoded by the GmSCAMP3 gene is shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that, The nucleotide sequence of the GmSCAMP3 gene is shown in SEQ ID NO:1.