Fermentation method for improving yield of microbial oil and nervonic acid, strain and application

Abstract

The invention belongs to the technical field of biology, and discloses a genetic engineering strain for high yield of microbial oil and nervonic acid. The method comprises the following steps of: enhancing the expression of specific acyltransferase, enhancing the expression of a fatty acid elongase compound, knocking out pseudohypha forming genes and knocking out stearoyl-coenzyme A desaturase SCD genes to obtain the stearoyl-coenzyme A desaturase SCD gene. In yarrowia lipolytica chassis cells, a nervonic acid high-yield cell factory is obtained through systematic metabolic engineering, on the basis, through optimization of a fermentation culture medium and a fermentation process, the nervonic acid yield is further increased to 46.3 g / L (which is 2.7 times of the nervonic acid yield in the previously reported yarrowia lipolytica), the grease yield reaches 181.3 g / L, and the nervonic acid yield reaches 46.3 g / L (which is 2.7 times of the nervonic acid yield in the previously reported yarrowia lipolytica. The nervonic acid yield and the grease yield both reach the highest level reported at present.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a fermentation method for improving the yield of microbial oil and nervonic acid, a strain and application. BACKGROUND

[0002] Oil is a basic raw material for food, energy and chemical industry, and has a large demand. China imports about 100 million tons of various oil crops every year, and the import amount of soybeans alone reached 99.41 million tons in 2023, with a foreign dependence of more than 82%. At present, the source of oil is mainly oil plants, which occupies a large amount of arable land. If completely relying on domestic planting of soybeans, 600-800 million mu of arable land is needed, which cannot guarantee the food supply security of China with only 1.8 billion mu of arable land. In addition, China has imported nearly 10 million tons of edible oil for many consecutive years, with a high foreign dependence. It can be seen that oil shortage is an important problem affecting the national economy and people's livelihood.

[0003] With the rapid development of synthetic biology, using oil-producing microorganisms as a chassis to synthesize microbial oil from renewable raw materials has become a new route for obtaining oil. The fatty acid composition of natural microbial oil is mainly composed of hexadecanoic acid and octadecanoic acid, which is similar to that of plant oil and can replace plant oil. Compared with plant oil, microbial oil has the advantages of wide raw material sources, no seasonality in fermentation production, easy scale production and management, etc. The production cost of conventional microbial oil is still higher than that of soybean, palm and other plant oils, while functional oil has high value and strong market competitiveness, which meets the recent development trend of microbial oil industry. Various fatty acid esters are essential for the human body and have important health and medical application values. For example, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) of omega-3 polyunsaturated essential fatty acids have been commercialized. Monounsaturated fatty acids also have important effects on human health, among which, nervonic acid has functions of treating nerve demyelination diseases, promoting nerve development and relieving movement disorders, and shows a broad application prospect.

[0004] The main sources of nervonic acid include shark, garlic pear, Acer truncatum, Microthlaspi, microalgae, and a few molds. Due to the unsustainability of shark sources, researchers have begun to look for plants that can naturally synthesize nervonic acid. Studies have found that the oil of Cardamine graeca seeds contains 54% nervonic acid, and the oil of Lunaria annua seeds, which belongs to the same family, contains up to 25% nervonic acid. In addition, Malania oleifera, a national second-class protected wild plant distributed in western Guangxi and eastern Yunnan, contains up to 64.5% oil in dry weight during the oil accumulation period, with a nervonic acid content of up to 43.2%. However, this species has a long growth cycle and is difficult to scale up, making it unlikely to be widely promoted. Currently, nervonic acid on the market is mainly extracted from Acer truncatum and Xanthoceras sorbifolia. Acer truncatum, a species of Aceraceae widely distributed in China, is an economic tree species. The nervonic acid content of Acer truncatum oil is about 5.8% of the total oil, and the price of nervonic acid produced from Acer truncatum is as high as 10,000 yuan / kg. Another plant nervonic acid is mainly extracted from Xanthoceras sorbifolia, a plant of Sapindaceae distributed in northern China. The oil content of Xanthoceras sorbifolia seeds is 50-70%, and the nervonic acid content of Xanthoceras sorbifolia oil is 1.5-3.0%. In addition to animals and plants, many microorganisms in nature can also synthesize nervonic acid. Umemoto et al. from Kinki University in Japan isolated a filamentous fungus Mortierella capitata RD00096973 from soil that produces nervonic acid, with a nervonic acid content of 6.94%. Yuan Cheng et al. found that the nervonic acid content of Mychonastes afer HSO 3-1 was 3.8% of the total fatty acids.

[0005] The oil-producing microorganism has the advantage of customizable synthesis of fatty acids, and is a new route for the production of nervonic acid, which is expected to greatly reduce the production cost and revolutionize the way of obtaining nervonic acid. The oleaginous yeast Yarrowia lipolytica can accumulate more than 70% of its dry cell weight in lipids, and its growth rate is significantly faster than that of Saccharomyces cerevisiae. In addition, it has many advantages such as high fermentation density, simple genetic manipulation, wide carbon source utilization spectrum, and high safety, and has become an advantageous chassis for fatty acid development. The synthesis of lipids in Y. lipolytica using glucose and glycerol as raw materials has been widely and deeply studied. However, the high cost of these carbon sources hinders their application in microbial lipid production. In this regard, acetic acid as a low-cost substrate shows great potential in the field of biotechnology. The carbon content of acetic acid and glucose is equivalent, and they each contain 1 carbon atom per 30 molecular weight. The prices of acetic acid and glucose are about $324 and $479 per ton, respectively. Therefore, at the same price, the mass of acetic acid is 32% greater than that of glucose. Y. lipolytica shows excellent characteristics in lipid synthesis based on a sugar platform, so substrate metabolism and lipid synthesis based on an acetic acid platform need to be studied. However, the synthesis of lipids using acetic acid as a substrate is slower than that using glucose, and the number of enzymatic reaction steps is larger. Therefore, in the present invention, glucose is used as a supplemental carbon source to provide reducing power to the cell to synthesize high-energy biological products. Glucose and acetate are used as co-substrates to provide more energy and reduce energy consumption. In addition, various strategies are used in fermentation engineering and process engineering to improve the utilization rate. Finally, the titer and yield of various biochemical products produced by the engineered microorganism using acetate reach a more ideal level.

[0006] In Yarrowia lipolytica, glycerol 3-phosphate is used as a substrate in the process of assembling TAGs from acyl-CoA, and acyl-CoA is consumed at the same time, and acyl-CoA is sequentially transferred to the sn-1, -2 and -3 positions of glycerol 3-phosphate in the ER by four consecutive acyltransferases, including glycerol 3-phosphate acyltransferase (GPAT), lysophosphatidyl acyltransferase (LPAT), phosphatidic acid phosphatase (PAP) and diacylglycerol acyltransferase (DGAT), and finally form lipid droplets stored in the cytoplasm. At present, the plant seeds with the highest content of nervonic acid in nature are the seeds of Garcinia indica, and the transcriptome sequencing of the seeds of the early stage (nervonic acid accounts for 0.88% of the total fat) and the middle stage (nervonic acid accounts for 29.39% of the total fat) of Garcinia indica found that the expression of GPAT, LPAT and DGAT2 in the four consecutive acyltransferases was significantly increased in the rapid accumulation stage of oil in the middle stage of the fruit. It is speculated that acyltransferases have substrate selectivity, and can selectively promote the assembly of C18:1-CoA to form TAG, and specific acyltransfer is beneficial to the competition of C16 and C18 precursors. Therefore, in the present application, it is planned to enhance the esterification process of nervonic acid in the chassis cell by screening specific acyltransferases to increase the yield of nervonic acid.

[0007] The acyltransferases required for TAG formation, including GPAT, LPAT, and DGAT, have preferences for different acyl-CoAs. It is unknown whether the acyltransferases in the seeds of P. laurifolium have a preference for C24:1Δ15. Triglycerides are produced by yeast primarily through the "glycerol-3-phosphate pathway". Lysophosphatidic acid (LA) is produced from the reaction of fatty acyl-CoA (FA-CoA) and glycerol-3-phosphate (G3P) catalyzed by glycerol-3-phosphate acyltransferase (GPAT). Next, lysophosphatidic acid is converted to phosphatidic acid (PA) by the action of 1-acylglycerol-3-phosphate acyltransferase (LPAT) and fatty acyl-CoA. Phosphatidic acid phosphatase (PAP) catalyzes the synthesis of diacylglycerol (DAG). Diacylglycerol acyltransferase (DGAT) combines fatty acyl-CoA and DAG to produce triglycerides within the endoplasmic reticulum membrane. Finally, lipid bodies are formed on the opposite side of the endoplasmic reticulum. In Y. lipolytica strains, most fatty acids exist in the form of TAG, diacylglycerol (DAG), and monoacylglycerol (MAG) lipids. Once C16-acyl-CoA and C18-acyl-CoA are esterified to form lipids, they cannot be elongated to 24:1-acyl-CoA to synthesize nervonic acid. Therefore, acyltransferases that prefer C24:1-acyl-CoA can specifically catalyze more C24:1 to form TAG from the pool of C16 acyl-CoA, C18 acyl-CoA, and then form lipid droplets for storage, thereby increasing the production of nervonic acid. Lysophosphatidic acid acyltransferase (LPAT) is also an important rate-limiting enzyme in the process of plant seed TAG assembly and plays an important role in the selective esterification of fatty acyl-CoAs. Currently, the synthesis of very long chain monounsaturated fatty acids is well understood in plants. Plants use C18:1 as the direct substrate and elongate the carbon chain through a very long chain fatty acid chain elongation cycle, which can elongate the carbon chain of the original fatty acid by two carbon atoms each cycle. This elongation process is catalyzed and regulated by a combination of four enzymes (KCS, KCR, HCD, and ECR) forming an enzyme complex. Among them, KCS is the enzyme that catalyzes the first condensation reaction of fatty acid carbon chain elongation, and KCS with different substrate specificity determines the speed of the cycle reaction and the carbon chain length of the final very long chain fatty acid.

[0008] Yarrowia lipolytica as a natural oleaginous yeast has many advantages in the synthesis of fatty acid products. In the study of nervonic acid synthesis by Yarrowia lipolytica as a chassis cell, zhao et al. overexpressed MaELO3, AtKCS, CraKCS and CgKCS, and desaturase D15D, DGA1 or OLE1 to obtain the best nervonic acid production strain NA15, and the yield of nervonic acid was 0.185 g / L [Zhao, XR., Chen, XL., Yang, JL. et al. De novo synthesis of nervonic acid and optimization of metabolic regulation by Yarrowia lipolytica. Bioresour. Bioprocess. 10, 70 (2023). https: / / doi.org / 10.1186 / s40643-023-00689-6]. Wang et al. combined plant and non-plant fatty acid biosynthesis pathways, and the yield of nervonic acid reached 13.6 g / L [Wang, K., Lin, L., Wei, P., Ledesma-Amaro, R., & Ji, X. J. (2023). Combining orthogonal plant and non-plant fatty acid biosynthesis pathways for efficient production of microbial oil enriched in nervonic acid in Yarrowia lipolytica. Bioresource technology, 378, 129012. https: / / doi.org / 10.1016 / j.biortech.2023.129012]. In addition, the inventors of the present patent produced nervonic acid at a high level in the oleaginous yeast Yarrowia lipolytica in 2023, with a titer of 17 g / L [Su, H., Shi, P., Shen, Z. et al. High-level production of nervonic acid in the oleaginous yeast Yarrowia lipolytica by systematic metabolic engineering. Commun Biol 6, 1125 (2023). https: / / doi.org / 10.1038 / s42003-023-05502-w].

[0009] In summary, the prior art has the following defects and the advantages of the present application:

[0010] 1. Traditional plant production, high cost, long cycle;

[0011] 2. The highest yield of nervonic acid produced by Yarrowia lipolytica as a host cell before is 17g / L. The yield of nervonic acid is improved to 46.3g / L (2.7 times of the yield of nervonic acid produced by Yarrowia lipolytica reported before);

[0012] 3. The carbon content of acetic acid and glucose is equivalent, and they each contain 1 carbon atom per 30 molecular weights. The prices of acetic acid and glucose are about $324 and $479 per ton, respectively. Therefore, at the same price, the mass of acetic acid is 32% greater than that of glucose, and the use of acetic acid can reduce the production cost;

[0013] 4. The development of oil and nervonic acid synthesis using acetic acid as a carbon source can reduce the production cost, and the direct production cost is reduced to 1 / 10-1 / 5 of the cost of plant sources. SUMMARY

[0014] The purpose of the present application is to overcome the deficiencies in the prior art and provide a fermentation method, strain and application for improving the yield of microbial oil and nervonic acid.

[0015] The technical scheme adopted by the present application to solve its technical problems is:

[0016] A genetically engineered strain with high yield of microbial oil and nervonic acid, which is obtained by strengthening the expression of specific acyltransferase, strengthening the expression of fatty acid elongase complex, knocking out the pseudohyphal formation gene and knocking out the stearoyl-CoA desaturase SCD gene based on the strain YLNA9 as the starting strain.

[0017] Further, the gene sequence of the specific acyltransferase is SEQ ID No. 1, and the amino acid sequence thereof is SEQ ID No. 2; the gene sequence of the fatty acid elongase complex is SEQ ID No. 3; the gene sequence of the pseudohyphal formation gene is SEQ ID No. 4; and the gene sequence of the stearoyl-CoA desaturase SCD gene is SEQ ID No. 5.

[0018] Further, the yield of oil and nervonic acid after fermentation of the genetically engineered strain reaches 46.3g / L, and the yield of oil reaches 181.3g / L.

[0019] The method for constructing the genetically engineered strain as described above is as follows: based on the strain YLNA9, a strain YL2 is obtained by expressing acyltransferase MoLPAT; by enhancing the expression amount of KCR, HCD and ECR in the YL2, a strain YL3 is obtained; by knocking out the pseudohyphal formation gene RAS in the YL3, a strain YL4 is obtained; by knocking out the stearoyl-CoA desaturase SCD gene in the YL4, a strain YL5 is obtained, i.e. the genetically engineered strain for high-yield microbial oil and nervonic acid is obtained.

[0020] Further, the method comprises the following steps:

[0021] (1) Constructing the strain YL2

[0022] The MoLPAT gene is synthesized, and the plasmid vector is constructed by using the Gibson assembly method, and all assembly fragments are obtained by using the PCR amplification method; the plasmid backbone is derived from the pYL-POX5-CgKCS plasmid, and the plasmid is composed of the following five parts:

[0023] a) the screening marker Amp resistance gene and the replication initiation site pBR322 ori in the Escherichia coli;

[0024] b) the screening marker URA and its promoter PLEU2 and terminator in the Yarrowia lipolytica;

[0025] c) the upstream integration fragment POX5up of the site-specific integration site POX5;

[0026] d) the downstream integration fragment POX5dn of the site-specific integration site POX5 10;

[0027] e) the elongase CgKCS and its strong promoter pTEF and terminator XPR2;

[0028] All the PCR amplifications are performed by using the KAPA HiFi high-fidelity DNA polymerase, and the amplification system is 50 μl (2×KAPAMix, 25 ul; 10 μM primers, 1.5 ul each; template, 1 μl; add water to 50 μl), i.e. each DNA sequence is obtained; the amplification condition is as follows: 95 ℃ pre-denaturation for 3 minutes; 98 ℃ denaturation for 20 seconds, 60-72 ℃ annealing for 15 seconds, 72 ℃ extension, the extension time is calculated as 30 seconds per kb, the cycle number is 29-35; 72 ℃ extension for 10 minutes;

[0029] After the plasmid backbone and the MoLPAT esterification enzyme gene fragment obtained above are assembled and transformed into the Escherichia coli competent Trans-T1, the recombinant plasmid pYL-POX5-MoLPAT of the MoLPAT gene is obtained by using the primers JD-F and JD-R for colony PCR and sequencing verification;

[0030] The process of transforming yeast with the recombinant plasmid is as follows:

[0031] The method of transforming Yarrowia lipolytica with the linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification is as follows:

[0032] 1) Scrape 2-3 inoculation rings of the overnight culture of the flat plate bacteria;

[0033] 2) Add the following ingredients in sequence, 90 μL of 50% (mass concentration) PEG, 5 μL of 2M LiAc, 5 μL of 2M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally add the fragment to be transformed;

[0034] 3) Mix thoroughly and place in a 30°C water bath for 1 h;

[0035] 4) Heat shock at 39°C for 10 min;

[0036] 5) Take the mixed solution of the transformation system and evenly spread it on the corresponding YNB selection plate, and incubate in a 28°C constant temperature incubator for 2-3 d, and then perform subsequent operations after single colonies grow;

[0037] (2) Construction of strain YL3

[0038] The KCR, HCD and ECR elongase complex genes were synthesized, and the plasmid vector was constructed by the Gibson assembly method. All the assembly fragments were obtained by PCR amplification. The plasmid backbone was derived from the pPICZaA plasmid, which was composed of the following parts:

[0039] a) The selection marker blasticidin resistance gene in E. coli and Yarrowia lipolytica, and its strong promoter TEFin and terminator CYC1t;

[0040] b) The KCR, HCD and ECR elongase complex fusion expression cassette and its promoter pLDP1 and terminator AOX1t;

[0041] All the above PCR amplifications used KAPA HiFi high-fidelity DNA polymerase, and the amplification system was 50 μl (2x KAPAMix, 25 ul; 10 μM primers each 1.5 ul; template 1 μl; add water to 50 μl). Each DNA sequence was obtained. The amplification conditions were as follows: 95°C pre-denaturation for 3 minutes; 98°C denaturation for 20 seconds, 60-72°C annealing for 15 seconds, 72°C extension, the extension time was calculated as 30 seconds per kb, the cycle number was 29-35; 72°C extension for 10 minutes.

[0042] The recombinant plasmid was transformed into yeast as follows:

[0043] The recombinant plasmid was transformed into yeast as follows:

[0044] The linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification was transformed into Yarrowia lipolytica as follows:

[0045] 1) Scrape 2-3 inoculation ring of overnight culture plate bacteria;

[0046] 2) Add the following ingredients in turn, 50% (mass concentration) PEG (3350) 90 μL, 2M LiAc 5 μL, 2M DTT (freshly prepared) 5 μL, salmon sperm DNA, 5 μL, DMSO 5 μL, and finally add the fragment to be transformed;

[0047] 3) Mix thoroughly and place in a 30°C water bath for 1 h;

[0048] 4) Heat shock at 39°C for 10 min;

[0049] 5) Take the mixed solution of the transformation system and evenly spread it on the corresponding YPD+bleomycin selection plate (yeast extract 10 g / L, peptone 20 g / L, glucose 10 g / L), and incubate in a 28°C constant temperature incubator for 2-3 d. After single colonies grow, subsequent operations are performed;

[0050] (3) Construction of strain YL4

[0051] The plasmid vector was constructed using the Gibson assembly method, and all assembly fragments were obtained by PCR amplification. The plasmid backbone was derived from pYL-POX5-MoLPAT plasmid, which was composed of the following parts:

[0052] a) Screening marker Amp resistance gene and replication origin pBR322 ori in E. coli;

[0053] b) Screening marker URA and its promoter PLEU2 and terminator in Yarrowia lipolytica;

[0054] c) Upstream integration fragment RASup of the site-specific integration site RAS;

[0055] d) Downstream integration fragment RASdn of the site-specific integration site RAS;

[0056] All the above PCR amplifications were performed using KAPA HiFi High-Fidelity DNA Polymerase, and the amplification system was 50 μl (2x KAPA Mix, 25 ul; 10 μM primers, 1.5 ul each; template, 1 μl; add water to 50 μl). The DNA sequences were obtained. The amplification conditions were as follows: 95 °C pre-denaturation for 3 min; 98 °C denaturation for 20 s, 60-72 °C annealing for 15 s, 72 °C extension, the extension time was calculated as 30 s per kb, and the cycle number was 29-35; 72 °C extension for 10 min;

[0057] After the plasmid backbone and the KCR, HCD and ECR elongase complex gene fragments obtained above were assembled, they were transformed into E. coli competent Trans-T1, and then primers JD2-F and JD2-R were used for colony PCR and sequencing verification, so as to obtain the recombinant plasmid pYL-RtKHE of the KCR, HCD and ECR elongase complex gene;

[0058] The process of transforming yeast with the recombinant plasmid is as follows:

[0059] The method for transforming Y. lipolytica with the linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification is as follows:

[0060] 1) Scrape 2-3 inoculation rings of overnight cultured plate bacterial lawn;

[0061] 2) Add the following ingredients in turn: 90 μL of 50% (mass concentration) PEG (3350), 5 μL of 2 M LiAc, 5 μL of 2 M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally add the fragment to be transformed;

[0062] 3) Mix thoroughly and place in a 30 °C water bath for 1 h;

[0063] 4) Heat shock at 39 °C for 10 min;

[0064] 5) Take the mixed liquid of the transformation system and evenly spread it on the corresponding YNB selection plate, and incubate in a 28 °C constant temperature incubator for 2-3 d. After single colonies grow, subsequent operations are performed;

[0065] (5) Construction of strain YL5

[0066] The plasmid vector was constructed by the Gibson assembly method, and all the assembly fragments were obtained by PCR amplification. The plasmid backbone was derived from pYL-POX5-MoLPAT plasmid, which was composed of the following parts:

[0067] a) The selection marker Amp resistance gene and the replication initiation site pBR322 ori in E. coli;

[0068] b) screening marker URA in Yarrowia lipolytica and its promoter PLEU2 and terminator;

[0069] c) upstream integration fragment SCDup of the site-specific integration site SCD;

[0070] d) downstream integration fragment SCDdn of the site-specific integration site SCD;

[0071] All the above PCR amplifications adopt KAPA HiFi high-fidelity DNA polymerase, and the amplification system is 50 μl, i.e. 2x KAPA Mix, 25 ul; 10 μM primers, 1.5 ul each; template, 1 μl; add water to 50 μl, i.e. to obtain each DNA sequence. The amplification conditions are as follows: 95 °C pre-denaturation for 3 minutes; 98 °C denaturation for 20 seconds, 60-72 °C annealing for 15 seconds, 72 °C extension, the extension time is calculated as 30 seconds per kb, and the cycle number is 29-35; 72 °C extension for 10 minutes;

[0072] After the plasmid backbone and the above obtained KCR, HCD and ECR elongase complex gene fragments are assembled, they are transformed into E. coli competent Trans-T1, and then primers JD2-F and JD2-R are used for colony PCR and sequencing verification, so as to obtain the recombinant plasmid pYL-RtKHE of KCR, HCD and ECR elongase complex gene;

[0073] The process of transforming the recombinant plasmid into yeast is as follows:

[0074] The method for transforming the linearized recombinant plasmid or the acyltransferase MoLPAT gene transformation fragment obtained by PCR amplification into Yarrowia lipolytica is as follows:

[0075] 1) Scrape 2-3 inoculation rings of overnight culture of the plate bacterial lawn;

[0076] 2) Add the following ingredients in turn: 90 μL of 50% (mass concentration) PEG, 5 μL of 2M LiAc, 5 μL of 2M DTT, 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally add the transformation fragment;

[0077] 3) Mix thoroughly and place in a 30 °C water bath for 1 h;

[0078] 4) 39 °C water bath heat shock for 10 min;

[0079] 5) Take the mixed liquid of the transformation system and evenly spread it on the corresponding YNB selection plate, and cultivate in a 28 °C constant temperature incubator for 2-3 d, and then perform subsequent operations after single colonies grow.

[0080] The genetically engineered strain as described above is applied in the production of oil and nervonic acid.

[0081] A fermentation method for improving the production of microbial oil and nervonic acid by using the genetically engineered strain as described above, which obtains a high-yield cell factory of nervonic acid in Yarrowia lipolytica chassis cells through systems metabolic engineering, and further improves the production of oil and nervonic acid by using the genetically engineered strain and optimizing the fermentation medium and fermentation process.

[0082] Further, the method comprises the following steps:

[0083] The steps of the shake flask fermentation method of the genetically engineered strain are as follows:

[0084] 1) Take the preserved genetically engineered strain from the-80℃ preservation tube, inoculate into the YPD seed activation medium (yeast powder 10g / L, peptone 20g / L, glucose 10g / L, solvent water, mix well and sterilize at 115℃ for 30min.), cultivate at 28℃, 250rpm for 24h, and obtain the activated bacterial liquid;

[0085] 2) Take the activated bacterial liquid and spread on the YPD seed activation solid medium plate (yeast powder 10g / L, peptone 20g / L, glucose 10g / L, agar powder 20g / L, solvent water, mix well and sterilize at 115℃ for 30min.), cultivate at 28℃ for 18h;

[0086] 3) Pick a single colony from the plate and inoculate into 5ml seed medium, i.e. one transfer, cultivate for 36h, then inoculate 100μL into 5ml seed medium, i.e. two transfers, cultivate for 36h, then transfer into shake flask fermentation medium, with the initial OD of 0.08, shake for 144h, and obtain oil and nervonic acid;

[0087] The composition of the fermentation medium is: glucose 150g / L, yeast powder 12g / L, ammonium sulfate 6g / L, sodium acetate 8g / L, high-oleic rapeseed oil 10g / L, solvent water, mix well and sterilize at 115℃ for 30min.

[0088] Further, the genetically engineered strain is used for fed-batch fermentation in a fermentation tank with acetic acid as the carbon source, and the steps are as follows:

[0089] The preserved bacteria YL5 is taken out from a -80 DEG C preservation tube, inoculated into YNB culture medium, and cultured at 28 DEG C and 250 rpm for 24 hours; then inoculated into YNB culture medium as a first-stage seed, and cultured at 28 DEG C and 250 rpm for 24 hours; after 24 hours, the first-stage seed is inoculated into seed culture medium with an initial OD of 0.08, and cultured at 28 DEG C and 250 rpm for 18 hours until the OD grows to 8-10 as a second-stage seed; the fermentation tank is filled with fermentation culture medium, and the inoculation amount is 10% with an initial liquid volume of 60% of the tank volume;

[0090] The fermentation process is controlled, the fermentation temperature is 28 DEG C, the pH is controlled at 6.5 by using pure acetic acid after the pH starts to rise to 6.5, the stirring is associated with the dissolved oxygen, the dissolved oxygen is controlled to be more than 20%, the cascade control rotating speed is between 200-680 rpm; the tank pressure is not specially controlled in the first 24 hours, and is controlled to be 0.01-0.03 MPa after 24 hours, and the total culture time is 192 hours; the defoaming agent is added in the fermentation culture medium with a final concentration of 3-5 parts per million;

[0091] The YNB culture medium is: glucose 20 g / L, amino acid-free and ammonium sulfate-free yeast nitrogen source 1.7 g / L, ammonium sulfate 5 g / L, CSM-Ura 0.69 g / L, and the solvent is water;

[0092] The fermentation culture medium is: glucose 150 g / L, yeast powder 12 g / L, ammonium sulfate 6 g / L, sodium acetate 8 g / L, high-oleic rapeseed oil 10 g / L, and the solvent is water, and after being mixed, sterilization is carried out at 115 DEG C for 30 minutes.

[0093] The method as described above is applied to the simultaneous production of microbial oil and nervonic acid.

[0094] The application has the following advantages and positive effects:

[0095] 1. The application comprises a new process for improving microbial oil production by using acetic acid / acetic acid salt as a carbon source and improving nervonic acid production by adding low-price edible oil.

[0096] 2. The application finds that acetic acid / acetic acid salt is more beneficial to improving oil production than glucose, the oil production is improved by 48.5% in shake flask fermentation, and the oil production is improved by more than 80% and the nervonic acid production is improved by 42.5% in fermentation tank fermentation.

[0097] 3、In order to improve the production of nervonic acid, the fatty acid elongation module is strengthened in the application. The proportion of nervonic acid in total oil is increased from 19.94% to 21.5%.

[0098] 4、The application first tests the mixed carbon source of glucose and acetate, and finds that 8 g / L of sodium acetate does not have the highest effect on the improvement of biomass, but has a significant effect on the improvement of oil yield, and the oil concentration is increased from 10.11 g / L of the control group to 15.08 g / L. In order to improve the content of nervonic acid, the application selects RAS as a homologous recombination site to destroy its function, so as to inhibit the change from yeast form to pseudohyphal form, so as to obtain a high-yield strain of nervonic acid, and the proportion of nervonic acid in total oil is increased to 22.93% at most. The proportion of C24:1, n9 is increased to 25% by weakening SCD, which shows that adjusting the fatty acid desaturation module helps to promote the synthesis of nervonic acid.

[0099] The inventors of the present application have obtained a series of authorized patents in the field of gene and strain construction for synthesizing oil and nervonic acid in Yarrowia lipolytica (ZL201810309632.4, ZL201910747616.8, PCT / CN2019 / 081736, ZL202111552485.1). Based on acetic acid / acetate raw materials and low-grade edible oil, the application provides a new fermentation process for improving the yield of microbial oil and nervonic acid.

[0100] 5、The application obtains a high-yield cell factory of nervonic acid in Yarrowia lipolytica through system metabolic engineering, and further improves the yield of nervonic acid to 46.3 g / L (2.7 times of the previously reported yield of nervonic acid in Yarrowia lipolytica), and the yield of oil reaches 181.3 g / L. The yield of nervonic acid and oil reaches the highest level reported in Yarrowia lipolytica. At the same time, the synthesis of oil and nervonic acid with acetic acid as the carbon source not only can reduce the production cost (the direct production cost is reduced to 1 / 10-1 / 5 of the cost of plant source), but also has important significance in carbon emission reduction. The application provides support for the development of high-efficiency oleaginous microorganisms, and lays a foundation for the industrialization of nervonic acid. BRIEF DESCRIPTION OF DRAWINGS

[0101] Figure 1 Figure 2 is a graph showing the effect of sodium acetate and ammonium acetate on the yield of oil and biomass in the application; wherein A is a graph showing the effect of sodium acetate and ammonium acetate on the yield of oil; B is a graph showing the effect of sodium acetate and ammonium acetate on the biomass;

[0102] Figure 2 Figure 4 is a graph showing the effect of p-exogenous oil addition on the synthesis of nervonic acid in the application;

[0103] Figure 3Figure for the influence of oleic acid addition on nervonic acid synthesis in the present application;

[0104] Figure 4 Figure for the influence of rapeseed oil addition on YL3 nervonic acid synthesis in the present application; wherein A is the figure for the influence of 10 g / L rapeseed oil addition on the proportion of nervonic acid in total oil, and B is the figure for the fatty acid composition analysis of YL3 strain after 10 g / L rapeseed oil addition;

[0105] Figure 5 Figure for the fermentation results of YL5 in a 5L bioreactor in the present application;

[0106] Figure 6 Figure for the fermentation results of YL5 using mixed carbon sources in a 5L bioreactor in the present application. DETAILED DESCRIPTION

[0107] The present application is further described below in conjunction with examples, which are descriptive rather than limiting, and cannot be used to limit the protection scope of the present application.

[0108] The various experimental operations involved in the specific examples are all conventional techniques in the art, and the parts not specifically annotated in the text can be implemented by referring to various commonly used tool books, scientific and technical literature or related instructions, manuals, etc. before the application date of the present application.

[0109] Specifically, the relevant preparation and detection are as follows:

[0110] Example 1 Construction of a high-yield nervonic acid cell factory

[0111] The strains used in the present application are shown in Table 5, and these strains are obtained by using the strategies of strengthening the expression of specific acyltransferase, strengthening the expression of fatty acid elongase complex, knocking out the pseudomycelium formation gene, and knocking out the stearoyl-CoA desaturase (SCD) gene. The relevant sequences are described as follows.

[0112] 1.1 Sequence of acyltransferase

[0113] >SEQ ID No. 1

[0114] MoLPAT gene sequence

[0115] GGCAACACCGGCGACGCCTCTTTCCTGCGAAACCGACGACTGGACTCTTTCCTGACCGCCGACTCTGTGCCCAACGCCCGAGAGTCTTCTAAGGCCGATCAGCTGAAGGAGGAGACCGCCCCCAAGCAGCGATCTCCCGAGTCTTACGAGGACGATGACGGCTGGGCCGCCGTGATCATCTCTTGTGTGCGAATCGTGACCTGTTTCGTGACCATGATGGTGACCACCTTCCTGTGGGCCCTGATCATGGTGGTGCTGATCCCCTGGCCCTATCAGCGAATCCGACAAGGCAACGTGTACGGCCACGTGACCGGCAAGCTCATGATGTGGATTCTGGGCAACCCCATCCGAATCGAGGGCGCCGAGTTCTCTAACGAGCGAGCCATCTACGTGTCTAACCACGCCTCTCCCATCGACATCTTCCTGATGATGTGGCTCACCCCCACCGGCTCTGTGGGCATCGCCAAGAAGGAGATCATCTGGTATCCCCTGTTCGGACAGCTGTACATCCTGGCCAACCACCTGCGAATCGACCGATCTAACCCCAACGCCGCCATCGAGTCTATGAAGGAGGCCGCCTCTGCCGTGGTGAAGAACAACCTGTCTCTGATCATCTTCCCCGAGGGCACCCGATCTAAGAACGGCCGACTGCTGCCCTTCAAGAAGGGCTTCGTGCACCTGGCCCTGCAGTCTCGACTGCCCATCGTGCCCGTGGTGCTGACCGGCACCCACCGAGCCTGGCGAAAGGGCTCTCTGCACATCCGACCCGCCCCCCTGACCGTGTCTTACCTGCCCCCCATCCGAACCGACGATTGGACCGCCGACAAGATCGAGGACTACGTGGGCATGGTGCACGAGATCTACGTGAAGCACCTGCCCGAGTCTCAGCGACCCCTGGTGTAA

[0116] (a) Sequence features:

[0117] • Length: 903

[0118] • Type: DNA sequence

[0119] • Chain type: single

[0120] • Topology: linear

[0121] (b) Molecular type: DNA

[0122] (c) Hypothesis: no

[0123] (d) Antisense: no

[0124] (e) Original source: Malania oleifera

[0125] Sequence features: The nucleotide sequence of the coding product of this gene is acyltransferase.

[0126] >SEQ ID No. 2

[0127] MoLPAT amino acid sequence

[0128] GNTGDASFLRNRRLDSFLTADSVPNARESSKADQLKEETAPKQRSPESYEDDDGWAAVIISCVRIVTCFVTMMVTTFLWALIMVVLIPWPYQRIRQGNVYGHVTGKLMMWILGNPIRIEGAEFSNERAIYVSNHASPIDIFLMMWLTPTGSVGIAKKEIIWYPLFGQLYILANHLRIDRSNPNAAIESMKEAASAVVKNNLSLIIFPEGTRSKNGRLLPFKKGFVHLALQSRLPIVPVVLTGTHRAWRKGSLHIRPAPLTVSYLPPIRTDDWTADKIEDYVGMVHEIYVKHLPESQRPLV

[0129] (a) Sequence features:

[0130] • Length: 300

[0131] • Type: amino acid sequence

[0132] • Chain type: single

[0133] • Topology: linear

[0134] (b) Molecular type: amino acid

[0135] (c) Hypothesis: no

[0136] (d) Antisense: no

[0137] (e) Original source: Malania oleifera

[0138] Sequence features: The amino acid sequence of the acyltransferase encoded by this gene.

[0139] The strain YL2 expressing acyltransferase MoLPAT was obtained based on the strain YLNA9, and the specific construction process of the strain YL2 is as follows:

[0140] 1.2 Construction of acyltransferase recombinant plasmid and yeast transformation

[0141]

[0142]

[0143]

[0144] h) Upstream integration fragment of site POX5, POX5up (atctatcggtgcaagtatcgtacagtagacatgtgctattggtaaccctcggtattggctaggtttcgtatcagggatacagttcaacgctgatcgcatatggcatgattccggctcgacacagcgaccaagaaccaagcgtgtatgtcgtagacttgcaaatcatgtggggcttatccccggatttccccaagtcacgttttcacaaaggctgtctcccgaatgcatgagccgaggcaggctaaactggtttgttcatgtaccccacacaacgtaaagatgcaccccatgtgcagtgaaataccacaagtatatatataccgacctacccgagatagcaaattgattctacacttacactaccaattcttacatcaaaccaaacatgaacaacaaccccaccaacgtgatccttggaggcaaggagtacgacaccttcaccgagcctccggcccagatggagctggagcgagccaagacacaattcaaggtccgagacgtgaccaacttcctcacaggcagcgagcaggagacactgctgaccgagcgaatcatgcgggagattgagcgagatcccgttctcaacgtcgccggcgactacgacgccgatcttcccaccaagcgacgacaagctgttgagcgaatcggggctctggcccgatacctgcccaaggattccgagaaggaggccattttgcgaggccagctgcatggtattgtggacatgggtacccgaacccgaatcgccgttcactacggtctgtttatgggcgccattcgtggctcaggaaccaaggagcagtacgattactgggtcgccaagggcgccgctactctgcacaaattctatggctgctttgccatgactgagctgggtcacggatctaacgtggccggtctcgagaccaccgccacccttgataaggacaccgacgagttcatcatcaacac);

[0145] i)定点整合位点POX510的下游整合片段POX5dn(actaagctcatcgactacccctaccaccaacgacgtctgctgcctcttctggcctacacctacgccatgaagatgggcgccgacgaggcccagcagcagtacaactcctcctttggcgctcttctcaagctcaaccccgtcaaggacgctgagaagtttgctgtcgccactgccgacctcaaggctctgtttgcctcttctgccggaatgaaggccttcaccacctgggctgccgccaagatcattgacgagtgccgacaggcctgtggtggccatggctactccggctacaacggtttcggtcaggcttacgccgactgggtcgtccaatgcacttgggagggtgacaacaacgtgctgtgtctgtccatgggtcgatcgctcatccagtcgtgcattgccatgagaaagaagaagggccatgtcggcaagtcggtcgagtacctgcagcgacgagacgagctgcagaatgcccgagttgacaacaagcctctcactgaccctgctgtgctcatcactgcatgggagaaggttgcctgcgaggccatcaacagagccactgactccttcatcaagctcacccaggagggtctgtctcctgaccaggcctttgaggagctgtctcaacagagatttgagtgtgcgcgaatccacacccgaaagcatctgatcacctcgttctacgctcgaatctccaaggccaaggcccgagtcaagccccaccttactgttcttgccaacctctttgccgtctggtccatcgaggaggactctggtctcttccttcgggagggctgcttcgagcctgccgagatggacgagatcaccgctctggtcgacgagctgtgctgcgaggctcgagagcaggtcattggattcaccgacgccttcaacctgtccgacttcttcattaacgcccccattggccgattcgacggagacgcctacaagcactacatg);

[0146]

[0147] Table 1 Primers used to construct plasmid pYL-POX5-MoLPAT

[0148] Primer name Primer sequences MoLPAT_f ctaaccgcagGGCAACACCGGCGACGCC MoLPAT_r caacgtggggTTACACCAGGGGTCGCTGAGACTC POX5_f cctggtgtaaCCCCACGTTGCCGGTCTT POX5_r cggtgttgccCTGCGGTTAGTACTGCAAAAAGTGC

[0149] All PCR amplifications described above used KAPA HiFi high-fidelity DNA polymerase. The amplification system was 50 μl (2× KAPA Mix, 25 μl; 1.5 μl of each 10 μM primer; 1 μl of template; and water was added to make up to 50 μl) to obtain each DNA sequence. Amplification conditions were: pre-denaturation at 95°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing at 60-72°C for 15 seconds, and extension at 72°C (30 seconds per kb, 29-35 cycles); and extension at 72°C for 10 minutes.

[0150] After assembling the plasmid backbone and the MoLPAT esterase gene fragment obtained above, they were transformed into Escherichia coli competent cells Trans-T1 (Beijing Quanshijin Biotechnology Co., Ltd.). The transformation method of Escherichia coli was as follows: take out the competent cells Trans1-T1 from -80°C, thaw them on ice, and immediately add 10 μL of the ligation product or plasmid to 100 μL of the competent cells as soon as the competent cells thawed; ice bath for 30 minutes; heat shock at 42°C for 30 seconds; ice bath for 2 minutes; add 800 μL of LB medium and incubate at 37°C shaker at 200 rpm for 1 hour to allow the cells to recover; if it is a ligation product, centrifuge at 6,000 rpm for 2 minutes and then spread all the bacteria onto an LB plate containing antibiotics (ampicillin, final concentration 100 mg / L). If it is a transformation plasmid, take 50-200 μL of the bacterial solution and directly spread it onto an LB solid plate containing ampicillin (final concentration 100 mg / L); culture in a 37°C constant temperature incubator overnight.

[0151] Then, primers JD-F and JD-R (JD-F: ccacccttgataaggacaccgacgagttc; JD-R: ggcaacagcgttgggagagccctt)) were used for colony PCR verification. The colony verification PCR reaction system was:

[0152] Components Volume (μL) 2×EasyTaq DNA Polymerase 10 μL Forward primer 0.5μL Reverse primer 0.5μL Template 1 μL ddH2O 8μL

[0153] The transformants successfully verified by colony PCR were sequenced (Beijing Qingke Biotechnology Co., Ltd.) to obtain the recombinant plasmid pYL-POX5-MoLPAT of the MoLPAT gene.

[0154] The process of transforming yeast with recombinant plasmid is as follows:

[0155] The linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification is transformed into Yarrowia lipolytica as follows:

[0156] 1) Scrape 2-3 inoculating loops of overnight cultured bacterial lawn;

[0157] 2) Add the following ingredients in sequence: 90 μL of 50% (mass concentration) PEG (3350), 5 μL of 2M LiAc, 5 μL of 2M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally the fragment to be transformed;

[0158] 3) Mix thoroughly and place in a 30°C water bath for 1 hour;

[0159] 4) Heat shock in a 39°C water bath for 10 min;

[0160] 5) The transformation mixture was evenly spread onto corresponding YNB screening plates (YNB medium: 20 g / L glucose, 1.7 g / L yeast nitrogen base (without amino acids and ammonium sulfate) (Sangon Biotech, Shanghai, China), 5 g / L ammonium sulfate, 0.69 g / L CSM-Ura (MP Biomedicals, Solon, OH), and water as solvent). The plates were cultured in a 28°C incubator for 2–3 days. Subsequent operations were performed after single colonies were grown.

[0161] 1.3 Shake flask fermentation of recombinant acyltransferase bacteria

[0162] The shake flask fermentation process of the recombinant bacteria is as follows:

[0163] 1) Remove 500 μL of the positive transformants stored at -80°C and inoculate into 50 mL of YPD seed activation medium (10 g / L yeast extract, 20 g / L peptone, 10 g / L glucose, water as solvent, mix well, and sterilize at 115°C for 30 min) in a 500 mL Erlenmeyer flask. Incubate at 28°C, 250 rpm, and incubate for 24 h.

[0164] 2) Spread 100-200 μL of the culture onto a YPD seed activation solid medium plate (10 g / L yeast extract, 20 g / L peptone, 10 g / L glucose, 20 g / L agar powder, water as solvent, mix well, and sterilize at 115°C for 30 min. (Unless otherwise specified, the solvent in the culture medium of the present invention is water.) and incubate at 28°C for 18 h.

[0165] 3) Pick a single colony from the plate and inoculate it with 5 mL of seed culture medium (first transfection). After 36 hours of culture, inoculate 100 μL of the culture medium into 5 mL of seed culture medium (second transfection). After 36 hours of culture, transfer to shake flask fermentation medium. The initial OD value is unified to 0.08. After 144 hours of shaking, extract the oil and measure the dry weight. Each group is repeated three times to reduce the error.

[0166] The fermentation medium comprises the following components: 150 g / L glucose, 6 g / L ammonium sulfate, 12 g / L yeast powder, and the solvent is water.

[0167] 1.4 The oil extraction method is as follows:

[0168] 1) Take 5 mL of deionized water and add it to the oil extraction glass tube. After aspirating 3 mL of sample from the shake flask, immerse the tip of the pipette in the water and rinse repeatedly until it is completely dispersed in the water.

[0169] 2) Place the glass tube in a centrifuge and centrifuge at 3000 rpm for 15 minutes. Discard the supernatant and retain approximately 1 mL.

[0170] 3) Add 3.5 mL of 4 mol / L hydrochloric acid to break the tube, tighten the lid, and place it in a shaker for horizontal shaking at 250 rpm at 28°C for 1 h.

[0171] 4) Freeze-thaw cells, shake them, boil them in boiling water for 10 minutes, and then freeze them in a -20°C freezer for 30 minutes;

[0172] 5) Remove from the refrigerator, return to room temperature, add 6 mL of chloroform:methanol = 1:1 (volume ratio) extraction agent, shake thoroughly to mix, and then centrifuge at 3000 rpm for 10-15 minutes;

[0173] 6) After removing from the centrifuge, transfer the lower chloroform layer to another glass tube. Add 6 mL of a 1:1 (volume ratio) chloroform to the original tube and repeat the above steps for another extraction. Centrifuge and transfer the lower chloroform layer to the same glass tube. Add 3 mL of 0.15% sodium chloride solution to this tube, shake thoroughly, and centrifuge at 3000 rpm for 15 minutes.

[0174] 7) Use a pipette to remove the lower layer of chloroform and transfer it completely to the weighed glass tube;

[0175] 8) Use a water bath (40-50°C) to heat overnight to dry the chloroform, leaving the product, and take it out and weigh it.

[0176] 1.5 Fatty acid methyl esterification mode and detection method are as follows:

[0177] The extracted oil needs to react with methanol under the catalysis of sulfuric acid to produce methyl ester before it can be detected by gas chromatography. The specific steps are as follows:

[0178] 1) Add 3.9 mL of methanol:concentrated sulfuric acid = 98:2 (V / V, volume ratio) solvent to the weighed oil.

[0179] 2) Tighten the lid and place in an 85°C oven for methylation reaction for 3 hours. During the reaction, shake every 10 minutes to ensure sufficient reaction.

[0180] 3) Remove from the oven, cool to room temperature, add 1.5 mL of saturated sodium chloride solution, then add 1.5 mL of n-hexane, and shake thoroughly to mix.

[0181] 4) After centrifugation at 3000 rpm for 15 min, the upper layer containing the methyl-esterified n-hexane was taken and transferred to a 2 mL EP tube.

[0182] 5) Centrifuge the EP tube at 12,000 rpm for 5 minutes. The upper layer contains n-hexane solution and the lower layer contains a small amount of methanol. Transfer 200 μL of the upper n-hexane solution to the inner tube in the gas phase sample bottle. Tighten the bottle cap and seal it with sealing film. Since n-hexane is volatile, the sample preparation is complete.

[0183] Fatty acid composition was analyzed by gas chromatography (Agilent 7890B-GC, USA). A flame ionization detector and an HP-INNOWAX capillary column (30 m, 0.32 mm) were used, and 1 μL of the sample was injected at a flow rate of 1 mL / min at 250 ° C. The GC oven temperature was maintained at 140 ° C for 1 min, then increased to 180 ° C at a rate of 10 ° C / min for 10 min, increased to 210 ° C at a rate of 5 ° C / min for 4 min, and increased to 250 ° C at a rate of 5 ° C / min for 4 min. FAME was identified and quantified using commercial FAME standards purchased from Sigma-Aldrich (Shanghai, China). Protein content was determined using a K9840 Kjeldahl nitrogen analyzer (Haineng Instrument Co., Ltd.). The relative content of each fatty acid component was obtained by area normalization, and the fatty acid standards were products of Sigma.

[0184] 1.6 Effect of acyltransferase on neuraminic acid synthesis

[0185] To further increase the proportion of nervonic acid in the total oil content, the present invention attempted to further express the lysophosphatidic acid acyltransferase (MoLPAT) from the garlic fruit in the starting strain. Based on YLNA9, the MoLPAT gene was overexpressed to obtain the YL2 strain. The results showed that the proportion of nervonic acid in the total oil content of the YL2 strain increased from 16.5% in the starting strain YLNA9 to 19.94% (Table 2).

[0186] 1.7 Sequence of the fatty acid elongase complex

[0187] Different KCSs in the fatty acid elongase (FAE) complex tetramer have different substrate specificities. Among them, KCS is the rate-limiting step of catalyzing the elongation module of fatty acids, and the condensation of fatty acyl-CoA catalyzed by FAS and malonyl-CoA under the catalysis of KCS generates β-ketoacyl-CoA. Through KCR, β-ketoacyl-CoA is reduced to β-hydroxyacyl-CoA with NADPH as the reducing power. HCD can dehydrogenate β-hydroxyacyl-CoA and produce enoyl-CoA. Then, ECR reduces enoyl-CoA, which has two more carbons than the starting acyl-CoA. If the oleoyl-CoA (C18:1) is used as the starting substrate for three cycles, the oleoyl-CoA will increase by 6 carbon atoms, thus producing ceramide CoA (C24:1). The KS condensation reaction of the FAS module controls the total amount of carbon produced in the FAS cycle. Similarly, the substrate specificity of KCS in the FAE module determines the length of the carbon chain produced by the FAS module. Therefore, the prerequisite for constructing a high-efficiency cell factory of nervonic acid is to mine and screen KCS genes with high catalytic efficiency and strong substrate specificity.

[0188] With the efficient expression of CgKCS in the previous work, it is speculated that CgKCS has a relatively high expression amount in the whole elongase complex, but the expression amount of KCR, HCD and ECR is insufficient. This may cause the catalytic ability of CgKCS as the starting reaction in the whole elongase complex to be unmatched with KCR, HCD and ECR. Therefore, it is necessary to enhance the expression amount of KCR, HCD and ECR to improve the synergistic ability of the whole elongase complex. In order to consider that KCR, HCD and ECR are all functional on the endoplasmic reticulum, and the FAE complex catalyzes a continuous reaction, the present application adds a flexible linker composed of 10 glycines between KCR and HCD and ECR to express the three enzymes.

[0189] The codon-optimized sequence of Yarrowia lipolytica as the host strain is as follows

[0190] >SEQ ID No.3

[0191]

[0192] (a) Sequence features:

[0193] • Length: 3575

[0194] • Type: DNA sequence

[0195] • Chain type: Single

[0196] • Topology: Linear

[0197] (b) Molecule type: DNA

[0198] (c) Hypothetical: No

[0199] (d) Antisense: No

[0200] (e) Original source: Rhodosporidium toruloides

[0201] Sequence characteristics: The nucleotide sequence of the coding product of this gene is β-ketoacyl-CoA reductase, β-hydroxyacyl-CoA dehydrogenase, enoyl-CoA reductase.

[0202] 1.8 Effect of the fatty acid elongation module on the synthesis of nervonic acid

[0203] In order to improve the expression of KCR, HCD and ECR in cells, the KCR, HCD and ECR derived from Rhodosporidium toruloides were selected to express in YL2 to obtain YL3. The specific construction process of the strain YL3 is as follows:

[0204] 1.8.1 Construction of fatty acid elongation module recombinant plasmid and yeast transformation

[0205] The KCR, HCD and ECR elongase complex genes were synthesized by Huada Gene, and the plasmid vector was constructed by Gibson assembly method, and all assembly fragments were obtained by PCR amplification method. The plasmid backbone is derived from pPICZaA plasmid, which is composed of the following parts:

[0206] a) The selection marker blasticidin resistance gene in E. coli and Yarrowia lipolytica, and its strong promoter TEFin and terminator CYC1t;

[0207] b) KCR, HCD and ECR elongase complex fusion expression cassette and its promoter pLDP1 and terminator AOX1t.

[0208] (The primers are shown in Table 2)

[0209] Table 2 Primers used for constructing plasmid pYL-RtKHE

[0210] Primer name Primer sequences RtKHE_f cgcacgcaagatgaaggtcaccaagctc RtKHE_r caacgtggggtcaagcgatgaaggggaac pPi_f catcgcttgaccccacgttgccggtctt pPi_r tgaccttcatcttgcgtgcgtgcgtgttttg

[0211] All the above PCR amplifications were performed using KAPA HiFi High-Fidelity DNA Polymerase, and the reaction system was 50 μl (2x KAPA Mix, 25 ul; 10 μM primers, 1.5 ul each; template, 1 μl; add water to 50 μl). The DNA sequences were obtained. The amplification conditions were as follows: 95 °C pre-denaturation for 3 min; 98 °C denaturation for 20 s, 60-72 °C annealing for 15 s, 72 °C extension, the extension time was calculated as 30 s per kb, and the cycle number was 29-35; 72 °C extension for 10 min.

[0212] The plasmid backbone and the KCR, HCD and ECR elongase complex gene fragments obtained above were assembled and then transformed into E. coli competent Trans-T1 (Beijing Zixingjin Biotechnology Co., Ltd.). The E. coli transformation method was as follows: the competent cells Trans1-T1 were taken out from -80 °C and thawed on ice. When the competent cells were just thawed, 10 μL of the ligation product or plasmid was immediately added to 100 μL of the competent cells. The mixture was incubated in an ice bath for 30 min, subjected to heat shock at 42 °C for 30 s, and then incubated in an ice bath for 2 min. Then, 800 μL of LB medium was added, and the mixture was incubated at 37 °C on a shaker at 200 rpm for 1 h to allow the cells to recover. If it was a ligation product, all the bacteria were spread on an LB plate containing an antibiotic (ampicillin, final concentration 100 mg / L) after centrifugation at 6,000 rpm for 2 min. If it was a plasmid, 50-200 μL of the bacterial solution was directly spread on an LB solid plate containing ampicillin (final concentration 100 mg / L). The plate was incubated in a 37 °C constant temperature incubator overnight.

[0213] Then, the primers JD2-F and JD2-R (JD2-F: gcacagcatctctcgtttaaggtctggtgagtcgc; JD2-R: tcgtcattgatggacaggtagtaggaggcaag)

[0214] Colony PCR verification was performed, and the reaction system was as follows:

[0215]

[0216] After sequencing verification (Huada Gene) of the transformants successfully verified by colony PCR, the recombinant plasmid pYL-RtKHE of the KCR, HCD and ECR elongase complex gene was obtained.

[0217] 1.8.2 The process of transforming yeast with the recombinant plasmid was as follows:

[0218] The linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification was transformed into Yarrowia lipolytica as follows:

[0219] 1) Scrape 2-3 inoculation loop of overnight culture of the plate lawn;

[0220] 2) Add the following ingredients in order, 50% (mass concentration) PEG (3350) 90 μL, 2 M LiAc 5 μL, 2 M DTT (freshly prepared) 5 μL, Salmon sperm DNA, 5 μL, DMSO 5 μL, and finally the fragment to be transformed;

[0221] 3) Mix well and place in a 30 °C water bath for 1 h;

[0222] 4) Heat shock in a 39 °C water bath for 10 min;

[0223] 5) Take the mixed solution of the transformation system and evenly spread on the corresponding YPD + bleomycin screening plate (yeast extract 10 g / L, peptone 20 g / L, glucose 10 g / L), and incubate in a 28 °C constant temperature incubator for 2-3 d, and then perform subsequent operations after single colonies grow.

[0224] 1.8.3 KCR, HCD and ECR elongase complex recombinant bacteria shake flask fermentation

[0225] The specific implementation is consistent with 1.3 in Example 1.

[0226] 1.8.4 KCR, HCD and ECR elongase complex recombinant bacteria oil extraction

[0227] The specific implementation is consistent with 1.4 in Example 1.

[0228] 1.8.5 KCR, HCD and ECR elongase complex recombinant bacteria fatty acid composition detection

[0229] The specific implementation is consistent with 1.5 in Example 1.

[0230] 1.8.6 Effect of KCR, HCD and ECR elongase complex on nervonic acid content

[0231] This part of work obtains strain YL3 on the basis of YL2. The proportion of nervonic acid in total oil is increased from 19.94% in YL2 to 21.5% in YL3, and the isomer C24:1, n7 of nervonic acid is reduced from 2.74% to 2.4%. The reduction of C24:1, n7 content will be conducive to the separation of the product in the later stage. The oil yield of YL3 is 22.53 g / L, and the shake flask fermentation titer of YL3 nervonic acid reaches 4.84 g / L.

[0232] 1.9 Knockout of pseudohyphal formation gene on nervonic acid synthesis

[0233] When the growth conditions of Yarrowia lipolytica change or it feels pressure, the morphology of yeast cells will change to that of pseudohyphae. The reason may be that the pseudohyphae state helps to increase the contact area with nutrients, thereby obtaining more nutrients or secreting more products into the environment. However, the formation of pseudohyphae is extremely unfavorable in the fermentation process, because the mycelium will lead to a decrease in oxygen mass transfer efficiency, and at the same time, the viscosity in the fermentation system increases, which is not conducive to the accumulation of oil. For this reason, the present invention selects RAS as a homologous recombination site to destroy its function, so as to control its change from yeast morphology to pseudohyphae morphology, and observe the effect of this scheme on the content of nervonic acid. The proportion of nervonic acid in the total oil in strain YL4 with the RAS gene destroyed is increased to 22.9%. The specific construction process of strain YL4 is as follows:

[0234] 1.9.1 Construction of RAS gene knockout recombinant plasmid and yeast transformation

[0235] The plasmid vector was constructed using the Gibson assembly method, and all assembled fragments were obtained by PCR amplification. The plasmid backbone was derived from the pYL-POX5-MoLPAT plasmid, which consists of the following parts:

[0236] e) A selection marker Amp resistance gene and replication origin pBR322 ori in E. coli;

[0237] f) the selection marker URA and its promoter PLEU2 and terminator in Yarrowia lipolytica;

[0238] g) RASup, the upstream integration fragment of the site-specific integration site RAS;

[0239] h) RASdn, the downstream integration fragment of the RAS site;

[0240] Table 3 Primers used to construct plasmid pYL-RAS

[0241] Primer name Primer sequences AMP-RAS_F agggtggatcGATCTCGGCAGTCTCTCG AMP-RAS_R caatggaaacCAGAGCAGATTGTACTGAGAG RAS-up_f atctgctctgGTTTCCATTGTCATTCTTG RAS-up_r ggatgtcctgTCTCGGTATTCTTCCTGG MoLPAAT-RAS_F aataccgagaCAGGACATCCTACTGCGAG MoLPAAT-RAS_R gccgagcatgTGTTCGGAAATCAACGGATG RAS-down_f tttccgaacaCATGCTCGGCAACCTCTTC RAS-down_r tgccgagatcGATCCACCCTTGATGCTATC

[0242] All PCR amplifications described above used KAPA HiFi high-fidelity DNA polymerase. The amplification system was 50 μl (2× KAPA Mix, 25 μl; 1.5 μl of each 10 μM primer; 1 μl of template; and water was added to make up to 50 μl) to obtain each DNA sequence. Amplification conditions were: pre-denaturation at 95°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing at 60-72°C for 15 seconds, and extension at 72°C (30 seconds per kb, 29-35 cycles); and extension at 72°C for 10 minutes.

[0243] After assembling the plasmid backbone and the KCR, HCD, and ECR elongase complex gene fragments obtained above, they were transformed into competent E. coli Trans-T1 (Beijing Quanshijin Biotechnology Co., Ltd.). The E. coli transformation method was as follows: take out the competent cells Trans1-T1 from -80°C, thaw on ice, and immediately add 10 μL of the ligation product or plasmid to 100 μL of the competent cells as soon as the competent cells thaw; ice bath for 30 minutes; heat shock at 42°C for 30 seconds; ice bath for 2 minutes; add 800 μL of LB medium, incubate at 37°C shaker at 200 rpm for 1 hour to allow the cells to recover; if it is a ligation product, centrifuge at 6,000 rpm for 2 minutes and then spread all the bacteria onto an LB plate containing antibiotics (ampicillin, final concentration 100 mg / L); if it is a transformation plasmid, take 50-200 μL of the bacterial solution and directly spread it onto an LB solid plate containing ampicillin (final concentration 100 mg / L); culture in a 37°C constant temperature incubator overnight.

[0244] Then primers JD2-F and JD2-R (JD2-F: gcacagcatctctcgtttaaggtctggtgagtcgc; JD2-R: tcgtcattgatggacaggtagtaggaggcaag))

[0245] Perform colony PCR verification. The colony verification PCR reaction system is

[0246] Components Volume (μL) 2×EasyTaq DNA Polymerase 10 μL Forward primer 0.5μL Reverse primer 0.5μL Template 1 μL ddH2O 8μL

[0247] After colony PCR and sequencing verification (BGI) of the transformants that were successfully verified by colony PCR, the recombinant plasmid pYL-ΔRAS of the RAS gene was obtained.

[0248] 1.9.2 The process of transforming yeast with recombinant plasmid is as follows:

[0249] The linearized recombinant plasmid or the ΔRAS gene fragment obtained by PCR amplification is transformed into Yarrowia lipolytica as follows:

[0250] 1) Scrape 2-3 inoculating loops of overnight cultured bacterial lawn;

[0251] 2) Add the following ingredients in sequence: 90 μL of 50% (mass concentration) PEG (3350), 5 μL of 2M LiAc, 5 μL of 2M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally the fragment to be transformed;

[0252] 3) Mix thoroughly and place in a 30°C water bath for 1 hour;

[0253] 4) Heat shock in a 39°C water bath for 10 min;

[0254] 5) The mixed solution of the transformation system was evenly coated on the corresponding YNB screening plate (YNB medium: glucose 20 g / L, yeast nitrogen source 1.7 g / L (without amino acid without ammonium sulfate) (Sangon Biotech, Shanghai, China), ammonium sulfate 5 g / L, CSM-Ura (MP Biomedicals, Solon, OH) 0.69 g / L), and cultured in a constant temperature incubator at 28°C for 2-3 days. After single colonies were grown, subsequent operations were performed.

[0255] 1.9.3 Shake flask fermentation of RAS gene knockout recombinant bacteria

[0256] The specific implementation is consistent with 1.3 in Example 1.

[0257] 1.9.4 Oil extraction of RAS gene knockout recombinant bacteria

[0258] The specific implementation is consistent with 1.4 in Example 1.

[0259] 1.9.5 Detection of fatty acid composition of RAS gene knockout recombinant bacteria

[0260] The specific implementation is consistent with 1.5 in Example 1.

[0261] >SEQ ID No.4

[0262] RAS gene sequence

[0263]

[0264] (a) Sequence characteristics:

[0265] Length: 1052

[0266] Type: DNA sequence

[0267] Chain type: single chain

[0268] Topology: Linear

[0269] (b) Molecule type: DNA

[0270] (c) Assumption: No

[0271] (d) Antonym: No

[0272] (e) Original source: Yarrowia lipolytica

[0273] Sequence characteristics: This gene controls the morphological changes of pseudohyphae

[0274] 1.10 Effects of the fatty acid desaturation module on neuraminic acid synthesis

[0275] Stearoyl-CoA desaturase (SCD) is the rate-limiting enzyme that catalyzes the synthesis of oleic acid from stearic acid. Its main substrate is stearic acid C18:0. However, the selectivity of the modified enzyme is not strong. In the process of catalyzing the synthesis of C18:0 from C18:1, n9, it can simultaneously catalyze the synthesis of C16:0 from C16:1, n7. With the strengthening of the fatty acid elongation module and the TAG assembly module in the present invention, the "pulling" role commonly used in metabolic engineering is gradually strengthened, gradually pulling C18:1, n9 towards the direction of neuraminic acid synthesis. In this process, the direct substrate C18:0 of ​​SCD becomes less and less, but the SCD in the chassis cells is overexpressed, and the excess SCD can only be used more to catalyze the synthesis of C16:0 from C16:1, n7. It is also important to note that SCD plays a vital role in the synthesis of monounsaturated fatty acids. Studies have shown that overexpression of SCD can promote oil synthesis, while also promoting cell growth and glucose tolerance [Qiao, K. et al. Engineering lipid overproduction in the oleaginous yeast Yarrowia lipolytica. Metabolic Engineering 29, 56-65 (2015). https: / / doi.org / 10.1016 / j.ymben.2015.02.005]. SCD1 deficiency leads to better insulin sensitivity and reduced liver fat in mice, allowing them to burn fat faster regardless of diet [Aljohani, AM, Syed, DN & Ntambi, JM Insights into Stearoyl-CoA Desaturase-1 Regulation of Systemic Metabolism. Trends in Endocrinology and Metabolism 28, 831-842(2017). https: / / doi.org / 10.1016 / j.tem.2017.10.003]. Therefore, SCD cannot be completely knocked out, which will lead to a decrease in the overall oil production capacity of chassis cells, which is not conducive to the synthesis of neuraminic acid.

[0276] In order to solve this problem, it is necessary to consider weakening the synthesis of C16:1, n9 rather than completely blocking it to ensure the normal synthesis of C18:1. This section plans to start from the perspective of SCD regulation to promote the flow of carbon sources toward the synthesis of neuraminic acid. According to previous studies, the endogenous SCD in the starting strain is overexpressed, so the present invention plans to knock out the endogenous SCD to reduce its expression level, hoping to achieve the purpose of weakening C16:1, n7 synthesis and reducing carbon atom loss. The results are as follows Figure 5 As shown, after knocking out SCD, YL4 was obtained. Compared with the starting strain YL4, the proportion of C16:1,n7 decreased from 35.82% to 28%, indicating that the weakening of SCD effectively reduced the conversion of C16:0 to C16:1,n7. The proportion of neuraminic acid increased from 21.5% to 25%. The proportion of C16:1,n7 in the YL4 strain was approximately 1.12 times that of C24:1,n9, which was significantly reduced compared to the starting strain. This indicates that regulating the fatty acid desaturation module helps promote the synthesis of neuraminic acid. The specific construction process of strain YL5 is as follows:

[0277] 1.10.1 Construction of recombinant plasmids encoding the weakened fatty acid desaturation pathway gene and yeast transformation

[0278] The plasmid vector was constructed using the Gibson assembly method, and all assembled fragments were obtained by PCR amplification. The plasmid backbone was derived from the pYL-POX5-MoLPAT plasmid, which consists of the following parts:

[0279] e) A selection marker Amp resistance gene and replication origin pBR322 ori in E. coli;

[0280] f) the selection marker URA and its promoter PLEU2 and terminator in Yarrowia lipolytica;

[0281] g) SCDup, an upstream integration fragment of the site-specific integration site SCD;

[0282] h) the downstream integration fragment SCDdn of the site-specific integration site SCD;

[0283] Table 4 Primers used to construct plasmid pYL-SCD

[0284] Primer name Primer sequences SCDup_fwd acaatctgctctgGTCGACACCATTGCCTCC SCDup_rev gtaggatgtcctgGGTGGGCAGAACAATGGC LP_fwd tgttctgcccaccCAGGACATCCTACTGCGAG LP_rev acctcccttccagTGTTCGGAAATCAACGGATG SCD-dn_fwd tgatttccgaacaCTGGAAGGGAGGTCTTGTC SCD-dn_rev gactgccgagatcGATTCGGTTTCCACTCTCATC Amp-scd_fwd tggaaaccgaatcGATCTCGGCAGTCTCTCG Amp-scd_rev caatggtgtcgacCAGAGCAGATTGTACTGAGAG

[0285] All PCR amplifications described above used KAPA HiFi high-fidelity DNA polymerase. The amplification system was 50 μl (2× KAPA Mix, 25 μl; 1.5 μl of each 10 μM primer; 1 μl of template; and water was added to make up to 50 μl) to obtain each DNA sequence. Amplification conditions were: pre-denaturation at 95°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing at 60-72°C for 15 seconds, and extension at 72°C (30 seconds per kb, 29-35 cycles); and extension at 72°C for 10 minutes.

[0286] The plasmid backbone and the ΔSCD gene fragment obtained above were assembled and transformed into competent Escherichia coli Trans-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), respectively. Then, colony PCR and sequencing verification (BGI) were performed using primers JD2-F and JD2-R (JD2-F: gcacagcatctctcgtttaaggtctggtgagtcgc; JD2-R: tcgtcattgatggacaggtagtaggaggcaag) to obtain the recombinant plasmid pYL-ΔSCD of the ΔSCD gene.

[0287] 1.10.2 The process of transforming yeast with recombinant plasmid is as follows:

[0288] The linearized recombinant plasmid or the ΔSCD gene fragment obtained by PCR amplification is transformed into Yarrowia lipolytica as follows:

[0289] 1) Scrape 2-3 inoculating loops of overnight cultured bacterial lawn;

[0290] 2) Add the following ingredients in sequence: 90 μL of 50% (mass concentration) PEG (3350), 5 μL of 2M LiAc, 5 μL of 2M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally the fragment to be transformed;

[0291] 3) Mix thoroughly and place in a 30°C water bath for 1 hour;

[0292] 4) Heat shock in a 39°C water bath for 10 min;

[0293] 5) The transformation mixture was evenly spread onto corresponding YNB screening plates (YNB medium: 20 g / L glucose, 1.7 g / L yeast nitrogen base (without amino acids and ammonium sulfate) (Sangon Biotech, Shanghai, China), 5 g / L ammonium sulfate, 0.69 g / L CSM-Ura (MP Biomedicals, Solon, OH)). The plates were cultured in a 28°C incubator for 2–3 days. Subsequent operations were performed after single colonies were grown.

[0294] 1.10.3 Shake flask fermentation of recombinant bacteria with a fatty acid desaturation module

[0295] The specific implementation is consistent with 1.3 in Example 1.

[0296] 1.10.4 Oil Extraction from Recombinant Bacteria with Modulated Fatty Acid Desaturation Module

[0297] The specific implementation is consistent with 1.4 in Example 1.

[0298] 1.10.5 Fatty acid composition detection of the fatty acid desaturation module

[0299] The specific implementation is consistent with 1.5 in Example 1.

[0300] >SEQ ID No.5

[0301]

[0302] (a) Sequence characteristics:

[0303] Length: 1324

[0304] Type: DNA sequence

[0305] Chain type: single chain

[0306] Topology: Linear

[0307] (b) Molecule type: DNA

[0308] (c) Assumption: No

[0309] (d) Antonym: No

[0310] (e) Original source: Yarrowia lipolytica

[0311] Sequence characteristics: This gene is stearoyl-CoA desaturase (SCD), the rate-limiting enzyme that catalyzes the synthesis of oleic acid from stearic acid

[0312] Table 5 Bacteria used in the present invention

[0313] Strain name genotype The proportion of neuraminic acid in total fat YLNA9 YLNA8,PEX10::(YlINO2) 16.5 YL2 YLNA9,POX5::(MoLPAT) 19.9 YL3 YL2,RtKCR-RtHCD-RtECR 21.5 YL4 YL3,RAS::(MoLPAT) 22.9 YL5 YL5,SCD::(MoLPAT) 25.0

[0314] Among them, strain YLNA9 is a known strain disclosed in the prior art, which has been disclosed in the article [Su, H., Shi, P., Shen, Z. et al. High-level production of nervonic acid in the oleaginous yeast Yarrowia lipolytica by systematic metabolic engineering. Commun Biol 6, 1125 (2023). https: / / doi.org / 10.1038 / s42003-023-05502-w].

[0315] Example 2 Effect of acetate on oil synthesis in Yarrowia lipolytica

[0316] Yarrowia lipolytica has been widely studied for its ability to synthesize lipids using glucose and glycerol. However, the high cost of these carbon sources has hindered their application in large-scale microbial lipid production. In recent years, acetic acid / acetate has shown great potential as a low-cost feedstock in biotechnology and has become a platform feedstock.

[0317] To study the effect of acetate on oil synthesis in Yarrowia lipolytica, the strain used in the test was YL5 (Table 5). The present invention added different concentrations of sodium acetate (10.7 g / L, 8 g / L, 12 g / L, 14 g / L) or ammonium acetate (6 g / L) to a shake flask control medium CK (r2-8) (glucose 150 g / L, yeast extract 12 g / L, ammonium sulfate 6 g / L, solvent: water).

[0318] The shake flask fermentation process of recombinant strain YL5 is as follows:

[0319] 1) Remove 500 μL of positive transformants from the -80°C seed tube and inoculate into 50 mL of YPD seed activation medium (10 g / L yeast extract, 20 g / L peptone, 10 g / L glucose, water as solvent, mix well, and sterilize at 115°C for 30 min) (500 mL Erlenmeyer flask) and incubate at 28°C, 250 rpm, for 24 h.

[0320] 2) Spread 100-200 μL of the culture onto a YPD seed activation solid medium plate (10 g / L yeast extract, 20 g / L peptone, 10 g / L glucose, 20 g / L agar powder, water as solvent, mix well, and sterilize at 115°C for 30 min) and incubate at 28°C for 18 h.

[0321] 3) Pick a single colony from the plate and inoculate it with 5 mL of seed culture medium (first transfection). After 36 hours of culture, inoculate 100 μL of the culture medium into 5 mL of seed culture medium (second transfection). After 36 hours of culture, transfer to shake flask fermentation medium. The initial OD value is unified to 0.08. After 144 hours of shaking, extract the oil and measure the dry weight. Each group is repeated three times to reduce the error.

[0322] The fermentation medium comprises 150 g / L glucose, 12 g / L yeast powder, 6 g / L ammonium sulfate, and water as solvent. Ammonium sulfate is replaced with 6 g / L ammonium acetate, or sodium acetate of different concentrations (10.7 g / L, 8 g / L, 12 g / L, 14 g / L) is added to 150 g / L glucose, 12 g / L yeast powder, 6 g / L ammonium sulfate, and water as solvent. After mixing, the mixture is sterilized at 115° C. for 30 minutes.

[0323] The specific implementation of shake flask fermentation is consistent with that of 1.3 in Example 1. The specific implementation of oil extraction is consistent with that of 1.4 in Example 1.

[0324] The dry weight test method is as follows: After the fermentation is completed, take 1 mL of sample and place it in a dried and weighed EP tube. Then add 1 mL of purified water, centrifuge at 10,000 rpm for 6 minutes, and discard the supernatant. Add deionized water, shake and resuspend, then centrifuge again, discard the supernatant, and repeat this operation three times to ensure that the residual culture medium components are washed away. Then place it in a 65°C constant temperature drying oven and dry it to constant weight. Take it out and weigh it. Repeat three times for each sample and take the average value. The final dry weight is calculated as: (weight after drying - empty EP tube weight) g / 0.001L, in g / L.

[0325] The results showed that when ammonium sulfate in the culture medium was replaced by ammonium acetate, the cell dry weight decreased from 24.3 g / L to 12.2 g / L, and the oil concentration decreased from 10.11 g / L to 5.03 g / L ( Figure 1 ). When 10.7g / L sodium acetate was added to the original fermentation medium, the cell dry weight increased from 24.3g / L to 40.3g / L, an increase of 65.7%, and the oil concentration increased from 10.11g / L to 14.88g / L, an increase of 47.1%. The effect of sodium acetate addition concentration on increasing oil yield was further explored, and a comparative analysis was conducted on 8g / L, 12g / L and 14g / L sodium acetate. The results showed that 8g / L sodium acetate significantly increased oil yield, and the oil concentration increased from 10.11g / L in the control group to 15.08g / L ( Figure 1 ).

[0326] Example 3 Effect of exogenous oil addition on neuraminic acid synthesis

[0327] Yarrowia lipolytica cells are able to absorb and utilize hydrophobic oil substrates. In order to increase the direct substrate required for neuraminic acid synthesis, the present invention explores the effect of exogenous oil addition. The strain used in the test is YL5 (Table 5), which is more conducive to the fatty acids entering the cell to participate in the elongation pathway. The control culture medium is r2-8 culture medium (150g / L glucose, 12g / L yeast powder, 6g / L ammonium sulfate, solvent is water, 115°C, sterilized for 30min), and various oils are added to r2-8 culture medium at a final concentration of 10g / L. Compare the results of oil fermentation. Shake flask fermentation is to divide 30mL of culture medium into 250mL shake flasks, and add 1% (ie 0.3g) of various oils to each bottle (3 parallels for each type of oil), sterilize at 115°C for 30min, and the specific design scheme is shown in Table 6. The specific implementation method of shake flask fermentation is consistent with 1.3 in Example 1. The specific implementation method of oil extraction is consistent with 1.4 in Example 1. The specific implementation method of fatty acid composition detection is consistent with 1.5 in Example 1.

[0328] Table 6 Experimental design of exogenous oil addition

[0329]

[0330] The results showed that rapeseed oil (C), low-erucic acid rapeseed oil (CL), high-oleic acid rapeseed oil (CH), peanut oil (P), and high-oleic acid peanut oil (PH) had an effect on increasing the proportion of neuraminic acid in the total oil. The addition of high-oleic acid peanut oil increased the content of neuraminic acid by 29%, and the addition of high-oleic acid rapeseed oil increased the content of neuraminic acid by 24.7%. The addition of corn oil (Cor), soybean oil (S), and sunflower oil (SS) reduced the proportion of neuraminic acid in the total oil. The reason why high-oleic acid peanut oil (PH) and high-oleic acid rapeseed oil (CH) had an effect on increasing the proportion of neuraminic acid in the total oil was that the large amount of oleic acid (proportion>75%) in these two oils provided a substrate for the extension of neuraminic acid and promoted the synthesis of neuraminic acid ( Figure 2 ).

[0331] Example 4 Effect of oleic acid addition on nervonic acid synthesis

[0332] The present invention further tested the effect of adding oleic acid (C18:1) on the synthesis of nervonic acid. Using the YL5 strain (Table 5), the control culture medium was 150 g / L glucose, 12 g / L yeast powder, 6 g / L ammonium sulfate, and the solvent was water. The test was carried out by adding different concentrations of oleic acid (5, 10, 15, 20 g / L) to the control culture medium and sterilizing at 115°C for 30 min. The specific implementation method of shake flask fermentation is consistent with 1.3 in Example 1. The specific implementation method of oil extraction is consistent with 1.4 in Example 1. The specific implementation method of fatty acid composition detection is consistent with 1.5 in Example 1.

[0333] The results showed that the addition of 15g / L oleic acid increased the proportion of nervonic acid in the total oil to 30.21%, an increase of 40.6%. This shows that the addition of oleic acid can effectively promote the synthesis of nervonic acid, which also explains why high oleic peanut oil (PH) and high oleic rapeseed oil (CH) promote the synthesis of nervonic acid. Figure 3 .

[0334] Example 5 Effect of exogenous oil addition on nervonic acid high-producing strains

[0335] Taking into account the high price of oleic acid, directly using high oleic peanut oil (PH) and high oleic rapeseed oil (CH) can effectively reduce costs. On the one hand, the price of high oleic peanut oil (PH) is higher than that of high oleic rapeseed oil (CH), and on the other hand, it is easy to solidify under low temperature conditions such as winter. Therefore, high oleic rapeseed oil (CH) is mainly added in the later stage to increase the yield of nervonic acid. The present invention was tested in the nervonic acid high-proportion strain YL5 (Table 5), and 10g / L of high oleic rapeseed oil was added to the control medium (150g / L glucose, 12g / L yeast powder, 6g / L ammonium sulfate, water as solvent, and sterilized at 115°C for 30min after mixing). The specific implementation method of shake flask fermentation is consistent with 1.3 in Example 1. The specific implementation method of oil extraction is consistent with 1.4 in Example 1. The specific implementation method of fatty acid composition detection is consistent with 1.5 in Example 1.

[0336] After fermentation with 10g / L high oleic rapeseed oil in the control medium (glucose 150g / L, yeast powder 12g / L, ammonium sulfate 6g / L, solvent water), the components of the strain YL5 with fatty acids accounting for more than 10% of the total oil content were 35.82% C16:1, 11.04% C18:1,n9, and 21.5% C24:1,n9. The proportion of C18:1,n9 was not high. After adding 10g / L high oleic rapeseed oil, the fermentation results showed that the proportion of nervonic acid in the total oil was significantly increased from 26.1% to 31.3%, becoming the component with the highest proportion of fatty acids in the strain ( Figure 4 ).

[0337] Example 6 Shake flask fermentation of strain YL5 to produce high oil and nervonic acid

[0338] The shake flask fermentation using the recombinant bacteria YL5 is used to produce high-yield oils and neuraminic acid. The shake flask fermentation process is as follows: The specific implementation method of the shake flask fermentation is consistent with 1.3 in Example 1, except that the fermentation medium used is the combined optimized medium (r3) of the present invention after multiple single-factor optimization of Examples 2 to 5. The components of r3 are: 150g / L glucose, 12g / L yeast powder, 6g / L ammonium sulfate, 8g / L sodium acetate, 10g / L high oleic rapeseed oil, and the solvent is water. After mixing, sterilize at 115°C for 30min.

[0339] The specific implementation of oil extraction is consistent with that of 1.4 in Example 1. The specific implementation of fatty acid composition detection is consistent with that of 1.5 in Example 1.

[0340] After testing, after shake flask fermentation using the r3 culture medium obtained in the present invention, the OD increased by 41.15%, the oil titer increased by 130.39%, and the proportion of nervonic acid in the total oil increased from 25.3% to 31.6%. From growth performance, product synthesis to the proportion of nervonic acid, it is better than the control culture medium in all aspects (Table 7).

[0341] Table 7 Experimental design of exogenous oil addition

[0342] culture medium OD Oil titer g / L The percentage of neuraminic acid in total fat r2-8 (control culture medium) 95 10.2 25.3 r3 136 23.5 31.6

[0343] At the same time, by comparing Examples 1 to 6, it can be seen that the ammonium sulfate, sodium acetate, and high oleic rapeseed oil in the combined optimized culture medium (r3) in the method of the present invention have a synergistic effect, which can synergistically increase the yield of the prepared oil and nervonic acid.

[0344] Example 7 Fed-batch fermentation in a fermenter using acetic acid as a carbon source

[0345] 500 μL of the preserved strain YL5 (final glycerol concentration 20%) was taken out from the -80°C seed tube and inoculated into 50 mL of YNB medium: 20 g / L glucose, 1.7 g / L yeast nitrogen base (without amino acids and ammonium sulfate) (Sangon Biotech, Shanghai, China), 5 g / L ammonium sulfate, 0.69 g / L CSM-Ura (MP Biomedicals, Solon, OH), and water as the solvent) in a 500 mL Erlenmeyer flask. The culture was incubated at 28°C and 250 rpm for 24 h. 500 μL of the strain was inoculated into 50 mL of YNB medium: 20 g / L glucose, 1.7 g / L yeast nitrogen base (without amino acids and ammonium sulfate) (Sangon Biotech, Shanghai, China), 5 g / L ammonium sulfate, and 0.69 g / L CSM-Ura (MP Biomedicals, Solon, OH), and water as the solvent. Biotech, Shanghai, China), ammonium sulfate 5g / L, CSM-Ura (MP Biomedicals, Solon, OH) 0.69g / L, solvent is water) (500mL Erlenmeyer flask) as the first-level seeds, 28 ℃, 250rpm, culture for 24h; after 24h, the first-level seeds were taken and inoculated into 500mL seed culture medium ((YNB medium: glucose 20g / L, yeast nitrogen base 1.7g / L (without amino acids and ammonium sulfate) (Sangon Biotech, Shanghai, China), ammonium sulfate 5g / L, CSM-Ura (MP Biomedicals, Solon, OH) 0.69g / L, solvent is water)) (2L Erlenmeyer flask) with an initial OD 0.08, 28 ℃, 250rpm, culture for about 18h, and the OD grew to 8-10, and was used as the second-level seeds for tanking; the inoculation amount for the tank was 10%, and the initial liquid filling volume was 60% of the tank volume. Fermentation process control: The fermentation temperature is kept at 28°C. After the pH begins to rise to 6.5, pure acetic acid (Sinopharm Group, analytical grade) is used to maintain the pH at 6.5. Agitation is linked to dissolved oxygen, which is controlled at above 20%. The cascade control speed is between 200-680 rpm. The tank pressure is not specifically controlled for the first 24 hours, but is maintained at 0.01-0.03 MPa thereafter. The culture is continued for 192 hours. OD600 is measured every 12 hours to observe growth. Samples are taken for sugar determination and then stored in a -20°C freezer. Oil production and fatty acid composition analysis can be performed uniformly after fermentation. The final concentration of the defoamer added to the fermentation medium is 3-5 parts per thousand.

[0346] The fermentation medium was as follows:

[0347] Glucose 150g / L, yeast powder 12g / L, ammonium sulfate 6g / L, sodium acetate 8g / L, high oleic rapeseed oil 10g / L, solvent is water, mix well and sterilize at 115℃ for 30min.

[0348] The specific implementation method of oil extraction is consistent with 1.4 in Example 1. The specific implementation method of fatty acid composition detection is consistent with 1.5 in Example 1. The dry weight detection method is: after the fermentation is completed, take 1 mL of sample and put it into a dried and weighed EP tube, then add 1 mL of purified water, centrifuge at 10000 rpm for 6 minutes, and then pour out the supernatant. Add deionized water, shake and resuspend, and centrifuge again, discard the supernatant, and repeat this operation three times to ensure that the residual culture medium components are washed clean. After that, put it into a 65°C constant temperature drying oven and dry it to constant weight, take it out and weigh it, repeat three times for each sample, and take the average value. The final dry weight is calculated as: (weight after drying-empty EP tube weight) g / 0.001L, in g / L.

[0349] When the present invention uses the YL5 strain (Table 5) to carry out fed-batch fermentation with acetic acid as the carbon source, the fermentation cycle is 198 h, the oil titer reaches 148.4 g / L, and the nervonic acid titer reaches 32.5 g / L (accounting for 21.91% of TFA). Figure 5 shown.

[0350] Table 4 summarizes the reported yields of fatty acids and fatty acid methyl esters synthesized by microorganisms. The highest titer of fatty acid synthesis using glucose as a carbon source in Escherichia coli was 8.6 g / L, while the highest titer in Saccharomyces cerevisiae was 2.2 g / L. In addition to the Yarrowia lipolytica studied in this paper, Rhodosporidium toruloides is also an important oleaginous yeast, and numerous researchers have conducted in-depth studies on this chassis cell for oil synthesis. In 2023, Feixiang Liu et al. from Nanjing Forestry University used an engineered strain of Rhodosporidium torrefaction [Liu, F. et al. Metabolic engineering of oleaginous yeast in the lipogenic phase enhances production of nervonic acid. Metabolic Engineering 80, 193-206 (2023)] and adopted a continuous flow addition method of 1000 g / L glucose to supplement the carbon source in the culture system. The glucose concentration in the system was controlled at around 10 g / L, the ventilation ratio was 1 vvm, the rotation speed varied between 100-900 rpm, the dissolved oxygen was controlled at 5% (the dissolved oxygen was in restriction mode), and 10 M NaOH was used to control the pH to be greater than 4. After 192 hours of fermentation, the oil titer reached 95.4 g / L. In Yarrowia lipolytica, Kangjian Qiao et al. [Qiao, K., Wasylenko, TM, Zhou, K., Xu, P. & Stephanopoulos, G. Lipid production in Yarrowia lipolytica is maximized by engineering cytosolic redoxmetabolism. Nature Biotechnology 35, 173-177 (2017)] used redox engineering to promote the conversion of NADH to NADPH, thereby promoting oil synthesis. The fermentation process temperature was controlled at 28 ° C, the pH was controlled at 5.5 using 6M NaOH, and the ventilation ratio was 3vvm. During the growth phase (0-36h), the dissolved oxygen was controlled at 20% by stirring cascade (200-750rpm). During the oil production phase (36h-end of fermentation), the dissolved oxygen was controlled at 5%, and the highest oil yield reported so far was 98.9g / L. In some content, the oil yield obtained by using YL5 in fed-batch fermentation with acetic acid was 148.4g / L, which was about 50% higher than the highest level reported so far.

[0351] There are advantages of using acetic acid as fermentation substrate, but there are problems of low pH and high concentration of fermentation inhibition. However, the fermentation rate is slow when only acetic acid is used as the substrate. Therefore, the present application uses a small amount of glucose to improve the fermentation rate and yield of oil by using acetic acid and glucose co-fermentation. High-efficiency microbial cell factories need to pay attention to both material and energy. Therefore, the present application uses YL5 strain (Table 5) to use glucose as a supplementary carbon source in the case of using acetic acid as the main carbon source, to provide reducing power for cells, and to supplement exogenous oil as a direct substrate C18:1, n9 for nervonic acid synthesis in combination with the results of medium optimization. The strategy is verified on a 5L fermenter, and the results are shown in Table 8. Figure 6 The glucose concentration is always kept at a low level so that it does not affect normal acetic acid metabolism. After 192h of fermentation, the oil titer is increased by 83.3% compared with the highest level reported so far, and the nervonic acid titer is increased by 42.5% compared with the use of glucose alone. The oil yield reaches the highest level reported so far (Table 8).

[0352] Table 8 Comparison of oil production in engineered microorganisms

[0353]

[0354]

[0355] Yarrowia lipolytica, a naturally occurring oleaginous yeast, possesses numerous advantages in the synthesis of fatty acid products. In a study using Yarrowia lipolytica as a base cell for nervonic acid synthesis, Zhao et al. overexpressed MaELO3, AtKCS, CraKCS, and CgKCS, along with the desaturases D15D, DGA1, or OLE1, resulting in an optimal nervonic acid-producing strain, NA15, with a nervonic acid yield of 0.185 g / L [Zhao, X. R., Chen, XL., Yang, J. L. et al. De novo synthesis of nervonic acid and optimization of metabolic regulation by Yarrowia lipolytica. Bioresource. Bioprocess. 10, 70(2023). https: / / doi.org / 10.1186 / s40643-023-00689-6]. Wang et al. combined plant and non-plant fatty acid biosynthesis pathways to achieve a nervonic acid production of 13.6 g / L [Wang, K., Lin, L., Wei, P., Ledesma-Amaro, R., & Ji, XJ (2023). Combining orthogonal plant and non-plant fatty acid biosynthesis pathways for efficient production of microbialoil enriched in nervonic acid in Yarrowia lipolytica. Bioresource technology, 378, 129012. https: / / doi.org / 10.1016 / j.biortech.2023.129012]. In addition, the inventors of this patent application achieved high-level production of nervonic acid in the oleaginous yeast Yarrowia lipolytica with a titer of 17 g / L in 2023 [Su, H., Shi, P., Shen, Z. et al. High-level production of nervonic acid in the oleaginous yeast Yarrowia lipolytica by systematic metabolic engineering. Commun Biol 6, 1125(2023).ttps: / / doi.org / 10.1038 / s42003-023-05502-w].

[0356] In the present invention, the YL5 strain, a high-yield cell factory for neuraminic acid, was obtained through systems metabolic engineering in the Yarrowia lipolytica chassis cells. On this basis, by optimizing the fermentation medium and fermentation process, the neuraminic acid production was further increased to 46.3 g / L (2.7 times the previously reported neuraminic acid production in Yarrowia lipolytica), and the oil production reached 181.3 g / L. Both neuraminic acid and oil production reached the highest levels reported in Yarrowia lipolytica to date (Table 9).

[0357] Table 9 Comparison of neuraminic acid production capacity of different engineered strains

[0358]

[0359]

[0360] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered strain for high yield of microbial oils and nervonic acid, characterized by: The strain is based on strain YLNA9 and is obtained by enhancing the expression of specific acyltransferase, enhancing the expression of fatty acid elongase complex, knocking out pseudohyphae formation genes, and knocking out stearoyl-CoA desaturase SCD genes.

2. The genetically engineered strain according to claim 1, characterized in that: The gene sequence of the specific acyltransferase is SEQ ID No. 1, and its amino acid sequence is SEQ ID No. 2; the gene sequence of the fatty acid elongase complex is SEQ ID No. 3; the gene sequence of the pseudohyphae formation gene is SEQ ID No. 4; and the gene sequence of the stearoyl-CoA desaturase SCD gene is SEQ ID No.

5.

3. The genetically engineered strain according to claim 1 or 2, characterized in that: After fermentation, the genetically engineered strain has an oil and nervonic acid production of 46.3 g / L, and an oil production of 181.3 g / L.

4. The method for constructing a genetically engineered strain according to any one of claims 1 to 3, wherein: Based on strain YLNA9, the acyltransferase MoLPAT was expressed to obtain strain YL2; the expression levels of KCR, HCD and ECR in YL2 were enhanced to obtain strain YL3; the pseudohyphae formation gene RAS was knocked out in YL3 to obtain strain YL4; and the stearoyl-CoA desaturase SCD gene was knocked out in strain YL4 to obtain strain YL5, thus obtaining a genetically engineered strain with high production of microbial oils and neuraminic acid.

5. The construction method according to claim 4, characterized in that: The steps include: (1) Construction of strain YL2 The MoLPAT gene was synthesized and the plasmid vector was constructed using the Gibson assembly method. All assembled fragments were obtained by PCR amplification. The plasmid backbone was derived from the pYL-POX5-CgKCS plasmid and consisted of the following five parts: a) A selection marker Amp resistance gene and replication origin pBR322 ori in E. coli; b) the selection marker URA and its promoter PLEU2 and terminator in Yarrowia lipolytica; c) POX5up, an upstream integration fragment of the site-specific integration site POX5; d) POX5dn, an integrated fragment downstream of the site-directed integration site POX510; e) the elongase CgKCS and its strong promoter pTEF and terminator XPR2; All the above PCR amplifications used KAPA HiFi high-fidelity DNA polymerase, and the amplification system was 50 μl (2× KAPA Mix, 25 μl; 1.5 μl of each 10 μM primer; 1 μl of template; water was added to 50 μl) to obtain each DNA sequence; the amplification conditions were: pre-denaturation at 95°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing at 60-72°C for 15 seconds, and extension at 72°C, with the extension time calculated at 30 seconds per kb and the number of cycles being 29-35; extension at 72°C for 10 minutes; The plasmid backbone and the MoLPAT esterase gene fragment obtained above were assembled and transformed into competent Escherichia coli Trans-T1 respectively. Colony PCR and sequencing were performed using primers JD-F and JD-R to obtain the recombinant plasmid pYL-POX5-MoLPAT of the MoLPAT gene. The process of transforming yeast with recombinant plasmid is as follows: The linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification is transformed into Yarrowia lipolytica as follows: 1) Scrape 2-3 inoculating loops of overnight cultured bacterial lawn; 2) Add the following ingredients in sequence: 90 μL of 50% (mass concentration) PEG, 5 μL of 2M LiAc, 5 μL of 2M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally the fragment to be transformed; 3) Mix thoroughly and place in a 30°C water bath for 1 hour; 4) Heat shock in a 39°C water bath for 10 min; 5) Evenly spread the transformation mixture onto the corresponding YNB screening plate and culture in a 28°C constant temperature incubator for 2-3 days. After a single colony grows, proceed with the subsequent steps. (2) Construction of strain YL3 The KCR, HCD, and ECR elongase complex genes were synthesized. The plasmid vector was constructed using the Gibson assembly method, and all assembled fragments were obtained by PCR amplification. The plasmid backbone was derived from the pPICZaA plasmid and consists of the following parts: a) a selection marker bleomycin resistance gene in Escherichia coli and Yarrowia lipolytica, and its strong promoter TEFin and terminator CYC1t; b) KCR, HCD and ECR elongase complex fusion expression cassette and its promoter pLDP1 and terminator AOX1t; All PCR amplifications described above used KAPA HiFi high-fidelity DNA polymerase. Each amplification system consisted of 50 μl (2× KAPA Mix, 25 μl; 1.5 μl of each 10 μM primer; 1 μl of template; and water added to make up to 50 μl) to obtain each DNA sequence. Amplification conditions were as follows: initial denaturation at 95°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing at 60-72°C for 15 seconds, and extension at 72°C (30 seconds per kb, 29-35 cycles); and extension at 72°C for 10 minutes. The plasmid backbone and the KCR, HCD, and ECR elongase complex gene fragments obtained above were assembled and transformed into competent Escherichia coli Trans-T1, and then colony PCR and sequencing were performed using primers JD2-F and JD2-R to obtain the recombinant plasmid pYL-RtKHE containing the KCR, HCD, and ECR elongase complex genes. The process of transforming yeast with recombinant plasmid is as follows: The linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification is transformed into Yarrowia lipolytica as follows: 1) Scrape 2-3 inoculating loops of overnight cultured bacterial lawn; 2) Add the following ingredients in sequence: 90 μL of 50% (mass concentration) PEG (3350), 5 μL of 2M LiAc, 5 μL of 2M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally the fragment to be transformed; 3) Mix thoroughly and place in a 30°C water bath for 1 hour; 4) Heat shock in a 39°C water bath for 10 min; 5) Evenly spread the transformation mixture onto the corresponding YPD + bleomycin selection plate (10 g / L yeast extract, 20 g / L peptone, 10 g / L glucose) and incubate in a 28°C incubator for 2-3 days. Continue with subsequent operations after a single colony has grown. (3) Construction of strain YL4 The plasmid vector was constructed using the Gibson assembly method, and all assembly fragments were obtained by PCR amplification. The plasmid backbone was derived from the pYL-POX5-MoLPAT plasmid, which consists of the following parts: a) A selection marker Amp resistance gene and replication origin pBR322 ori in E. coli; b) the selection marker URA and its promoter PLEU2 and terminator in Yarrowia lipolytica; c) RASup, the upstream integration fragment of the site-specific integration site RAS; d) RASdn, the downstream integration fragment of the RAS site; All PCR amplifications described above used KAPA HiFi high-fidelity DNA polymerase. The amplification system was 50 μl (2× KAPA Mix, 25 μl; 1.5 μl of each 10 μM primer; 1 μl of template; and water was added to make up to 50 μl) to obtain each DNA sequence. Amplification conditions were: pre-denaturation at 95°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing at 60-72°C for 15 seconds, and extension at 72°C (30 seconds per kb, cycle number 29-35); extension at 72°C for 10 minutes. The plasmid backbone and the KCR, HCD, and ECR elongase complex gene fragments obtained above were assembled and transformed into competent Escherichia coli Trans-T1, and then colony PCR and sequencing were performed using primers JD2-F and JD2-R to obtain the recombinant plasmid pYL-RtKHE containing the KCR, HCD, and ECR elongase complex genes. The process of transforming yeast with recombinant plasmid is as follows: The linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification is transformed into Yarrowia lipolytica as follows: 1) Scrape 2-3 inoculating loops of overnight cultured bacterial lawn; 2) Add the following ingredients in sequence: 90 μL of 50% (mass concentration) PEG (3350), 5 μL of 2M LiAc, 5 μL of 2M DTT (freshly prepared), 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally the fragment to be transformed; 3) Mix thoroughly and place in a 30°C water bath for 1 hour; 4) Heat shock in a 39°C water bath for 10 min; 5) Evenly spread the transformation mixture onto the corresponding YNB screening plate and culture in a 28°C constant temperature incubator for 2-3 days. After a single colony grows, proceed with the subsequent steps. (5) Construction of strain YL5 The plasmid vector was constructed using the Gibson assembly method, and all assembly fragments were obtained by PCR amplification. The plasmid backbone was derived from the pYL-POX5-MoLPAT plasmid, which consists of the following parts: a) A selection marker Amp resistance gene and replication origin pBR322 ori in E. coli; b) the selection marker URA and its promoter PLEU2 and terminator in Yarrowia lipolytica; c) SCDup, the upstream integration fragment of the site-specific integration site SCD; d) the downstream integration fragment SCDdn of the site-specific integration site SCD; All PCR amplifications described above used KAPA HiFi high-fidelity DNA polymerase. The amplification system consisted of 50 μl of 2× KAPA Mix (25 μl), 1.5 μl of each 10 μM primer, and 1 μl of template. Water was added to make up to 50 μl to obtain each DNA sequence. Amplification conditions were: pre-denaturation at 95°C for 3 minutes; denaturation at 98°C for 20 seconds, annealing at 60-72°C for 15 seconds, and extension at 72°C, with an extension time of 30 seconds per kb and a cycle number of 29-35; extension at 72°C for 10 minutes. The plasmid backbone and the KCR, HCD, and ECR elongase complex gene fragments obtained above were assembled and transformed into competent Escherichia coli Trans-T1, and then colony PCR and sequencing were performed using primers JD2-F and JD2-R to obtain the recombinant plasmid pYL-RtKHE containing the KCR, HCD, and ECR elongase complex genes. The process of transforming yeast with recombinant plasmid is as follows: The linearized recombinant plasmid or the acyltransferase MoLPAT gene fragment obtained by PCR amplification is transformed into Yarrowia lipolytica as follows: 1) Scrape 2-3 inoculating loops of overnight cultured bacterial lawn; 2) Add the following components in sequence: 90 μL of 50% (mass concentration) PEG, 5 μL of 2M LiAc, 5 μL of 2M DTT, 5 μL of salmon sperm DNA, 5 μL of DMSO, and finally the fragment to be transformed; 3) Mix thoroughly and place in a 30°C water bath for 1 hour; 4) Heat shock in a 39°C water bath for 10 min; 5) Evenly spread the transformation mixture onto the corresponding YNB screening plate and incubate in a 28°C constant temperature incubator for 2-3 days. After a single colony has grown, proceed with the subsequent steps.

6. Use of the genetically engineered strain as described in any one of claims 1 to 3 in the simultaneous production of oil and nervonic acid.

7. A fermentation method for increasing the production of microbial oils and nervonic acid using the genetically engineered strain according to any one of claims 1 to 3, characterized in that: The method obtains a high-yield cell factory of nervonic acid through system metabolic engineering in Yarrowia lipolytica chassis cells. On this basis, the production of nervonic acid and oil is further improved by utilizing genetically engineered strains and optimizing fermentation medium and fermentation process.

8. The fermentation method according to claim 7, characterized in that: The steps include: The steps of the shake flask fermentation method of the genetically engineered strain are as follows: 1) Remove the genetically engineered strain from the -80°C seed tube and inoculate it into YPD seed activation medium (10 g / L yeast powder, 20 g / L peptone, 10 g / L glucose, water as solvent, mix well, and sterilize at 115°C for 30 min). Incubate at 28°C, 250 rpm, and incubate for 24 h to obtain the activated bacterial solution. 2) Spread the activated bacterial solution onto a YPD seed activation solid medium plate (10 g / L yeast powder, 20 g / L peptone, 10 g / L glucose, 20 g / L agar powder, water as solvent, mix well, and sterilize at 115°C for 30 minutes) and incubate at 28°C for 18 hours. 3) Pick a single colony from the plate and inoculate it with 5 mL of seed culture medium (transfection #1). After 36 hours of culture, inoculate 100 μL of the culture medium with 5 mL of seed culture medium (transfection #2). After 36 hours of culture, transfer to shake flask fermentation medium. The initial OD value is uniformly 0.

08. After shaking the flask for 144 hours, oil and nervonic acid are obtained. The fermentation medium comprises the following components: 150 g / L glucose, 12 g / L yeast powder, 6 g / L ammonium sulfate, 8 g / L sodium acetate, 10 g / L high oleic rapeseed oil, and water as the solvent. After mixing, the mixture is sterilized at 115° C. for 30 minutes.

9. The fermentation method according to claim 8, characterized in that: The steps of using acetic acid as a carbon source to perform fed-batch fermentation in a fermenter are as follows: The preserved strain YL5 was removed from a -80°C seed tube and inoculated into YNB medium, cultured at 28°C, 250 rpm, for 24 hours; then inoculated into YNB medium as a first-level seed, cultured at 28°C, 250 rpm, for 24 hours; after 24 hours, the first-level seed was inoculated into seed medium, with an initial OD = 0.08, cultured at 28°C, 250 rpm for 18 hours, and when the OD grew to 8-10, it was used as a second-level seed for tank loading; the fermentation medium was filled into a fermentation tank, with an inoculum volume of 10% and an initial liquid volume of 60% of the tank volume; Fermentation process control: The fermentation temperature is controlled at 28°C. After the pH begins to rise to 6.5, pure acetic acid is used to control it at 6.

5. Stirring is linked to dissolved oxygen, and the dissolved oxygen is controlled at more than 20%. The cascade control speed is between 200-680 rpm. The tank pressure is not specially controlled for the first 24 hours, and is controlled at 0.01-0.03 MPa after 24 hours. The total culture time is 192 hours. The defoamer is added to the fermentation medium at a final concentration of 3-5 parts per ten thousand. YNB medium contains: 20 g / L glucose, 1.7 g / L yeast nitrogen base without amino acids and ammonium sulfate, 5 g / L ammonium sulfate, 0.69 g / L CSM-Ura, and water as the solvent. The fermentation medium is: 150 g / L glucose, 12 g / L yeast powder, 6 g / L ammonium sulfate, 8 g / L sodium acetate, 10 g / L high oleic rapeseed oil, and the solvent is water. After mixing, sterilize at 115°C for 30 minutes.

10. Use of the method according to any one of claims 7 to 9 in the simultaneous production of microbial oils and nervonic acid.

Images