Method for obtaining white pulp genotype tetraploid loquats based on open pollination of white pulp triploid loquats

Abstract

The invention provides a method for obtaining white pulp genotype tetraploid loquats based on open pollination of white pulp triploid loquats. According to the method, white-flesh triploid loquats (such as' Huayu seedless No.1 ', Q16 and Q21) capable of fruiting (at least one single flower spike fruit on average) under the open pollination condition are taken as female parents and mixed with white-flesh diploid loquats for field planting, and open pollination seeds of the triploid loquats are taken as materials for screening to obtain white-flesh genotype tetraploid loquats.

Description

TECHNICAL FIELD

[0001] The present application belongs to biotechnology and relates to loquat breeding, in particular to a method for obtaining white-fleshed genotype tetraploid loquat based on open pollination of white-fleshed triploid loquat. BACKGROUND

[0002] Loquat is a perennial subtropical evergreen woody fruit tree of Rosaceae Loquat genus, and its fruit is delicate and juicy, rich in nutrients, and has the effects of relieving cough, moistening lung, invigorating spleen and diuresis. As a perennial vegetative propagation crop, loquat germplasm can only be preserved by field planting at present, and the research on loquat germplasm and breeding has important significance for the production, development and comprehensive utilization of loquat.

[0003] Current commercial loquat varieties are mostly diploid (chromosome number 2n = 2x = 34), with large and many seeds, which leads to low edible rate and poor processing performance of loquat fruit. Therefore, seedlessness is an important goal of loquat breeding. Triploid has high abnormality degree of meiosis, and most of the gametes cannot develop normally. Loquat triploid (2n = 3x = 51) is the main material to achieve seedless loquat. Currently, several triploid seedless loquat varieties such as ‘Wuheguoyu’, ‘Huayuwenhe No.1’, ‘Huajinwenhe No.1’, ‘Wuhezaoyu’, ‘Wuhefuzao’ and the like have been developed. These varieties are all selected from the offspring of diploid loquat, i.e. the principle of 2n gamete production of loquat is used. However, the frequency of 2n gamete production of loquat is very low, which leads to a great workload of screening triploid, and is not conducive to large-scale breeding of triploid seedless loquat. Tetraploid hybridization with diploid is the most efficient way to obtain triploid. However, there are very few tetraploid (2n = 4x = 64) lines of loquat, and it is impossible to create triploids of multiple genetic backgrounds in a short time. Therefore, in order to speed up the breeding process of triploid seedless loquat, efficient exploitation of tetraploid is the foundation.

[0004] There are many methods for obtaining tetraploid plants, including chemical reagent (such as colchicine) induction, physical induction, and ploidy hybridization. Chemical reagent induction often produces chimeras, and the materials are difficult to purify. Kong Suping used colchicine mutagenesis combined with tissue culture technology to conduct a loquat chromosome doubling experiment, but did not obtain a large number of polyploids (Kong Suping. Research on loquat embryo culture and polyploid induction [D]. Sichuan Agricultural University, 2002.). Physical induction has different effects on different plants and is difficult to implement. Zheng Shaoquan et al. used radiation mutagenesis to achieve the goal of doubling the number of chromosomes, but the fruit obtained in this experiment had a low rate of few seeds and could not be applied to production practice (Zheng Shaoquan, Xu Xiudan, Xu Jiahui et al. Research on loquat radiation mutagenesis breeding I. Suitable dose of branch radiation and trait variation [J]. Fruit trees in southern China, 1996, 25(3): 25-27.). Hybridization of parents with different ploidy is also a common method of ploidy breeding. Theoretically, tetraploid loquat can be obtained by hybridizing diploid loquat with tetraploid loquat, but the vitality and germination rate of diploid pollen are at a disadvantage in competition with haploid pollen, so the possibility of obtaining tetraploid offspring by hybridizing tetraploid with diploid is very low. Summary of the Invention

[0005] In order to solve the problems in the prior art, the present invention provides a method for obtaining a white-flesh genotype tetraploid loquat based on open pollination of a white-flesh triploid loquat. Loquat can be self-pollinated or cross-pollinated. When it is naturally pollinated, complex mutations often occur in the offspring of seedlings. The inventor unexpectedly discovered that by using a triploid parent material of a specific genotype that can bear fruit (homozygous white-flesh genotype (aaa)) as the female parent and a diploid of the white-flesh genotype (aa) as the male parent, not only can a white-flesh genotype tetraploid loquat be obtained through open pollination, the proportion of white-flesh genotype tetraploid loquats obtained is much higher than that of the prior art, which is of great significance for seedless breeding of loquats.

[0006] The present invention adopts the following technical solutions:

[0007] A method for obtaining white-fleshed genotype tetraploid loquats based on open pollination of white-fleshed triploquats, characterized by comprising the following steps:

[0008] (1) Triploid maternal selection

[0009] The triploid parent material with homozygous white flesh genotype (aaa) that can bear fruit under open pollination conditions was selected as the triploid female parent;

[0010] (2) Construction of natural pollination system

[0011] Planting the fruit-bearing triploid loquats of the white-fleshed genotype obtained in step (1) in a specific area, with the diploid white-fleshed genotype (aa) loquats being the main species within 1 km of the mother plant;

[0012] (3) Screening of tetraploid plants by progeny ploidy identification:

[0013] After the seeds of the open pollination of the triploid are sowed into seedlings, the leaves of the progeny plants after the open pollination are detected by using flow cytometry, and the tetraploid single plants are screened.

[0014] (4) Identification of the flesh color of the progeny tetraploid:

[0015] The tetraploid is analyzed by using the specific marker primer of the flesh color of loquat, and the white-flesh tetraploid single plant is obtained by screening;

[0016] The specific marker primer of the flesh color of loquat is selected from the specific marker primer 1 (EjPSY2A-F: TATGAACCATTGATTAGTCTAGC; EjPSY2A-R: GTTATTGTCACCGTAGTCGC) of the flesh color of loquat or the improved primer 2 (EjPSY2A-NEW-F: TATGAACCATTGATTAGTCTAGC; EjPSY2A-NEW-R: GCCACCATCATTCCAATC).

[0017] In the application, the average single inflorescence can bear not less than one fruit.

[0018] In the application, when the triploid female parent is selected in step (1), firstly, the ploidy of the material is identified by using flow cytometry combined with the chromosome preparation technology, and the triploid is selected; secondly, the result characteristics of the triploid loquat are observed, and the strain capable of bearing fruit (the average single inflorescence can bear not less than one fruit) under the condition of open pollination is selected; thirdly, the genotype of the triploid strain is analyzed by using the specific molecular marker of the flesh color of loquat, and the triploid parent material with the homozygous white-flesh genotype (aaa) is strictly screened (only a band of 319 bp can be amplified by using the primers EjPSY2A-F and EjPSY2A-R, and a band of 1013 bp or two bands of 1013 bp and 319 bp can be amplified for the red-flesh genotype); the average single inflorescence can bear not less than one fruit; and the specific molecular marker of the flesh color of loquat is the specific marker primer 1 of the flesh color of loquat.

[0019] In the application, in the construction of the natural pollination system in step (2), the diploid white-flesh genotype (aa) loquat is mainly used as the female parent within 1 km, the white-flesh male parent (aa) is only planted within 100 m of the female parent center, and other genotypes are excluded; and the proportion of the white-flesh male parent (aa) is greater than or equal to 60% within the range of 100-1000 m of the female parent center.

[0020] In the application, the male parent and the female parent are planted with a spacing of 4m*4m.

[0021] In the present application, the triploid parent material with homozygous white flesh genotype (aaa) is preferably one or several of white flesh triploid loquat such as 'Huayu Seedless 1', Q16, Q21.

[0022] In the present application, the diploid white flesh genotype loquat is preferably 'Huabai 1' and / or 'Huabai 2'. The diploid red flesh genotype is 'Jinhua 2' (Aa).

[0023] Beneficial effects:

[0024] The present application provides a method for obtaining white flesh genotype tetraploid loquat based on open pollination of white flesh triploid loquat. In the present application, white flesh triploid loquat (such as 'Huayu Seedless 1', Q16, Q21) that can set fruit (at least 1 fruit per individual flower spike on average) under open pollination conditions is used as the female parent, mixed with white flesh diploid loquat for planting, and the seeds of triploid loquat open pollination are used as the material for screening to obtain white flesh genotype tetraploid loquat. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is the ploidy identification and 3 triploid meat color gene genotyping of Q16 and Q21.

[0026] Figure 2 is the ploidy of 'Huayu Seedless 1' open pollination offspring.

[0027] Figure 3 is the agarose gel electrophoresis analysis of the fruit flesh color molecular marker amplification product of the tetraploid genome of the offspring of 'Huayu Seedless 1'. DETAILED DESCRIPTION

[0028] In order to further illustrate the present application and its advantages, the technical solutions of the present application will be further described below through specific embodiments, and it should be understood that these embodiments only help to understand the present application and should not be regarded as specific limitations of the present application. Unless otherwise specified, the parts described in the present application are parts by weight, and the percentages described are mass percentages. The triploid parent material 'Huayu Seedless 1' of the present application (Dangjiangbo, Guo Qigao, Xiang Suqiong, et al. New Variety of Large Fruit Seedless Loquat 'Huayu Seedless 1' [J]. Acta Horticulturae Sinica, 2019, 46(S2): 2766-2767.; Variety Right No.: CNA20151820.5).

[0029] The invention is diploid white-fleshed genotype (aa) loquat 'Huabai No. 1' (variety right No. CNA20151823.2) (white-fleshed diploid), 'Huabai No. 2' (Wang Junxu, Li Xiaolin, He Qiao, et al. New white-fleshed loquat variety 'Huabai No. 2' [J]. Acta Horticulturae Sinica, 2024, 51(S2): 65-66.; Variety No. YUS-SV-EJ-002-2021) (white-fleshed diploid). 'Jinhua No. 2' (Dang Jiangbo, Guo Qigao, Xiang Suqiong, et al. New red-fleshed loquat variety 'Jinhua No. 2' with few kernels and high sugar content [J]. Acta Horticulturae Sinica, 2019, 46(S2): 2768-2769.; Variety identification No. YUPINSHIYANJIAN2018010) (red-fleshed diploid).

[0030] Example 1

[0031] A method for obtaining white-fleshed genotype tetraploid loquat based on open pollination of white-fleshed triploid loquat, characterized in that it comprises the following steps:

[0032] (1) Selection of triploid female parent

[0033] Select a triploid parent material with homozygous white-fleshed genotype (aaa) that can set seeds under open pollination conditions as the triploid female parent; when selecting the triploid female parent, first use flow cytometry combined with chromosome preparation technology to identify the ploidy of the material and select triploids; secondly, observe the fruit characteristics of the triploid loquat and select the strain that can set seeds (not less than 1 fruit per average flower spike) under open pollination conditions; thirdly, use loquat flesh color-specific molecular markers to analyze the genotype of the triploid strain and strictly select the triploid parent material with homozygous white-fleshed genotype (aaa) (only a 319 bp band can be amplified using primers EjPSY2A-F and EjPSY2A-R); the ability to set seeds refers to not less than 1 fruit per average flower spike; the loquat flesh color-specific molecular marker is loquat flesh color-specific marker primer 1.

[0034] (2) Construction of natural pollination system

[0035] Plant the white-fleshed genotype triploid loquat that can set seeds obtained in step (1) in a specific area; to ensure that the pollen received by the female parent mainly comes from the target genotype (white-fleshed genotype (aa)), the female parent plant is mainly planted with diploid white-fleshed genotype (aa) loquat within 1 km; strictly plant white-fleshed male parent (aa) within 300 m of the female parent center and exclude other genotypes. A small amount of other varieties can be mixed within the range of 300-1000 m, but the proportion of white-fleshed male parent (aa) still needs to be ≥60%. The male parent and female parent are planted with a spacing of 4m x 4m.

[0036] (3) Ploidy identification and selection of tetraploid plants:

[0037] The triploid open pollination seedlings were sowed, and the leaves of the open pollination offspring plants were detected by flow cytometry to screen the tetraploid single plants.

[0038] (4) Identification of the color of the fruit pulp of the offspring tetraploid:

[0039] The white-pulp tetraploid single plants were screened and obtained by using the loquat fruit pulp color-specific marker primer to analyze the tetraploid, and the loquat fruit pulp color-specific marker primer was selected from loquat fruit pulp color-specific marker primer 1 (EjPSY2A-F: TATGAACCATTGATTAGTCTAGC; EjPSY2A-R: GTTATTGTCACCGTAGTCGC), or improved primer 2 (EjPSY2A-NEW-F: TATGAACCATTGATTAGTCTAGC; EjPSY2A-NEW-R: GCCACCATCATTCCAATC).

[0040] The triploid parent material with a homozygous white-pulp genotype (aaa) is preferably one or several of white-pulp triploid loquats such as 'Huayu Wuzhe No. 1', Q16, Q21.

[0041] The diploid white-pulp genotype (aa) loquat is preferably 'Huabai No. 1' and / or 'Huabai No. 2'. The diploid red-pulp genotype is preferably 'Jinhua No. 2' (Aa).

[0042] Example 2

[0043] The triploid strains 'Huayu Wuzhe No. 1' (Q27), Q16 and Q21 were used as the female parent to create tetraploids

[0044] 1) Screening and identification of excellent triploid female parents

[0045] 'Huayu Wuzhe No. 1' is a triploid loquat (2n = 3x = 51). To verify the ploidy of Q16 and Q21, flow cytometry combined with chromosome counting was used for analysis. Flow cytometry detection showed that the DNA fluorescence intensity peak value of Q16 and Q21 was 1.5 times that of the diploid control 'Jinhua No. 2' (2n = 2x = 34) (C-E). Chromosome counting further confirmed that the chromosome number of the two strains was 3x = 3n = 51 (A-B), which was confirmed as triploid. Figure 1 Figure 1

[0046] ​​To determine the flesh color genotypes of three triploid loquat lines ('Huayu Seedless 1', Q16, and Q21), genomic DNA from the three lines was amplified using flesh color-related molecular markers (EjPSY2A-F: TATGAACCATTGATTAGTCTAGC; EjPSY2A-R: GTTATTGTCACCGTAGTCGC). 'Huabai 1' (white flesh) and 'Jinhua 2' (red flesh) were used for comparison. Agarose gel electrophoresis revealed that only a single fragment of approximately 319 bp was amplified from the genomic DNA of the three triploid lines ( Figure 1 F). Therefore, the genotypes of the three triploid lines are all white-fleshed genotypes, which can be labeled as aaa according to the method reported by Xiumin Fu et al. (2012) (Xiumin F, Wenbin K, Gang P, et al. Plastid structure and carotenogenic gene expression in red-and white-fleshed loquat (Eriobotryajaponica) fruits. [J]. Journal of experimental botany, 2012, 63 (1): 341-54.).

[0047] Figure 1 Ploidy identification of Q16 and Q21 and flesh color genotyping of three triploid lines. A is chromosome Q16; B is chromosome Q21; C is a histogram of DNA fluorescence intensity in leaf cells of the diploid line 'Jinhua 2' measured by flow cytometry; D is a histogram of DNA fluorescence intensity in leaf cells of Q16 measured by flow cytometry, with a secondary peak indicating DNA fluorescence intensity in leaf cells of the diploid line 'Jinhua 2'; E is a histogram of DNA fluorescence intensity in leaf cells of Q21 measured by flow cytometry, with a secondary peak indicating DNA fluorescence intensity in leaf cells of the diploid line 'Jinhua 2'; F is agarose gel electrophoresis of genomic DNA flesh color marker amplification products from the three triploid lines. 'Jinhua 2' was identified as a heterozygous red-fleshed loquat, and 'Huabai 1' was identified as a white-fleshed loquat as a control.

[0048] Construction of natural pollination system

[0049] The selected triploid loquats were used as female plants and planted in a specific experimental area. To ensure that the female plants received pollen primarily from the target genotype, the pollination environment was strictly controlled in the planting layout. Within a 1-kilometer radius of the female plants, only 'Jinhua No. 2' (a heterozygous red-fleshed diploid), 'Huabai No. 1' (a white-fleshed diploid), and 'Huabai No. 2' (a white-fleshed diploid) were present. The 'Jinhua No. 2' variety was planted over 300 meters apart.

[0050] Ploidy identification of triploid open pollinated progeny

[0051] Flow cytometry was used to analyze the ploidy of 377 open pollinated progeny of three triploid loquat lines (‘Huayu Seedless 1’, Q16 and Q21). The results showed that there was significant variation in ploidy among the progeny. The 297 progeny of ‘Huayu Seedless 1’ showed a complex ploidy composition: diploid (16%), triploid (10%), tetraploid (44%) and aneuploid (30%). Among the 50 progeny of Q16, diploids and tetraploids accounted for 32% and 68%, respectively. The 30 progeny of Q21 contained diploids (57%), triploids (7%) and tetraploids (36%). The comprehensive analysis showed that the ploidy distribution of the progeny of the three triploid lines was: diploid 21%, triploid 8%, tetraploid 47% and aneuploid (materials with non-integral changes in chromosome number) 24%. Notably, the frequency of tetraploids in the progeny was significantly higher than that of conventional tetraploid creation methods (such as somatic doubling), indicating that open pollination of triploid loquat is an effective way to produce tetraploids.

[0052] Figure 2 Ploidy of ‘Huayu Seedless 1’ open pollinated progeny, where A is the column chart of flow cytometry detection of DNA fluorescence intensity of diploid leaf cells, the peak value of the plant overlaps with that of the control diploid; B is the column chart of flow cytometry detection of DNA fluorescence intensity of triploid leaf cells, the median of the peak value of the plant is 1.58 times that of the peak value of the control diploid; C is the column chart of flow cytometry detection of DNA fluorescence intensity of tetraploid leaf cells, the median of the peak value of the plant is 1.93 times that of the peak value of the control diploid; D is the column chart of flow cytometry detection of DNA fluorescence intensity of aneuploid leaf cells, the median of the peak value of the plant is 1.87 times that of the peak value of the control diploid; E is the histogram of the number of individuals of different ploidy in the open pollinated progeny of ‘Huayu Seedless 1’.

[0053] Flesh color identification of tetraploid progeny screened out

[0054] Using the loquat flesh color gene genotyping markers of loquat flesh color specific marker primer 1 or / and improved primer 2, based on PCR and agarose gel electrophoresis technology, 172 tetraploid individuals of the three lines ‘Huayu Seedless 1’, Q16 and Q21 were preliminarily identified for flesh color genotype. Two heterozygous genotypes were detected, i.e. red-flesh genotype (24%) and white-flesh genotype (76%). The proportion of white-flesh tetraploid in the tetraploid progeny of ‘Huayu Seedless 1’ was as high as 77.69%. The results showed that after open pollination, the proportion of tetraploid loquat in the progeny was as high as 46%, and the proportion of white-flesh tetraploid in the total tetraploid loquat was as high as 76%.

[0055] Figure 3is the agarose gel electrophoresis analysis of the amplification product of the fruit flesh color molecular marker of the tetraploid genome DNA of 'Huanyu Wukong No.1', wherein A is the amplification product of the loquat flesh color specific marker primer 1; B is the amplification product of the improved primer. "M" represents DL 2000 DNA marker.

Claims

1. A method for obtaining white-fleshed genotype tetraploid loquats based on open pollination of white-fleshed triploquats, characterized in that: The steps include: (1) Triploid maternal selection The triploid parent material with homozygous white flesh genotype (aaa) that can bear fruit under open pollination conditions was selected as the triploid female parent; (2) Construction of natural pollination system The white-fleshed triploid loquats obtained by screening in step (1) are planted, and the diploid white-fleshed genotype (aa) loquats are mainly grown within 1 km of the mother plant; (3) Identification of offspring ploidy and screening of tetraploid plants: After the triploid open-pollinated seeds were sown into seedlings, the leaves of the open-pollinated offspring plants were tested by flow cytometry to screen tetraploid plants; (4) Identification of flesh color of tetraploid offspring: Tetraploids were analyzed using loquat flesh color-specific marker primers, and white-fleshed tetraploid plants were obtained. The loquat pulp color specific marker primer is selected from loquat pulp color specific marker primer 1 (EjPSY2A-F: TATGAACCATTGATTAGTCTAGC; EjPSY2A-R: GTTATTGTCACCGTAGTCGC), or improved primer 2 (EjPSY2A-NEW-F: TATGAACCATTGATTAGTCTAGC; EjPSY2A-NEW-R: GCCACCATCATTCCAATC).

2. The method according to claim 1, wherein The ability to bear fruit means that on average a single flower spike has no less than one fruit.

3. The method according to claim 1, wherein Step (1) When selecting a triploid mother, firstly, the ploidy of the material is identified by using flow cytometry combined with chromosome preparation technology, and the triploid is selected; secondly, the fruiting characteristics of the triploid loquat are observed, and the strains that can bear fruit under open pollination conditions are selected; thirdly, the genotype of the triploid strains is analyzed using loquat flesh color-specific molecular markers, and triploid parent materials with a homozygous white flesh genotype (aaa) are screened; the ability to bear fruit means that an average of no less than one fruit is produced per single spike; The loquat pulp color-specific molecular marker is loquat pulp color-specific marker primer 1.

4. The method according to claim 3, wherein The triploid parent material with the homozygous white meat genotype (aaa) is a triploid parent material that can only amplify a 319 bp band using primers EjPSY2A-F and EjPSY2A-R.

5. The method according to any one of claims 1 to 4, characterized in that In the construction of the natural pollination system in step (2), the diploid white-fleshed genotype (aa) loquat is mainly used within 1 km of the mother plant, and the white-fleshed male parent (aa) is planted within a radius of 100m from the center of the mother plant, and the male parent (aa) accounts for ≥60% within a radius of 100-1000m from the center of the mother plant.

6. The method according to claim 5, wherein The male and female parents were planted at a spacing of 4 m × 4 m.

7. The method according to any one of claims 1 to 4, characterized in that The triploid parent material with homozygous white flesh genotype (aaa) is selected from one or more of white flesh triploid loquats such as 'Huayu Seedless No. 1', Q16, and Q21.

8. The method according to claim 5, wherein The diploid white-fleshed genotype (aa) loquat is selected from 'Huabai No. 1' and / or 'Huabai No. 2'.

9. The method according to claim 5, wherein The proportion of diploid red meat male parents within a radius of 100-1000m from the maternal center is less than 40%.

10. The method according to claim 9, wherein The diploid red meat male parent is 'Jinhua No. 2' (Aa).

Images