ACSF2 gene molecular marker related to weight and egg laying traits of white geese in south of Yangtze River and application of ACSF2 gene molecular marker

Abstract

The invention relates to the technical field of poultry breeding, in particular to an ACSF2 gene molecular marker related to the weight and egg laying traits of white geese in the south of Jiangsan and application of the ACSF2 gene molecular marker. According to the present invention, the ACSF2 gene molecular marker is the g.6316855 site and the g.6317768 site of the ACSF2 gene; according to the application of the loci as the molecular genetic marker, specifically, for breeding for improving the egg yield, individuals with the g.6316855 locus of the ACSF2 gene being T and the g.6317768 locus being A are selected, and individuals with the g.6316855 locus of the ACSF2 gene being A and the g.6317768 locus of the ACSF2 gene being A are selected; for breeding which aims at improving body weight, an individual with the g.6316855 site of the ACSF2 gene being C and the g.6317768 site being G is selected. According to the invention, a plurality of SNP sites, including synonymous mutation and non-synonymous mutation, of the ACSF2 gene are found, and the functional influence of the ACSF2 gene is predicted and analyzed; the relevance between the polymorphism of the ACSF2 gene of the white geese in the south of the Yangtze River and the body weight and egg laying characters is defined, and an effective molecular marker is developed for assisted breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of poultry breeding, in particular to a Jiangnan white goose weight and egg laying trait related ACSF2 gene molecular marker and application thereof. TECHNICAL BACKGROUND

[0002] Jiangnan white goose is an important waterfowl breed in the Jiangnan region of China, which is characterized by delicious meat, good growth performance and outstanding egg laying performance. Body weight and egg laying traits are key indicators of measuring goose production performance, which are directly related to the economic benefits of breeding. With the increasing market demand, improving the body weight and egg laying performance of Jiangnan white goose through molecular marker assisted breeding has become an important research direction. Acyl-CoA synthetase family member 2 (ACSF2) gene is involved in fatty acid activation and lipid metabolism, and lipid metabolism is closely related to the growth and development and reproductive performance of poultry. Previous studies have shown that ACSF2 gene expression may be related to goose body weight and egg laying traits, but the association analysis of ACSF2 gene polymorphism with body weight and egg laying traits in Jiangnan white goose has not been clearly defined, and there is a lack of effective molecular markers for assisted breeding. SUMMARY

[0003] In order to solve the problems existing in the prior art, the present application provides a Jiangnan white goose weight and egg laying trait related ACSF2 gene molecular marker and application thereof.

[0004] Firstly, phylogenetic tree analysis found that the goose ACSF2 gene had the closest genetic relationship with chicken, and was clustered with chicken and turkey of the same class. Then, using Jiangnan white goose, Holbaqi goose and Zhedong white goose liver cDNA as templates, the specific sequence of the CDS region of ACSF2 gene was obtained by PCR amplification and sequencing. Four SNP sites were screened out through sequence alignment, which were g.6316855C>T, g.6317531C>T, g.6317723G>A and g.6317768G>A. Finally, through function prediction and weight egg laying association analysis, it was determined that g.6316855C>T and g.6317768G>A sites were significantly associated with Jiangnan white goose weight and egg laying, and could be used as potential molecular markers for breeding.

[0005] The present application discloses a Jiangnan white goose weight and egg laying trait related ACSF2 gene molecular marker, which is the g.6316855 site and the g.6317768 site of ACSF2 gene.

[0006] The present application further discloses the application of the g.6316855 site and the g.6317768 site of ACSF2 gene as a Jiangnan white goose weight and egg laying trait molecular genetic marker.

[0007] The application of the g.6316855 site and the g.6317768 site of the ACSF2 gene of the application as the molecular genetic markers of the body weight and egg production traits of Jiangnan White Geese is specifically as follows: for breeding aiming at improving egg production, individuals with the g.6316855 site being T and the g.6317768 site being A are selected; for breeding aiming at improving body weight, individuals with the g.6316855 site being C and the g.6317768 site being G are selected.

[0008] The molecular marker of the application is obtained by the following steps: (1) searching for the ACSF2 gene sequence of geese, designing amplification primers and entrusting a company to synthesize; (2) extracting liver tissue RNA of target individuals, and obtaining cDNA by reverse transcription; (3) performing ACSF2 gene PCR amplification of geese according to the 2xTaq Master Mix kit instructions; (4) performing electrophoresis detection on the PCR products, sending the products to a sequencing company for bidirectional sequencing, analyzing and screening SNP sites by using bioinformatics software, and determining the four sites of g.6316855C>T, g.6317531C>T, g.6317723G>A and g.6317768G>A; (5) combining the phenotype data such as body weight, egg production and egg weight of three varieties of geese, and analyzing the correlation between the SNP sites and the traits, and the results show that the g.6316855C>T and g.6317768G>A sites are significantly correlated with the body weight and egg production traits of Jiangnan White Geese; (6) in the breeding process of Jiangnan White Geese, the DNA or RNA of individuals to be tested is extracted, and the genotypes of the g.6316855C>T and g.6317768G>A sites are detected by the above method. For breeding aiming at improving egg production, individuals with the g.6316855 site being T and the g.6317768 site being A are preferentially selected; for body weight breeding, individuals with corresponding genotypes can be selected according to the target body weight, so as to realize molecular marker assisted breeding.

[0009] The beneficial effects of the application are as follows: (1) a plurality of SNP sites of the ACSF2 gene are found, including synonymous mutations and non-synonymous mutations, and the functional effects thereof are predicted and analyzed; (2) it is helpful to further understand the action mechanism of the ACSF2 gene in the growth and reproduction of geese, provides an important clue for further studying the relationship between lipid metabolism and production performance of geese, and expands the field of research on functions of genes of poultry; (3) The association between ACSF2 gene polymorphism and body weight and egg laying traits of Jiangnan White Ge was determined, and an effective molecular marker was developed for assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 are the sequencing peak maps of the SNP sites of the ACSF2 gene of three breeds of ge g.6316855, g.6317531, g.6317723 and g.6317768. Note: JN: Jiangnan White Ge, H: Holbaqi Ge, ZD: Zhedong White Ge. DETAILED DESCRIPTION

[0011] Example One: (1) The ACSF2 gene sequence (XM_048064166.2) of ge was searched through the public database NCBI (https: / / www.ncbi.nlm.nih.gov / ), and the amplification primers (Table 1) GOOSE-ACSF2-F and GOOSE-ACSF2-R were designed for the CDS region of the ACSF2 gene by using the software Primer Premier 6, and a company was commissioned to synthesize (Beijing Qikexing Biological Technology Co., Ltd.). ACSF 2-F and GOOSE- ACSF 2-R. The CDS region of the ACSF2 gene in XM_048064166.2 is located at 73..1842, and the specific sequence of the CDS is shown in SEQ ID NO. 1.

[0012] (2) According to the instructions of the RNA extraction reagent RNA-easy Isolation Reagent, total RNA was extracted from the liver tissues of Jiangnan White Ge, Holbaqi Ge and Zhedong White Ge, respectively, the concentration and purity of the extracted total RNA were detected by using the microspectrophotometer Nano-300, and the RNA was reversely transcribed into cDNA for PCR analysis by using the reverse transcription kit HiScript III RT SuperMix for qPCR (+gDNA wiper).

[0013] (3) The PCR amplification of the ACSF2 gene of ge was performed according to the instructions of the 2×Taq Master Mix kit. The amplification system was as follows: 2×Taq Master Mix was 25 μL; GOOSE-ACSF2-F and GOOSE-ACSF2-R primers were 2 μL each; cDNA template was 2 μL, and ddH2O was supplemented to 50 μL. The reaction conditions were as follows: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, for 35 cycles; 72℃ for 5 min, 4℃ for any time.

[0014] (4) After the PCR amplification product was detected by agarose gel electrophoresis, it was sent to the company for sequencing (Beijing Genesee Biotechnology Co., Ltd.). The sequencing results (R end) of the CDS region sequence H of the Hallabji goose ACSF2 gene is shown as SEQ ID NO. 4; the CDS region sequence JN of the Jiangnan white goose ACSF2 gene is shown as SEQ ID NO. 5; and the CDS region sequence ZD of the Zhedong white goose ACSF2 gene is shown as SEQ ID NO. 6. First, the sequencing results of the three varieties of geese were input into the DNAMAN software for alignment, and a large number of mutation sites were collected and arranged, and 123 candidate mutation sites were preliminarily obtained. Then, the sequencing peak map was viewed by Chromas software, and low-quality (QA is usually greater than 20), nested or overlapping peak sites were eliminated. Then, the sequencing results were compared and analyzed with the ACSF2 gene sequence (XM_048064166.2) CDS region by NCBI and SnapGene software, and four SNP sites c.179C>T, c.855C>T, c.1047G>A and c.1092G>A were screened out, and then the above four sites were located on the goose whole genome (NC_089891.1), which are g.6316855C>T, g.6317531C>T, g.6317723G>A and g.6317768G>A (as shown in Table 1). Figure 1 ).

[0015] H: GATAGGACGTGCCTGGACGAGACGGCTGAGCGCTTTCCTGACCGTGAGGCCTTCGTCTTCGTCCGAGATGGGGTTCGGAAAACGTTTGCTCAGTTCAAAGAGGAGGTGGACCAAGCAGCAGCTGGACTTCTGGCTCTTGGCCTGAAGAAAGGAGACCGGCTAGGAATGTGGGGTCCCAATAAATACGAGTGGGTTCTCATGCAGTTTGCAACTGCCCAGGCAGGAATCATCCTGGTATCCGTGAATCCCGCCTATCAGGCCCTTGAGCTGGAGTTTGTCATCAGGAAGGTTGGCTGTAAGGCACTGGTGTTTCCTACTCAATTTAAATCACAGAAATACTATGATATTCTAAAGCAGTCATGTCCTGAGCTAGAAAATTCCAGTCCAGGGGGAATAAAGAGTAAAAGGTTACCTGACTTATCTGTTGTCATTGTGGTGGACTCCAAGCTGCCTGGCACCTTCCACATGAACGACGTGATGCAGGCTGGGGACAGCAGCCACGTGAAGCAGTTAAGAGCCTTACAGCAGACCCTGTCCTGCAACGAGCCCATCAACATTCAGTTCACTTCAGGGACAACGGGAAGCCCCAAAGGAGCCACCCTCTCTCATAGGAACATTGTGAATAATGGCAATCTGATTGGCATGAGACTGGGGATCACAGAGCAGGACTATCGTGTTTGCCTCCCCGCACCCCTCTATCA T TGCCTGGCGTCAGTAGGAGGCTGCATGGTGACGGCTCTGCATGGTTCCTCCTGCATCTTCTCATCTCCGAGTTTCGAGGGGAAGGCGGCACTGGAGGCAGTGTCTCAAGAGAAATGCTCCTTTTTACATGGCACGCCAACCATGTTTATAGCCATGCTCTCCCAGCCAGACTTTGACTCCTACGACCTGTC A ACTCTCCGGGGAGGAGTATTGCAGGTCCCCCGTTCCCCTGAGATCTGAAGATGATTTTACGAAGATGCCATGCCAAAACTGGGGTTGCTATGGGACCACGAAACAGCCCTGCCCCTTCTGGGATCCCCACGACAGATTGACAAAAACCAGAAGGGGGATACTCTTCCCCCACCGAGGCAAATTGGGGTCCGAACGGGGAACC (SEQ ID NO. 4, where underlined sites are c.855C>T, c.1047G>A, i.e. g.6317531C>T, g.6317723G>A).

[0016] JN:TGGTAGGTGCCTGGACGAGACGG T TGAGCGCTTTCCTGACCGTGAGGCCTTCGTCTTCGTCCGAGATGGGGTTCGGAAAACGTTTGCTCAGTTCAAAGAGGAGGTGGACCAAGCAGCAGCTGGACTTCTGGCTCTTGGCCTGAAGAAAGGAGACCGGCTAGGAATGTGGGGTCCCAATAAATACGAGTGGGTTCTCATGCAGTTTGCAACTGCCCAGGCAGGAATCATCCTGGTATCCGTGAATCCCGCCTATCAGGCCCTTGAGCTGGAGTTTGTCATCAGGAAGGTTGGCTGTAAGGCACTGGTGTTTCCTACTCAATTTAAATCACAGAAATACTATGATATTCTAAAGCAGTCATGTCCTGAGCTAGAAAATTCCAGTCCAGGGGGAATAAAGAGTAAAAGGTTACCTGACTTATCTGTTGTCATTGTGGTGGACTCCAAGCTGCCTGGCACCTTCCACATGAACGACGTGATGCAGGCTGGGGACAGCAGCCACGTGAAGCAGTTAAGAGCCTTACAGCAGACCCTGTCCTGCAACGAGCCCATCAACATTCAGTTCACTTCAGGGACAACGGGAAGCCCCAAAGGAGCCACCCTCTCTCATAGGAACATTGTGAATAATGGCAATCTGATTGGCATGAGACTGGGGATCACAGAGCAGGACTATCGTGTTTGCCTCCCCGCACCCCTCTATCACTGCCTGGCGTCAGTAGGAGGCTGCATGGTGACGGCTCTGCATGGTTCCTCCTGCATCTTCTCATCTCCGAGTTTCGAGGGGAAGGCGGCACTGGAGGCAGTGTCTCAAGAGAAATGCTCCTTTTTACATGGCACGCCAACCATGTTTATAGCCATGCTCTCCCAGCCAGACTTTGACTCCTACGACCTGTC A ACTCTCCGGGGAGGAGTTATTGCAGGTTCCCCCGTTCCCCCTGA A ATCATGAAGATGATTTTAACGAAGATGCACATGCCAGAGACTGGGGTTGCCTATGGGACCCACGAAACAGCCCTGCCCCTTCTGGGATCC (SEQ ID NO. 5 where underlined sites are c.179C>T, c.1047G>A, c.1092G>A, i.e. g.6316855C>T, g.6317723G>A and g.6317768G>A).

[0017]

[0018] (5) To further predict the possible impact of SNP sites on protein structure and function, SIFT and PolyPhen-2 software were used for function prediction of SNP sites. Among them, g.6316855C>T and g.6317723G>A are synonymous mutations, which do not change amino acids, but may affect codon usage bias or translation efficiency; g.6317768G>A is a synonymous mutation, which may affect mRNA stability or splicing regulation. g.6317531C>T is a non-synonymous mutation, located in a conserved functional domain, PolyPhen-2 predicts that it may be harmful (score 0.98), SIFT score is 0.00 (lower than the harmfulness threshold of 0.05), and the median of conservation is 3.15, indicating that the site may have a significant negative impact on protein function.

[0019] (6) 30 female geese of each of Jiangnan White Goose, Holbaqi Goose and Zhexi White Goose, a total of 90 geese, were uniformly raised in the test period, including the same feed formula, feeding management and environmental conditions. Combined with the phenotype data (such as Table 2) of the three varieties of geese, such as body weight, egg production, egg weight, etc., the correlation between SNP sites and traits was analyzed. The results showed that the g.6316855C>T site was significantly correlated with body weight (p<0.05), while the g.6317768G>A site was extremely significantly correlated with egg production (p<0.01) (such as Table 3).

[0020] (7) In the breeding process of Jiangnan White Goose, the DNA or RNA of the test individual was extracted, and the genotypes of g.6316855C>T and g.6317768G>A sites were analyzed by sequencing. For the selection of individuals with high egg production, individuals with T at g.6316855 site and A at g.6317768 site were preferred. Because Jiangnan White Goose has a negative correlation between body weight and egg production, generally, female geese with smaller body weight have higher egg production, so the high egg production site is avoided; for the selection of individuals with high body weight, individuals with C at g.6316855 site and G at g.6317768 site were selected, to realize molecular marker-assisted breeding.

[0021] Taking Jiangnan white goose (JN), Holbaqi goose (H) and Zhedong white goose (ZD) as examples, the g.6316855C>T (NC_089891.1) of the Jiangnan white goose is detected to have a C→T base substitution at the 179th position (g.6316855C>T, corresponding to c.179C>T of the mRNA reference sequence XM_048064166.2) in the coding region of ACSF2 gene; the g.6317768G>A (NC_089891.1) of the Jiangnan white goose is detected to have a G→A base substitution at the 1092th position (g.6317768G>A, corresponding to c.1092G>A of the mRNA reference sequence XM_048064166.2) in the coding region of ACSF2 gene. The g.6316855C>T and g.6317768G>A sites are T and A respectively in the Jiangnan white goose, and it can be analyzed from the chart that the two sites are probably related to the lower body weight, higher egg production and lower egg weight of the Jiangnan white goose.

Claims

1. A molecular marker of the ACSF2 gene related to body weight and egg production traits in Jiangnan White Goose is located at the g.6316855 and g.6317768 loci of the ACSF2 gene.

2. Application of g.6316855 and g.6317768 loci of the ACSF2 gene as molecular genetic markers for body weight and egg production traits in Jiangnan White geese.

3. The use according to claim 2, characterized in that For breeding aimed at increasing egg production, individuals with T at g.6316855 and A at g.6317768 of the ACSF2 gene were selected. For breeding aimed at increasing body weight, individuals with C at g.6316855 and G at g.6317768 of the ACSF2 gene were selected.

Images