A molecular marker related to the branching angle of oilseed rape, a kasp primer set and application thereof

Abstract

The application discloses a molecular marker related to a branch angle of rapeseed, a KASP primer set and application thereof, and belongs to the field of molecular genetic breeding.The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, a T / C mutation exists at the 106th base, and the genotype of the site includes TT and CC genotypes.The KASP primer set for detecting the molecular marker can be used for identifying the branch angle size of rapeseed, screening rapeseed varieties or strains with small branch angles, and performing molecular marker assisted selection on the branch angle of rapeseed.The KASP primer set for detecting the molecular marker developed by the application has the characteristics of low cost and high throughput in practical application, is high in specificity, and is accurate, reliable, simple to operate and suitable for rapeseed branch angle identification and assisted selection breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular genetic breeding, and in particular to a molecular marker related to the branching angle of rapeseed, a KASP primer set, and their applications. Background Technology

[0002] Rapeseed, as an important oilseed crop, holds a significant position in terms of planting scale and output globally, and rapeseed oil accounts for more than 50% of the edible vegetable oil supply. Increasing rapeseed yield is a key way to ensure the security of edible vegetable oil supply, but the current yield level still lags behind international advanced standards. Among these, optimizing plant type is the core breakthrough point for achieving high and stable yields and mechanized and efficient production.

[0003] Branching angle is a crucial agronomic trait determining the canopy structure of rapeseed. An excessively large branching angle can lead to excessive shading during the mature stage, resulting in low photosynthetic efficiency, poor ventilation and light penetration, and increased susceptibility to pests and diseases. Furthermore, during mechanical harvesting, the branches can become entangled and pull, causing pods to fall off and crack, resulting in high harvesting losses. Therefore, selecting compact rapeseed varieties with a moderately small branching angle is of great significance for increasing rapeseed planting density and reducing harvesting losses.

[0004] Traditional methods for improving plant type require manual measurement of branching angles at maturity, which has drawbacks such as long breeding cycles and significant interference from environmental factors, limiting the accuracy of trait selection. Developing specific molecular markers based on base polymorphisms of target gene loci and establishing an early-stage auxiliary selection system is an effective way to improve rapeseed breeding efficiency. Kompetitive Allele-Specific PCR (KASP), a novel SNP genotyping technique, combines the principles of Amplification Refractory Mutation System (ARMS) with a fluorescence detection system. It uses two forward primers carrying specific bases and one universal reverse primer for PCR amplification. The 5' ends of the forward primers are linked to different fluorescent marker sequences. When the amplified product matches the corresponding allele, the difference in fluorescence signal at the terminal can be used to accurately genotype the SNP locus (He CL, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145:75-86). Therefore, creating KASP molecular markers closely linked to the branching angle trait of rapeseed to achieve seedling genotype screening has important practical value for optimizing the breeding process and accelerating the improvement of plant type. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker, KASP primer set, and its application related to rapeseed branching angle, in order to solve the problems existing in the prior art. The KASP primer set developed in this invention for detecting molecular markers related to rapeseed branching angle has the characteristics of low cost and high throughput in practical applications, and also features high specificity, accuracy, reliability, and ease of operation, making it suitable for rapeseed branching angle identification and assisted selection breeding.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a molecular marker related to the branching angle of rapeseed. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a T / C mutation exists at the 106th base. The genotypes at this site include TT and CC genotypes.

[0008] The present invention also provides a KASP primer set for detecting the molecular marker, comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The present invention also provides a detection kit for the molecular marker described above, comprising the KASP primer set described above.

[0010] The present invention also provides an application of the KASP primer set or the detection kit described herein in identifying the branch angle of rapeseed.

[0011] The present invention also provides a method for identifying the branching angle of rapeseed, comprising the following steps:

[0012] Using the genomic DNA of the rapeseed sample to be tested as a template, the template is amplified by real-time quantitative PCR using the KASP primer set or the detection kit. After the PCR amplification is completed, the fluorescence signal is read, the converted fluorescence signal is analyzed, the genotype is identified, and the branching angle of the rapeseed is determined based on the genotype.

[0013] If the identified genotype is TT, the rapeseed sample to be tested is determined to be a sample with a large branch angle; if the identified genotype is CC, the rapeseed sample to be tested is determined to be a sample with a small branch angle.

[0014] Furthermore, the procedure for the quantitative PCR amplification is as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61–55℃ for 60 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

[0015] Furthermore, the fluorescence quantitative PCR amplification system is as follows: 2 μL of 25 ng / μL DNA template; 5 μL of 2×KASPMaster mix; 0.14 μL of KASP mixed primers and 2.86 μL of water; the volume ratio of upstream primer F1, upstream primer F2 and downstream primer R in the KASP mixed primers is 2:2:5.

[0016] The present invention also provides the application of the KASP primer set or the detection kit described herein in screening rapeseed varieties or lines with small branch angles.

[0017] The present invention also provides an application of the KASP primer set or the detection kit described herein in molecular marker-assisted breeding of rapeseed branching angle.

[0018] The present invention discloses the following technical effects:

[0019] This invention identifies an SNP locus on the A07 chromosome of rapeseed that co-segregates with the rapeseed branching angle gene. At the same time, it develops a rapid and efficient KASP primer set that can be used for molecular-assisted breeding of rapeseed branching angle. This KASP primer set has important value in rapeseed branching angle breeding.

[0020] The KASP primer set provided by this invention can directly and specifically distinguish and detect the T or C bases at SNP mutation sites. The application method of the KASP primer set provided by this invention is accurate, reliable, and easy to operate, making it suitable for identifying rapeseed branch angles and for assisted selection breeding.

[0021] The KASP primer set provided by this invention has the characteristics of low cost and high throughput in practical applications, and also has high specificity, making it particularly suitable for screening and identifying superior rapeseed plant type resources. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 The image shows a Manhattan plot of the genome-wide association analysis results for branching angles in rapeseed. The gray dashed line in the plot represents the significance threshold: -log10(P-value) = 6.11. Among them, A represents the analysis results of the GLM calculation model; B represents the analysis results of the AD test calculation model.

[0024] Figure 2This is a genotyping diagram of different rapeseed varieties using KASP primer pairs. The gray dots near the origin of the coordinate axis represent blank controls without template DNA; the green dots near the Y-axis and the blue dots near the X-axis represent rapeseed varieties carrying T allelic variants and rapeseed varieties carrying C allelic variants, respectively. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] The experimental materials used in this invention embodiment consist of 271 rapeseed germplasm resources provided by the team of Jiang Lixi at Zhejiang University. These resources are widely sourced and highly representative, encompassing local varieties, breeding materials, and cultivars from multiple major rapeseed producing regions worldwide, as well as other countries. Of these, 46 resources are from China, 82 from Germany, 23 from Poland, 21 from Sweden, and the remaining 99 from France, Japan, Canada, and Italy. The 271 rapeseed resources include 166 winter rapeseed, 54 spring rapeseed, and 51 semi-winter rapeseed (Table 1).

[0031] Table 1. Names and numbers of natural populations of rapeseed.

[0032]

[0033]

[0034]

[0035] Note: The above 271 rapeseed materials appear in the published literature with the corresponding numbers in Table 1 (Wu D, Liang Z, Yan T, et al. Whole-genome resequencing of a worldwide collection of rapeseed accessions reveals the genetic basis of ecotype divergence[J].Molecularplant,2019,12(1):30-43.https: / / doi.org / 10.1016 / j.molp.2018.11.007).

[0036] Example 1: Obtaining single nucleotide polymorphisms (SNPs) significantly associated with branching angles in rapeseed.

[0037] (1) Determining the branching angle: During the rapeseed maturity period, hold the camera so that the camera body is parallel to the plane formed by the branches and the main stem, and take photos of the 271 rapeseed materials in Table 1, including the angle between the base of the branches and the main stem. Use Photoshop software to measure the angle formed by the branches and the main stem.

[0038] (2) Genotyping: Based on the population resequencing data of 271 rapeseed materials in Table 1, BWA was used to align to the reference genome (Zhongshuang11), and SNP calling was performed using GATK.

[0039] (3) Genome-wide association analysis (GWAS): Using TASSEL software, with GLM and AD test models, genome-wide association analysis was performed on the branching angle phenotypic data of rapeseed. A total of 187 significant loci were detected, jointly explaining 64.3% of the phenotypic variation. Among them, the locus scaffoldA07_398704, located at 398,704 bp on chromosome A07 of the double 11 genome in rapeseed, was repeatedly detected in both models and is one of the most significant loci in the GLM model. Figure 1 At this position, a T-to-C substitution occurs, and the average branching angle of the T-type line is 4.8° greater than that of the C-type line. The nucleotide sequence of this SNP is shown in SEQ ID NO.1.

[0040] SEQ ID NO.1:

[0041] TTCTTCGAGCAAGATATCTGGACTCCAGCAACTAATTGAAGCCTCTGTAGCTAACGA GGAATCAGTTTGGACCAAGGTATATCTAATGAACCCTAGTACCACTCG[T / C]CGGAGTATT GGTCCTGACGTTTATAACTTATAGAGAACAATTCTT (The 106th bp of this sequence is an SNP site, indicating a T / C mutation.)

[0042] Example 2: Development of KASP-labeled specific primers

[0043] Using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), three primers were designed based on the sequence SEQ ID NO.1: upstream primer F1, upstream primer F2, and universal downstream primer R. The 3' ends of upstream primers F1 and F2 are allelic variants, and their 5' ends are linked to specific FAM and HEX fluorescent linker sequences (underlined) from the KASP reagent of LGC (Laboratory of the Government Chemist), UK. The sequences are as follows:

[0044] F1: 5'- gaaggtgaccaagttcatgct TCTAATGAACCCTAGTACCACTCGT-3' (SEQ ID NO. 2);

[0045] F2: 5'- gaaggtcggagtcaacggatt TAATGAACCCTAGTACCACTCGC-3' (SEQ ID NO. 3);

[0046] R: 5'-TTGTTCCTATAAGTTATAAACGTCAGG-3' (SEQ ID NO. 4).

[0047] Example 3: Detection of genotypes of extreme individual plants in a population and different rapeseed varieties at this SNP locus.

[0048] The KASP molecular marker-specific primers from Example 2 were used to amplify and genotype 134 rapeseed lines on a real-time quantitative PCR instrument.

[0049] From another population containing 424 resources, 134 lines were randomly selected, and genomic DNA was extracted from each rapeseed variety. Using the genomic DNA as a template, PCR amplification was performed using KASP-labeled specific primers to obtain PCR amplification products. PCR amplification was performed in an ABI 7500 real-time quantitative PCR instrument. After PCR, the instrument can perform genotyping based on the fluorescence signal. The amplification system was a 10 μL reaction system: 2 μL of 25 ng / μL rapeseed sample DNA template; 5 μL of 2×KASPMaster mix; 0.14 μL of KASP mixed primers, where F1:F2:R = 2:2:5 (V / V / V); 2.86 μL of water. The reaction conditions included: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61–55℃ for 60 sec, decreasing by 0.6℃ per cycle, for 10 cycles; and denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

[0050] After the reaction is complete, the ABI 7500 real-time quantitative PCR instrument directly reads the fluorescence data of the PCR reaction products. The fluorescence scan results are automatically converted into graphs, as shown in the figure. Figure 2 The branching angle measurements of these 134 rapeseed varieties are shown in Table 2. Figure 2 As shown in Table 2, the molecular marker primers can clearly separate the two genotypes. The dots near the Y-axis represent individual plants carrying the T allelic variant, defined as the TT genotype (95 plants, with an average branching angle of 44.4°). The dots near the X-axis represent individual plants carrying the C allelic variant, defined as the CC genotype (39 plants, with an average branching angle of 39.8°). The gray dots near the origin of the coordinate axes represent the blank control. The average branching angle of the rapeseed lines with the CC genotype is smaller than that of the rapeseed lines with the TT genotype.

[0051] Table 2134 rapeseed varieties, branching angles and genotypes.

[0052]

[0053]

[0054] Therefore, when using the KASP marker-specific primers developed in Example 2 to test rapeseed, if the genotype is CC according to the typing results, it is determined to be a rapeseed variety with a small branching angle; if the genotype is TT according to the typing results, it is determined to be a rapeseed variety with a large branching angle. The detection results are consistent with those of Example 1.

[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker related to the branching angle of rapeseed, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a T / C mutation exists at the 106th base. The genotypes at this mutation site include TT and CC genotypes.

2. A KASP primer set for detecting the molecular marker of claim 1, characterized in that, It includes upstream primer F1 with nucleotide sequence as shown in SEQ ID NO.2, upstream primer F2 with nucleotide sequence as shown in SEQ ID NO.3, and downstream primer R with nucleotide sequence as shown in SEQ ID NO.

4.

3. A detection kit for molecular markers as described in claim 1, characterized in that, It includes the KASP primer set as described in claim 2.

4. The application of the KASP primer set of claim 2 or the detection kit of claim 3 in identifying the branching angle of rapeseed.

5. A method for identifying the branching angle of rapeseed, characterized in that, Includes the following steps: Using the genomic DNA of the rapeseed sample to be tested as a template, the template is amplified by real-time PCR using the KASP primer set described in claim 2 or the detection kit described in claim 3. After the PCR amplification is completed, the fluorescence signal is read, the converted fluorescence signal is analyzed, the genotype is identified, and the branching angle of the rapeseed is determined based on the genotype. If the identified genotype is TT, the rapeseed sample to be tested is determined to be a sample with a large branch angle; if the identified genotype is CC, the rapeseed sample to be tested is determined to be a sample with a small branch angle.

6. The method according to claim 5, characterized in that, The procedure for quantitative real-time PCR amplification is as follows: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61–55℃ for 60 sec, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for 26 cycles.

7. The method according to claim 5, characterized in that, The quantitative PCR amplification system is as follows: 2 μL of 25 ng / μL DNA template; 5 μL of 2×KASPMaster mix; 0.14 μL of KASP mixed primers and 2.86 μL of water; the volume ratio of upstream primer F1, upstream primer F2 and downstream primer R in the KASP mixed primers is 2:2:

5.

8. The application of the KASP primer set of claim 2 or the detection kit of claim 3 in screening rapeseed varieties or lines with small branch angles.

9. The application of the KASP primer set of claim 2 or the detection kit of claim 3 in molecular marker-assisted breeding of rapeseed branching angle.

Images