RT-RPA / RAA detection kit and detection method for four Hunipah viruses
By designing specific primers and probes using recombinase polymerase amplification and recombinase-assisted amplification technologies, a Hennipa virus RT-RPA/RAA detection kit was developed. This kit solves the problems of complexity and equipment dependence of existing detection methods, enabling rapid and sensitive multiplex detection, and is suitable for on-site diagnosis in resource-limited areas.
Patent Information
- Application Number
- CN202511102534.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-07
- Publication Date
- 2025-10-17
AI Technical Summary
Existing Henipavirus detection methods have problems such as complex operation, long time consumption, high equipment dependence, and insufficient sensitivity. They are difficult to promote in areas with limited resources and lack rapid and sensitive multiple detection methods.
Using recombinase polymerase amplification (RPA) and recombinase-assisted amplification (RAA) technologies, specific primers and probes were designed, and four henipavirus RT-RPA/RAA detection kits were developed for the detection of Nipah virus (NiV), Langya virus (LayV), Mojiang virus (MoJV), and Cedar virus (Cedar virus). Simultaneous detection was achieved using a dual real-time fluorescence RT-RPA/RAA detection method.
It can simultaneously detect NiV, LayV, MoJV and CedV in a short time simply and quickly without the need for complex equipment. It is suitable for rapid on-site diagnosis and provides efficient public health support. The detection limit reaches 101-102 copies/μl and has good specificity and stability.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of virus detection, and specifically relates to four Henipavirus RT-RPA / RAA detection kits and detection methods. Background Art
[0002] Henipavirus has become an important monitoring target in the field of global public health due to its zoonotic nature and high mortality rate. [1-2] Nipah virus (NiV) is a pathogen that is operated in a biosafety level 4 laboratory (BSL-4). [2] (Langya henipavirus, LayV) was discovered in Shandong and Henan, China in 2022. Clinical manifestations include fever, respiratory symptoms and multiple organ damage. Mojiang virus [3] Mojiang virus (MoJV) was first discovered in Mojiang County, Yunnan Province, China. [4] Cedar virus (CedV) was first discovered in fruit bats in Queensland, Australia in 2009. All four viruses belong to the genus Henipavirus in the family Paramyxoviridae. Although there are currently no confirmed cases of human infection with MoJV and CedV, their widespread distribution in fruit bat hosts and their genetic similarity to NiV suggest that their potential to cross species barriers cannot be ignored. [4-5] This epidemiological feature, combined with environmental changes and the increased frequency of human-animal contact, poses a severe challenge to the prevention and control of Henipavirus-related epidemics. [6-7] Therefore, rapid and sensitive detection methods have become particularly important in the research and prevention of Henipavirus. The existing mainstream detection methods include virus isolation, ELISA, RT-PCR and qRT-PCR. [8-11] Among them, virus isolation needs to be performed in a BSL-4 laboratory, which is complex and time-consuming. Although ELISA can be used for antibody detection, it lacks sensitivity for early infection. RT-PCR has high sensitivity but relies on sophisticated instruments and professionals, making it difficult to promote in resource-limited areas.
[0003] In recent years, rapid molecular diagnostic techniques such as recombinase polymerase amplification (RPA) and recombinase-aided amplification (RAA) have gradually become ideal tools for efficient virus detection due to their advantages such as simple operation, rapid response, and low equipment dependence.
[12] RT-RPA and RT-RAA achieve amplification through recombinase-mediated double-stranded DNA melting and strand invasion, the former uses bacteriophage-derived recombinase, and the latter relies on bacterial / fungal-derived recombinase
[13] . SUMMARY
[0004] The purpose of the present application is to provide four kinds of Hendra virus RT-RPA / RAA detection kits and detection methods.
[0005] In the present application, the four kinds of Hendra virus include Nipah virus (NiV), Langyavirus (LayV), Mojiang virus (MoJV) and Cedar virus (CedV).
[0006] In order to achieve the purpose of the present application, in the first aspect, the present application provides four kinds of Hendra virus RT-RPA / RAA detection primers: The RT-RPA / RAA primers for detecting NiV are shown as SEQ ID NO: 2 and 3; The RT-RPA / RAA primers for detecting LayV are shown as SEQ ID NO: 6 and 8; The RT-RPA / RAA primers for detecting MojV are shown as SEQ ID NO: 12 and 14; The RT-RPA / RAA primers for detecting CedV are shown as SEQ ID NO: 17 and 19.
[0007] In the second aspect, the present application provides a probe used in cooperation with the RT-RPA / RAA detection primers: The probe for detecting Nipah virus is NiV-exo: CTGATCTTAAGAGAATGATTGATCACAGTAT [HEX-dt] [THF] [BHQ1-dt] GACTGAAAGCGTATTA-C3spacer (SEQ ID NO: 5); The probe for detecting Langyavirus is LayV-exo: AGGGTTGCTGCTGTCGTTCAAGGTGACAA [FAM-dt] C [THF] A [BHQ1-dt] CAATTGCGATAACTCA-C3spacer (SEQ ID NO: 10); The probe for detecting the MojV is MojV-exo: AACAAGTCCGACATGTCTGTCAGAGACCG[ROX-dt][THF][BHQ2-dt]TTTGATGAACCTGAGGGA-C3spacer (SEQ ID NO: 15); The probe for detecting the CedV is CedV-exo: GTGCTGACAGTAGGTCTGCAATGAATGAG[TAMRA-dt]C[THF]A[BHQ2-dt]GACAACAACATCCT-C3spacer (SEQ ID NO: 20).
[0008] In a third aspect, the present application provides application of the RT-RPA / RAA detection primer and the probe in preparation of a four-Henipavirus detection kit.
[0009] In a fourth aspect, the present application provides a four-Henipavirus RT-RPA / RAA detection kit, which contains the RT-RPA / RAA detection primer and the probe.
[0010] Further, the kit also contains positive and negative controls of the four-Henipavirus.
[0011] In a fifth aspect, the present application provides application of the RT-RPA / RAA detection primer and the probe, or the kit in detection of the four-Henipavirus (the application is not for the purpose of diagnosis and treatment of diseases).
[0012] In a sixth aspect, the present application provides a double real-time fluorescent RT-RPA / RAA detection method of the four-Henipavirus, in which the four-Henipavirus NiV, LayV, MojV and CedV are divided into two groups, group A including NiV and LayV, and group B including MojV and CedV, and the double real-time fluorescent RT-RPA / RAA detection is performed by using the RT-RPA / RAA detection primer and the probe, or by using the kit (the method is not for the purpose of diagnosis and treatment of diseases).
[0013] Further, the method comprises the following steps: (1) extracting nucleic acid as a template from a sample to be tested; (2) mixing the RT-RPA / RAA detection primer and the probe with RT-RPA / RAA fluorescent basic reaction reagents to obtain a reaction premix; then mixing the template obtained in step (1) with the reaction premix and a reaction starting buffer to perform double real-time fluorescent RT-RPA / RAA amplification reaction; (3) According to the fluorescence amplification signal of the double real-time fluorescence RT-RPA / RAA amplification reaction and whether there is an obvious amplification curve, it is judged whether the sample to be tested contains NiV, LayV, MojV and CedV.
[0014] Further, the A group and the B group are detected independently; The RT-RPA / RAA reaction system of each group is as follows: the total system is 50 μL, four primers (two forward primers and two reverse primers) are 2.1 μl each, two probes are 0.6 μl each, and the template is 2 μl; Among them, the concentration of the forward primer, the reverse primer and the probe is 10 μM.
[0015] Preferably, the RT-RPA / RAA reaction condition is: 39℃ reaction for 15-20min (preferably 15min).
[0016] By the above technical solution, the present application has at least the following advantages and beneficial effects: The present application adopts the RT-RPA / RAA technology, develops a double detection method, can simultaneously detect the L gene of NiV and LayV, and the N gene of MoJV and CedV. It has the advantages of simple operation, rapid reaction, and no need for complex equipment, etc., can simultaneously detect NiV, LayV, MoJV and CedV in a short time, especially suitable for on-site rapid diagnosis, and can provide efficient technical support for public health departments. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1A For the detection result of the double real-time fluorescence RT-RPA specificity test in the preferred embodiment of the present application, the figure shows that only the amplification curve of the target virus Lay and NiV nucleic acid appears, and other non-target virus nucleic acid does not appear amplification.
[0018] Figure 1B For the detection result of the double real-time fluorescence RT-RPA specificity test in the preferred embodiment of the present application, the figure shows that only the amplification curve of the target virus MojV and CedV nucleic acid appears, and other non-target virus nucleic acid does not appear amplification.
[0019] Figure 1C For the detection result of the double real-time fluorescence RT-RAA specificity test in the preferred embodiment of the present application, the figure shows that only the amplification curve of the target virus Lay and NiV nucleic acid appears, and other non-target virus nucleic acid does not appear amplification.
[0020] Figure 1D For the detection result of the double real-time fluorescence RT-RAA specificity test in the preferred embodiment of the present application, the figure shows that only the amplification curve of the target virus MojV and CedV nucleic acid appears, and other non-target virus nucleic acid does not appear amplification.
[0021] Figure 2A For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RPA in the preferred embodiment of the present application, the amplification curve of NiV is shown in the figure, and the minimum detection limit is 10 1 copies / μl.
[0022] Figure 2B For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RPA in the preferred embodiment of the present application, the amplification curve of LayV is shown in the figure, and the minimum detection limit is 10 1 copies / μl.
[0023] Figure 2C For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RPA in the preferred embodiment of the present application, the amplification curve of MojV is shown in the figure, and the minimum detection limit is 10 2 copies / μl.
[0024] Figure 2D For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RPA in the preferred embodiment of the present application, the amplification curve of CedV is shown in the figure, and the minimum detection limit is 10 2 copies / μl.
[0025] Figure 2E For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RAA in the preferred embodiment of the present application, the amplification curve of NiV is shown in the figure, and the minimum detection limit is 10 2 copies / μl.
[0026] Figure 2F For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RAA in the preferred embodiment of the present application, the amplification curve of LayV is shown in the figure, and the minimum detection limit is 10 2 copies / μl.
[0027] Figure 2G For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RAA in the preferred embodiment of the present application, the amplification curve of MojV is shown in the figure, and the minimum detection limit is 10 2 copies / μl.
[0028] Figure 2H For the results of the sensitivity and stability detection of the double real-time fluorescent RT-RAA in the preferred embodiment of the present application, the amplification curve of CedV is shown in the figure, and the minimum detection limit is 10 2 copies / μl. DETAILED DESCRIPTION
[0029] The application aims to provide a double real-time fluorescence reverse transcription-recombinase polymerase amplification / recombinase-aided amplification (RT-RPA / RAA) detection method for rapidly and accurately identifying Nipah virus (NiV), Langya virus (LayV), Mojiang virus (MoJV) and Cedar virus (CedV).
[0030] The application adopts the following technical scheme: Specific primers and probes are designed for the conserved regions of L genes of NiV and LayV and the conserved regions of N genes of MoJV and CedV, and the four viruses are divided into two groups (group A includes NiV and LayV, and group B includes MoJV and CedV) for double detection. The amplification efficiency of different primer pairs (F1 / R1, F1 / R2, F2 / R1 and F2 / R2) is compared to screen the best primer and probe combination; the reaction temperature and the concentrations of primers and probes are optimized to establish a double real-time fluorescence RT-RPA / RAA detection system, the specificity, sensitivity and stability of the system are verified, and finally the detection effect of the method is verified by using clinical samples.
[0031] The screened primer pairs are shown in Table 1 (NiV primer pair NiV-F2 / NiV-R1, LayV primer pair LayV-F1 / LayV-R1, MoJV primer pair MoJV-F2 / MoJV-R2 and CedV primer pair CedV-F2 / CedV-R2), which all exhibit the best amplification effect when combined with the corresponding probes. The best annealing temperature is 39 o C; the minimum detection limit is 10 1 -10 2 copies / μl. The method can effectively distinguish the target virus from other non-target viruses, and repeated experiments show that the method has good stability R 2 >0.90). In addition, the detection results of the NiV Malaysia strain nucleic acid and various clinical samples are consistent with those of the multiplex qRT-PCR (Taqman probe method).
[0032] The following examples are used to illustrate the application, but are not used to limit the scope of the application. If not specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art, and the raw materials used are commercially available.
[0033] Example Dual real-time fluorescent RT-RPA / RAA detection method for four henipaviruses 1Materials and methods 1.1Nucleic acid samples and clinical samples One portion of NiV wild type Malaysia strain nucleic acid (provided by National Virus Resource Center, CSTR:16533.06.IVCAS 16.00059), one portion of Human Metapneumovirus (HMPV) nucleic acid, one portion of Respiratory Syncytial Virus (RSV) nucleic acid, one portion of Human Parainfluenza Virus Type 3 (HPIV-3) nucleic acid and one portion of Human Parainfluenza Virus Type 4 (HPIV-4) nucleic acid (all provided by Virus Resource Center of China CDC), 37 portions of clinical throat swab samples (collected from fever patients in Ditan Hospital, Beijing), 24 portions of bat anal swab samples (collected from Xiaozhu and Yuteng villages, Huaiji County, Zhaoqing, Guangdong Province), and 33 portions of bat throat swab samples (collected from Dongyuan County, Heyuan, Guangdong Province) were stored and provided by Virus Resource Center of China CDC.
[0034] 1.2Sample processing and nucleic acid extraction RNA extraction of clinical throat swab samples and bat swab samples was performed using QIAamp Viral RNA Mini Kit (QIAGEN, Germany) according to the instructions. Each batch of extraction contained a negative control (RNase-free water) and a positive control (a sample known to contain the target virus). The extracted RNA was finally dissolved in 50 μl of RNase-free water.
[0035] 1.3 Synthesis of genes, primers and probes LayV (212 bp, located in the partial gene sequence of LayV L gene sequence (Genbank No. OM101125.1) at 2321-2532 bp) and NiV (221 bp, located in the partial gene sequence of NiV L gene sequence (Genbank No. NC_002728.1) at 3029-3249 bp), MojV (205 bp, located in the partial gene sequence of MojV N gene sequence (Genbank No. NC_025352.1) at 1363-1567 bp) and CedV (188 bp, located in the partial gene sequence of CedV N gene sequence (Genbank No. NC_025351.1) at 1320-1507 bp) were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. The synthesized DNA was cloned into pUC57 vector plasmid. RT-RAA nucleic acid amplification kit (fluorescence method) was purchased from Hangzhou Zhongce Biological Technology Co., Ltd.; TwistAmp® Liquid exo / exo RT kit (RT-RPA nucleic acid amplification kit) was purchased from TwistDx limited company; RAA-F1620 constant temperature nucleic acid amplification detector was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd.; RAA-B6108 sample pretreatment system was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd. Specific forward and reverse primers and probes were designed for the conserved regions of the L genes of NiV and LayV, and the N genes of MojV and CedV using Beacon Designer 7.9 (Table 1). All RPA / RAA primers and probes were purified by high performance liquid chromatography (HPLC) and diluted to a working concentration of 10 μmol / L.
[0036] Table 1 RT-RPA / RAA primer and probe sequences for detection of Nipah virus, Langya virus, Mojing virus and Cedarn virus (SEQ ID NO: 1-20)
[0037] Note: aReference genome information: NiV L gene sequence (Genbank No. NC_002728.1), LayV L gene sequence (Genbank No. OM101125.1), MojV N gene sequence (Genbank No. NC_025352.1), CedV N gene sequence (Genbank No. NC_025351.1). HEX (Hexachlorofluorescein), FAM (6-Carboxyfluorescein), ROX (Carboxy-X-Rhodamine), TAMRA (Tetramethylcarboxyrhodamine): fluorescent reporter groups; THF (Tetrahydrofuran): abasic nucleotide mimics; BHQ1-dT / BHQ2-dt (Black Hole Quencher 1 / 2-Deoxythymidine): quenching groups; Spacer C3 (three-carbon spacer): blocking group to prevent polymerase extension.
[0038] 1.4Establishment of real-time fluorescent RT-RPA / RAA nucleic acid detection method The real-time fluorescent RT-RPA detection method was established in a total reaction system of 50 μl, and the reagent configuration was performed according to the kit instructions. First, a premix solution of primers and probes was prepared, including 2x reaction buffer, dNTP, 10x Probe E-mix (10x RPA core enzyme component), forward and reverse primers and probes, and a suitable amount of enzyme-free water to the total volume, oscillation mixing and short centrifugation. Then 20x Core Reaction Mix (20x core enzyme reaction mixture) and 50x Exo (50x exonuclease) were added to the reaction tube, mixed uniformly and centrifuged. The premix solution was transferred to the PCR tube, 280 mM MgOAc and template were added, and the setting was 37 o C to 42 o C reaction for 20 min, and the reaction results were observed in real time.
[0039] The real-time fluorescent RT-RAA detection method was established: according to the reagent configuration of the kit instructions, the buffer VI, the forward and reverse primers, the probe and the purified water were added to the reaction tube, and the centrifugation was mixed uniformly. Add the reaction system to the RT fluorescence basic reaction unit, gently shake the freeze-dried powder to dissolve it, avoid violent shaking. Add magnesium acetate I and standard plasmid template or sample RNA for pre-amplification. Put the reaction tube into the constant temperature amplification instrument, set 39 o C reaction for 15 min, and the reaction process was observed in real time.
[0040] 1.5 Optimization of reaction temperature, primers and probes To determine the optimal reaction temperature, the prepared RT-RPA reaction tubes were placed under 37 o C, 38 o C, 39 o C, 40 o C, 41 o C and 42 o C conditions for 20 min, and the fluorescence signal was collected every 30 s. By comparing the fluorescence signal intensity and the time to reach the threshold under each temperature condition, the optimal reaction temperature was determined. Each temperature was tested in triplicate to ensure the reliability of the results. The designed two pairs of specific primers and probes were paired to form four different combinations (F1 / R1, F1 / R2, F2 / R1, F2 / R2) for RPA reaction using NiV-pUC57-L, LayV-pUC57-L, MojV-pUC57-N and CedV-pUC57-N plasmids as templates. By comparing the amplification efficiency and specificity of different primer combinations, the optimal primer pair combination was determined.
[0041] 1.6 Establishment and grouping of dual real-time fluorescence RT-RPA / RAA reaction conditions To optimize the amplification effect of the RT-RPA / RAA detection method for the four viruses, the target viruses were divided into two groups: Group A included NiV and LayV, and Group B included MojV and CedV. RT-RPA / RAA reactions were performed as follows: 50 μL reaction volume, 2.1 μl of each of the four primers (two forward primers and two reverse primers), 0.6 μl of each of the two probes, and 2 μl of template.
[0042] 1.7 Specificity, sensitivity and stability detection of dual real-time fluorescence RT-RPA / RAA nucleic acid Using NiV, LayV, MojV, and CedV plasmids as templates, cross-detection was performed to verify the specificity of each detection system. Meanwhile, HMPV, RSV, HPIV-3 and HPIV-4 mixed nucleic acids were used as templates for detection, and RNase-free water was used as a negative control. Positive controls were set up to analyze the specificity of the detection system.
[0043] NiV, LayV, MojV, and CedV plasmid standards were diluted 10-fold to 10 copies / μl, with a concentration range of 10 1 to 10 8 copies / μl for sensitivity detection. Three parallel samples were set up for each concentration, and the positive detection rate and fluorescence curve characteristics of each concentration gradient were recorded and analyzed to determine the detection limit of the method.
[0044] To evaluate the stability of the method, four concentration gradients (10 3 to 10 6Five batches of experiments were repeated with three parallel wells for each experiment. The detection rate and average Ct The value (number of cycles required to reach the threshold) and the coefficient of variation (CV) were plotted against the logarithm of the template copy number (log 10 ) is the X-axis, Ct The values are the standard curve of the Y axis, and the correlation coefficient is calculated by linear regression analysis ( R 2 ), to evaluate the stability of the method.
[0045] 1.8 Application of the Dual Real-Time Fluorescence RT-RPA / RAA Nucleic Acid Detection Method The established dual real-time fluorescence RT-RPA / RAA method was used to detect clinical throat swab samples and bat swab samples to verify its clinical application potential. In addition, the Taqman multiplex qRT-PCR method for NiV, LayV, MojV, and CedV was used. [9] All samples were tested in parallel to compare the consistency of the test results of the two methods.
[0046] 1.9 Statistical Methods GraphPad Prism 8.0 software was used for data analysis and graphing. The mean, standard deviation, and CV were calculated for each experimental condition.
[0047] 2 Results 2.1 Optimization of real-time fluorescence RT-RPA reaction temperature For NiV in group A and MojV in group B, the fluorescence intensity (RFU) and Ct The results show that at 39 o Under the reaction conditions of C, NiV and MojV both reached the detection threshold within the 3rd to 5th cycle, and the RFU was the highest at this temperature, with average RFU of 19528 and 24541, respectively. o C and 38 o Although the fluorescence signal can be detected at 41 °C, the time to reach the detection threshold is prolonged and the RFU is relatively low. o C and 42 o Under C conditions, the fluorescence signal appeared earlier, which may be due to the increase of nonspecific amplification. o C is the optimal temperature for real-time fluorescence RT-RPA reaction.
[0048] 2.2 Real-time fluorescent RT-RPA / RAA primer and probe screening results For NiV, LayV, MojV and CedV, multiple sets of primer pairs were designed. The best combination was screened by comparing the amplification efficiency and RFU of each combination. The results showed that the primer pairs F2 / R1 for NiV, F1 / R1 for LayV, F2 / R2 for MojV and F2 / R2 for CedV had the highest amplification efficiency when combined with the corresponding probes, with RFU of 17767, 11464, 12205 and 21870, respectively.
[0049] 2.3 Specific detection results of duplex real-time fluorescent RT-RPA / RAA The detection results of A group and B group virus standards and other non-target virus nucleic acids (including HMPV, RSV, HPIV-3 and HPIV-4) showed that only the standards of NiV and LayV in A group appeared specific amplification curves. No amplification signal appeared in non-target virus nucleic acids and negative controls Figure 1A and Figure 1B ). The standards of MojV and CedV in B group showed specific amplification, and other non-target virus nucleic acids and negative controls had no amplification reaction Figure 1C and Figure 1D ). In addition, there was no obvious cross-reaction between the two viruses in the same group, indicating that the established duplex real-time fluorescent RT-RPA / RAA detection method had high specificity and only produced amplification reaction for target viruses.
[0050] 2.4 Sensitivity and stability detection results of duplex real-time fluorescent RT-RPA / RAA The results showed that in the RT-RPA method, the minimum detection limit of NiV and LayV was 10 1 copies / μl Figure 2A and Figure 2B ). The minimum detection limit of MojV and CedV was 10 2 copies / μl Figure 2C and Figure 2D ). In the RT-RAA method, the minimum detection limit of the four viruses was 10 2 copies / μl Figure 2E~Figure 2H . This result showed that the RT-RPA method had slightly higher sensitivity for NiV and LayV, while for MojV and CedV, the sensitivity of the two methods was comparable.
[0051] Ten 3 to 10 6 copies / μl of plasmid standard were tested five times independently. The R 20.9938, LayV 0.9180, MojV 0.9267, CedV 0.9889, respectively; in the RT-RAA method R 2 0.9057, LayV 0.9828, MojV 0.9267, CedV 0.9742, respectively. The CV of all target viruses were greater than 0.90, and the CV were less than 5%, indicating that the detection method had good repeatability and stability. R 2
[0052] 2.5 Detection results of clinical samples by duplex real-time fluorescent RT-RPA / RAA The results showed that the nucleic acid detection result of NiV wild-type Malaysia strain was positive, and the nucleic acid detection results of 37 throat swab samples of patients with fever, 24 anal swab samples of bats, and 33 throat swab samples of bats were all negative.
[0053] All samples were detected in parallel by NiV, LayV, MojV, and CedV Taqman multiplex qRT-PCR method (see CN117737309A). The results showed that for the detection of NiV and LayV, the results of the two methods were completely consistent, the positive consistency rate was 100% (1 / 1, 1 NiV wild-type Malaysia strain nucleic acid), the negative consistency rate was 100% (94 / 94, 37 throat swab samples of patients with fever, 24 anal swab samples of bats, and 33 throat swab samples of bats), and the overall consistency rate was 100% (95 / 95), indicating that the two methods had very high consistency. For the detection of MojV and CedV, the negative consistency rates of the two methods were both 100% (95 / 95), and no positive sample was detected.
[0054] 3 DISCUSSION The impact of COVID-19 highlights the need for more effective and accurate diagnostic methods in the early control of infectious diseases. The emergence of LayV further emphasizes this need in public health systems. Although LayV has not yet caused large-scale infection, Henipavirus has historically caused widespread infection and death in humans and livestock [14-15] In addition, the potential natural host of wild animals and the route of transmission through saliva or respiratory secretions also indicate the need to establish a rapid, accurate and instant method for detecting the virus.
[0055] At present, there are many methods for detecting the nucleic acid of NiV, LayV, MojV, and CedV. The NiV and LayV detection methods reported in recent years are mainly based on conventional RT-PCR and qRT-PCR. Wu et al
[16] The CRISPR-Cas12a system combined with the RPA technology is used to establish a rapid detection method for LayV, and the detection methods for MojV and CedV are more limited. At present, there is no real-time fluorescent RT-RPA / RAA-based Hendravirus detection method, and related research has not combined a multiple detection strategy to improve detection efficiency. Therefore, the L gene fragments of NiV and LayV, and the N gene fragments of MojV and CedV are used as targets to screen out primers and probes with the best amplification efficiency, and the four viruses are divided into two groups: group A for NiV and LayV, and group B for MojV and CedV, and double real-time fluorescent RT-RPA / RAA detection methods are established.
[0056] Compared with the traditional qRT-PCR method, the double real-time fluorescent RT-RPA / RAA detection method established in the application has a detection limit of 10 1 -10 2 copies / μl, and the sensitivity is equivalent, but the detection time is greatly shortened to 15-20 min (while qRT-PCR generally needs 60-90 min). The specific detection results show that the method only produces amplification reaction for the target virus, and has no cross reaction with other respiratory viruses (HMPV, RSV, HPIV-3, HPIV-4), and exhibits good detection specificity. Stability analysis shows that the values of four viruses are all greater than 0.90, and the CV is less than 5%, which shows excellent repeatability. R²
[0057] The double real-time fluorescent RT-RPA / RAA detection method provided by the application can quickly and accurately identify and distinguish the four important Hendravirus, NiV, LayV, MoJV and CedV, and has the characteristics of simple operation, rapid reaction, strong specificity, good stability and the like, and provides an effective molecular detection tool for on-site rapid diagnosis, epidemic monitoring and prevention and control of viruses.
[0058] Although the application has been described in detail above with general description and specific embodiments, some modifications or improvements can be made on the basis of the application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the application, all belong to the scope of protection claimed by the application.
[0059] Reference: [1] Diederich S, Babiuk S, Boshra H. A Survey of Henipavirus Tropism-Our Current Understanding from a Species / Organ and Cellular Level [J]. Viruses, 2023, 15(10): 2048. DOI: 10.3390 / v15102048. [2] Zhang XA, Li H, Jiang FC, et al. A Zoonotic Henipavirus in Febrile Patients in China [J]. N Engl J Med, 2022, 387(5): 470-472. DOI:10.1056 / NEJMc2202705. [3] Wu Z, Yang L, Yang F, et al. Novel Henipa-like virus, Mojiang Paramyxovirus, in rats, China, 2012 [J]. Emerg Infect Dis, 2014, 20(6): 1064-1066. DOI: 10.3201 / eid2006.131022. [4] Marsh GA, Jong CD, Barr JA, et al. Cedar virus: a novel Henipavirus isolated from Australian bats [J]. PLoS Pathog, 2012, 8(8):e1002836. DOI: 10.1371 / journal.ppat.1002836. [5] Sabir AJ, Rong LJ, Broder CC, et al. Cedar virus biology and its applications as a surrogate for highly pathogenic henipaviruses [J]. Cell Insight, 2024, 3(4), 100181. DOI: 10.1016 / j.cellin.2024.100181. [6] Peel AJ, Sargan DR, Baker KS, et al. Continent-wide panmixia of an African fruit bat facilitates transmission of potentially zoonotic viruses [J]. Nat Commun, 2013, 4, 2770. DOI: 10.1038 / ncomms3770. [7] Madera S, Kistler A, Ranaivoson HC, et al. Discovery and Genomic Characterization of a Novel Henipavirus, Angavokely Virus, from Fruit Bats in Madagascar [J]. J Virol, 2022, 96(18), e0092122. DOI: 10.1128 / jvi.00921-22. [8] Mazzola LT, Kelly-Cirino C. Diagnostics for Nipah virus: a zoonotic pathogen endemic to Southeast Asia [J]. BMJ Glob Health, 2019, 4(Suppl 2): e001118. DOI: 10.1136 / bmjgh-2018-001118. [9] Bergeron É, Chiang CF, Lo MK, et al. Streamlined detection of Nipah virus antibodies using a split NanoLuc biosensor [J]. Emerg Microbes Infect, 2024, 13(1): 2398640. DOI: 10.1080 / 22221751.2024.2398640.
[10] Pollak NM, Olsson M, Marsh GA, et al. Evaluation of three rapid low-resource molecular tests for Nipah virus [J]. Front Microbiol, 2023, 13:1101914. DOI: 10.3389 / fmicb.2022.1101914.
[11] He WJ, Ma T, Wang YL, et al. Development and evaluation of a quadruple real-time fluorescence-based quantitative reverse transcription polymerase chain reaction assay for detecting Langya, Mojiang, Nipah, and Cedar viruses [J]. Biosaf Health, 2024, 6(2): 80-87. DOI: 10.1016 / j.bsheal.2024.02.002.
[12] Daher RK, Stewart G, Boissinot M, et al. Recombinase Polymerase Amplification for Diagnostic Applications [J]. Clin Chem, 2016, 62(7): 947-958. DOI: 10.1373 / clinchem.2015.245829.
[13] Wu T, Ge YY, Zhao KC, et al. A reverse-transcription recombinase-aided amplification assay for the rapid detection of N gene of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2) [J]. Virology, 2020, 549: 1-4. DOI: 10.1016 / j.virol.2020.07.006.
[14] Gazal S, Sharma N, Gazal S, et al. Nipah and Hendra Viruses:Deadly Zoonotic Paramyxoviruses with the Potential to Cause the Next Pandemic[J]. Pathogens, 2022, 11(12): 1419. DOI: 10.3390 / pathogens11121419.
[15] Adesola RO, Miranda AV, Tran YSJ, et al. Langya virus outbreak:current challenges and lesson learned from previous henipavirus outbreaks inChina, Australia, and Southeast Asia [J]. Bull Natl Res Cent, 2023, 47(1):87-92. DOI: 10.1186 / s42269-023-01064-3.
[16] Wu X, Xiang R, Yang D, et al. HRP-integrated CRISPR-Cas12abiosensor for rapid point-of-care detection of Langya henipavirus [J].iScience, 2024, 27(12): 111466. DOI: 10.1016 / j.isci.2024.111466.
Claims
1. Four Henipavirus RT-RPA / RAA detection primers, characterized in that: The four henipaviruses include Nipah virus (NiV), Langya virus (LayV), Mojiang virus (MoJV) and Cedar virus (CedV); The RT-RPA / RAA primers used for NiV detection are shown in SEQ ID NOs: 2 and 3; The RT-RPA / RAA primers used for detecting LayV are shown in SEQ ID NOs: 6 and 8; The RT-RPA / RAA primers used to detect MojV are shown in SEQ ID NOs: 12 and 14; The RT-RPA / RAA primers used for detecting CedV are shown in SEQ ID NOs: 17 and 19.
2. A probe for use with the RT-RPA / RAA detection primer according to claim 1, characterized in that: The probe used to detect Nipah virus was NiV-exo: CTGATCTTAAGAGAATGATTGATCACAGTAT[HEX-dt][THF][BHQ1-dt]GACTGAAAGCGTATTA-C3spacer; The probe used to detect Langya virus was LayV-exo: AGGGTTGCTGCTGTCGTTCAAGGTGACAA[FAM-dt]C[THF]A[BHQ1-dt]CAATTGCGATAACTCA-C3spacer; The probe used to detect Mojiang virus was MojV-exo: AACAAGTCCGACATGTCTGTCAGAGACCG[ROX-dt][THF][BHQ2-dt]TTTGATGAACCTGAGGGA-C3spacer; The probe used to detect cedar virus is CedV-exo: GTGCTGACAGTAGGTCTGCAATGAATGAG[TAMRA-dt]C[THF]A[BHQ2-dt]GACAACAACATCCT-C3spacer.
3. Use of the RT-RPA / RAA detection primers according to claim 1 and the probes according to claim 2 in the preparation of four Henipavirus detection kits; The four henipaviruses are NiV, LayV, MojV and CedV.
4. Four Henipavirus RT-RPA / RAA detection kits, characterized in that: The kit contains the RT-RPA / RAA detection primer according to claim 1 and the probe according to claim 2.
5. The detection kit according to claim 4, characterized in that The kit also contains positive and negative controls for four henipaviruses.
6. Use of the RT-RPA / RAA detection primer according to claim 1 and the probe according to claim 2, or the kit according to claim 4 or 5, in the detection of four henipaviruses, wherein the four henipaviruses are NiV, LayV, MojV, and CedV; The application is not intended for the diagnosis and treatment of diseases.
7. A dual real-time fluorescence RT-RPA / RAA detection method for four henipaviruses, characterized in that: Four henipaviruses, NiV, LayV, MojV, and CedV, were divided into two groups, Group A included NiV and LayV, and Group B included MojV and CedV, and dual real-time fluorescence RT-RPA / RAA detection was performed using the RT-RPA / RAA detection primers of claim 1 and the probe of claim 2, or using the kit of claim 4 or 5; The method is not intended for the diagnosis and treatment of diseases.
8. The method according to claim 7, characterized in that The following steps are involved: (1) Extracting nucleic acid from the sample to be tested as a template; (2) mixing the RT-RPA / RAA detection primers and probes with the RT-RPA / RAA fluorescence basic reaction reagent to obtain a reaction premix; then mixing the template obtained in step (1) with the reaction premix and the reaction start buffer to perform a dual real-time fluorescence RT-RPA / RAA amplification reaction; (3) Determine whether the sample contains NiV, LayV, MojV, or CedV based on the fluorescence amplification signal of the dual real-time fluorescence RT-RPA / RAA amplification reaction and whether there is a clear amplification curve.
9. The method according to claim 8, characterized in that The tests of Group A and Group B were performed independently; The RT-RPA / RAA reaction system for each group was as follows: 50 μL total system, 2.1 μL each of the four primers, 0.6 μL each of the two probes, and 2 μL of template; The concentrations of the forward primer, reverse primer, and probe were all 10 μM.
10. The method according to claim 8 or 9, characterized in that The RT-RPA / RAA reaction conditions are: 39°C for 15-20 minutes.
Citation Information
Patent Citations
Primer probe group and kit for dual RT-RAP detection of norovirus and rotavirus and application of primer probe group and kit
CN115927746A
Quadruple qRT-PCR method for yellow virus, ink river virus, nipah virus and cedar virus
CN117737309A
Primer probe combination, kit and method for simultaneously detecting chicken infectious anemia virus and chicken circle virus type 3 based on fluorescent RAA and application
CN120400431A